Explorer l'espace de séquence pour identifier les sites de liaison pour les protéines de liaison de l'ARN réglementaires

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La spécificité de la séquence est essentielle à la régulation des gènes. Les protéines réglementaires qui reconnaissent des séquences spécifiques sont importantes pour la régulation des gènes. Définir des sites de liaison fonctionnels pour de telles protéines est un problème biologique difficile. Une approche itérative pour l'identification d'un site de liaison pour une protéine liant l'ARN est décrite ici et s'applique à toutes les protéines liant l'ARN.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Singh, R. Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins. J. Vis. Exp. (150), e59635, doi:10.3791/59635 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La régulation génique joue un rôle important dans toutes les cellules. Des étapes transcriptionnelles, post-transcriptionnelles (ou de traitement de l'ARN), translationnelles et post-traductionnelles sont utilisées pour réguler des gènes spécifiques. Les protéines de liaison à l'acide nucléique spécifiques à la séquence ciblent des séquences spécifiques pour contrôler l'expression des gènes spatiaux ou temporels. Les sites de liaison dans les acides nucléiques sont généralement caractérisés par une analyse mutationnelle. Cependant, de nombreuses protéines d'intérêt n'ont pas de site de liaison connu pour une telle caractérisation. Ici nous décrivons une approche pour identifier les emplacements de liaison précédemment inconnus pour les protéines RNA-contraignantes. Il s'agit d'une sélection itérative et d'amplification des séquences à partir d'un pool de séquences randomisée. Après plusieurs tours de ces étapes-transcription, liaison et amplification- les séquences enrichies sont séquencées pour identifier un site de liaison préféré. Le succès de cette approche est surveillé à l'aide d'essais de liaison in vitro. Par la suite, des essais fonctionnels in vitro et in vivo peuvent être utilisés pour évaluer la pertinence biologique des séquences sélectionnées. Cette approche permet l'identification et la caractérisation d'un site de liaison jusque-là inconnu pour toute protéine liant l'ARN pour laquelle il existe un test visant à séparer les ARN liés aux protéines et non liés.

Introduction

En biologie cellulaire, la régulation des gènes joue un rôle central. À une ou plusieurs étapes le long de la voie d'expression génique, les gènes ont le potentiel d'être régulés. Ces étapes incluent la transcription (initiation, allongement et terminaison) ainsi que l'épissage, la polyadenylation ou la formation de fin de 3', l'exportation d'ARN, la traduction d'ARNm, et la décomposition/localisation des transcriptions primaires. À ces étapes, les protéines nucléiques liant l'acide modulent la régulation des gènes. L'identification des sites de liaison pour ces protéines est un aspect important de l'étude du contrôle génétique. L'analyse mutationnelle et la comparaison phylogénétique de séquence ont été employées pour découvrir des séquences réglementaires ou des emplacements protéine-contraignants dansles acides nucléiques, tels que des promoteurs, des emplacements d'épissage, des éléments de polyadenylation, et des signaux translationnels 1,, 2 (en) , 3 (en) , 4.

L'épissage pré-ARNm est une étape intégrale lors de l'expression et de la régulation des gènes. La majorité des gènes des mammifères, y compris ceux chez l'homme, ont des introns. Une grande fraction de ces transcriptions est alternativement épissée, produisant l'ARNm multiple et les isoformes de protéine du même gène ou transcription primaire. Ces isoformes ont des rôles spécifiques aux cellules et développementaux dans la biologie cellulaire. Le site d'épissage de 5 pi, le point de branche et le site d'épissage de polypyrimidine/3' sont des signaux d'épissage critiques qui sont soumis à la réglementation. En régulation négative, un site d'épissage par ailleurs fort est réprimé, tandis que dans une réglementation positive, un site d'épissage par ailleurs faible est activé. Une combinaison de ces événements produit une pléthore d'isoformes fonctionnellement distincts. Les protéines liant l'ARN jouent un rôle clé dans ces événements d'épissage alternatifs.

De nombreuses protéines sont connues dont le site de liaison ou les cibles de l'ARN restent à identifier5,6. Lier les protéines régulatrices à leurs cibles ou séquences biologiques en aval est souvent un processus complexe. Pour ces protéines, l'identification de leur ARN cible ou de leur site de liaison est une étape importante dans la définition de leurs fonctions biologiques. Une fois qu'un site de liaison est identifié, il peut être caractérisé davantage à l'aide d'analyses moléculaires et biochimiques standard.

L'approche décrite ici présente deux avantages. Tout d'abord, il peut identifier un site de liaison jusque-là inconnu pour une protéine d'intérêt. Deuxièmement, un avantage supplémentaire de cette approche est qu'elle permet simultanément la mutagénèse de saturation, qui serait autrement laborieuse pour obtenir des informations comparables sur les exigences de séquence dans le site de liaison. Ainsi, il offre un outil plus rapide, plus facile et moins coûteux pour identifier les sites de liaison des protéines dans l'ARN. À l'origine, cette approche (SELEX ou Systematic Evolution of Ligands par eXponential enrichment) a été utilisée pour caractériser le site de liaison de la polymérase d'ADN bactériophage T4 (protéine du gène 43), qui chevauche le site de liaison ribosome dans son propre ARNm. Le site de liaison contient une séquence de boucle de 8 bases, représentant 65 536 variantes randomisées pour l'analyse7. Deuxièmement, l'approche a également été utilisée indépendamment pour montrer que des sites de liaison spécifiques ou des aptamers pour différents colorants peuvent être sélectionnés à partir d'un pool d'environ 13 séquences8. En fait, cette approche a été largement utilisée dans de nombreux contextes différents pour identifier les aptamers (ARN ou séquences d'ADN) pour lier de nombreux ligands, tels que les protéines, les petites molécules et les cellules, et pour la catalyse9. À titre d'exemple, un aptamer peut faire la distinction entre deux dérivés de la xanthine, la caféine et la théophylline, qui diffèrent par la présence d'un groupe méthyle dans la caféine10. Nous avons largement utilisé cette approche (SELEX ou sélection-amplification itérative) pour étudier comment les protéines liant l'ARN fonctionnent dans l'épissage ou l'épissage du règlement11, qui sera la base de la discussion ci-dessous.

La bibliothèque aléatoire: Nous avons utilisé une bibliothèque aléatoire de 31 nucléotides. La longueur de la bibliothèque aléatoire était vaguement basée sur l'idée que le facteur d'épissage général U2AF65 se lie à une séquence entre la séquence de point de branche et le site d'épissage de 3'. En moyenne, l'espacement entre ces signaux d'épissage chez les métazoaires est de l'ordre de 20 à 40 nucléotides. Une autre protéine Sex-létale a été connu pour se lier à une séquence réglementaire mal caractérisée près du site d'épissage 3' de son objectif pré-ARNm, transformateur. Ainsi, nous avons choisi une région aléatoire de 31 nucléotides, flanquéde de sites de liaison d'apprêt avec des sites d'enzymes de restriction pour permettre l'amplification de PCR et l'attachement du promoteur de polymère d'ARN T7 pour la transcription in vitro. La taille ou la complexité théorique de la bibliothèque était de 431 ou environ 1018. Nous avons utilisé une petite fraction de cette bibliothèque pour préparer notre pool d'ARN aléatoire (1012-1015) pour les expériences décrites ci-dessous.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

REMARQUE : La figure 1 fournit un résumé des étapes clés du processus de sélection-amplification itérative (SELEX).

1. Génération d'un modèle de bibliothèque aléatoire

  1. Synthétiser l'amorce avant 5'- GTAATACGACTCACTATAGGGTGATCAGATTCTGATCCA-3' et l'amorce inverse 5'- GCGACGGATCCAAGCTTCA-3' par synthèse chimique sur un synthétiseur d'ADN.
    REMARQUE : Les amorces et la bibliothèque aléatoire peuvent être synthétisées commercialement.
  2. Synthétiser un modèle d'oligonucléotide aléatoire de bibliothèque 5'- GGTGATCAGATTCTGATCCA(N1... N31)TGAAGCTTGGATCCGTCGC-3' par synthèse chimique. Utilisez un mélange équimolaire de quatre phosphoramidites lors de la synthèse pour les 31 positions randomisées indiquées ci-dessus sous le titre N.
    REMARQUE : La séquence du modèle de bibliothèque contient 31 nucléotides aléatoires (N1 à N31) et des séquences de flanc pour la liaison des amorces avant et inverses. L'apprêt avant comprend la séquence de promoteur de polymérase d'ARN T7 (soulignée) pour la transcription in vitro et un site de restriction Bcl1 (italique) pour le clonage. L'amorce inverse contient des sites d'enzymes de restriction BamH1 et HindIII (italique) pour faciliter le clonage.

2. Génération du pool de bibliothèque aléatoire d'ADN

  1. Attachez le promoteur de la polymérase d'ARN T7 à la bibliothèque par réaction en chaîne de polymérase (PCR) contenant 1 modèle de bibliothèque aléatoire d'ADN, 1 M de chaque amorce, 20 mM Tris (pH 8,0), 1,5 mM MgCl2, 50 mM KCl, 0,1 g/L d'albumine de sérum bovin acétylé, 2 unités d'albumine de sérum bovin taq /c1MD polymérase, et 200 M chacun de dNTPs (deoxyguanosine, deoxyadenosine, deoxycytidine, et deoxythymidine triphosphate).
  2. Utiliser cinq cycles de dénaturation, d'annealing et d'étapes d'extension (94 oC pour 1 min, 53 oC pour 1 min et 72 oC pour 1 min) de PCR suivis d'un cycle d'extension (72 oC pour 10 min).

3. Synthèse de la piscine 0 ARN

  1. Configurez une réaction de transcription de 100 l12. Mélangez le tampon de transcription T7, 1 m d'ADN aléatoire de piscine de bibliothèque, 5 mM dithiothreitol (TNT), 2 mM de guanosine triphosphate (GTP), 1 mM chacun de triphosphate d'adénosine (ATP), de triphosphate de cytidine (CTP) et de triphosphate d'uridine (UTP), et de 2 unités/L T7 ARN polyphosphate.
    REMARQUE : L'ARN peut être transcrit in vitro à l'aide de kits disponibles dans le commerce avec une option de polymérase d'ARN T7 ou SP6.
  2. Incuber le mélange de réaction ci-dessus dans un tube de microcentrifuge pendant 2 h à 37 oC.
  3. Le gel purifie l'ARN dans un gel polyacrylamide dénaturant de 10%.
  4. Identifiez l'emplacement des transcriptions sur le gel en le tachant avec le bleu de méthylène ou l'autoradiographie en incluant des traces de radioactivité (0,5 l ou moins de32P UTP) dans la réaction de transcription.
    1. Placer la tranche de gel dans un tube de centrifugeuse et les casser en petits morceaux, par exemple, avec une pointe d'homogénéisateur. Ajouter le tampon protéinase K (PK) (100 mM Tris, pH 7,5, 150 mM NaCl, 12,5 mM EDTA, 1 % de sulfate de dodecyl de sodium) pour immerger les morceaux de gel. Laisser le tube sur un écrou de 2 h à la nuit à température ambiante.
  5. Faire tourner dans un microcentrifugeà-rapide (14 000 tr/min ou 16 873 x g)pendant 5 minutes à température ambiante pour enlever les débris de gel et récupérer la solution tampon.
  6. Vortex l'échantillon deux fois avec un volume égal de phénol-chloroforme et une fois avec le chloroforme.
  7. Mélanger la phase aqueuse d'en haut avec un dixième de volume d'acétate de sodium (3,0 M, pH 5,2), 10 g d'ARNc ou 20 g de glycogène et de l'éthanol (2 à 3 volumes, stockés à -20 oC). Laisser les tubes à -80 oC pendant 1 h.
  8. Faire tourner les tubes contenant la solution pendant 5 à 10 min à 4 oC dans un microcentrifugeur (14 000 tr/min ou 16 873 x g). Jeter le supernatant soigneusement. Rincer le granule d'ARN avec 70 % d'éthanol et faire tourner pendant 2 à 5 min. Aspirate éthanol soigneusement. Sécher à l'air la pastille d'ARN.
  9. Solubilize le granule d'ARN dans 50 l d'eau traitée avec du pyrocarbonate de diéthyle (DEPC). Laisser l'échantillon à -20 oC pour le stockage.
    REMARQUE : Purifez l'ARN à l'aide de colonnes de spin disponibles dans le commerce, qui sont actuellement plus couramment utilisées pour éliminer la radioactivité non incorporée et servent d'alternative rapide et plus pratique pour la purification de l'ARN.
    CAUTION : Utilisez un bouclier en verre acrylique, des gants et d'autres précautions pour vous protéger contre la radioactivité.

4. Réaction de liaison de protéine et séparation de l'ARN lié

  1. Effectuer la liaison des protéines et de l'ARN dans 10 mM Tris-HCl, pH 7,5 dans un volume de 100 L en ajoutant les ingrédients suivants à ces concentrations finales : 50 mM KCl, 1 mM DTT, 0,09 g/L d'albumine de sérum bovin, 0,5 unité/L RNasin, 0,15 g/L tRNA , 1 mM EDTA, et 30 L de concentration appropriée de protéines recombinantes (PTB). Ajouter l'ARN de la piscine appropriée.
    REMARQUE : Le facteur d'épissage U2AF65 se lie généralement aux sites d'épissage polypyrimidine/3' des introns modèles ayant une affinité de liaison (dissociation d'équilibre constante ou Kd)d'environ 1 à 10 nM. Par conséquent, les deux premiers cycles de liaison ont utilisé une concentration de protéines 10 fois supérieure au Kd pour U2AF65; pour les protéines SXL et PTB, la concentration de départ dans cette gamme n'était que notre meilleure estimation. Cela a assuré que les espèces d'ARN désirées qui pourraient se lier, bien que des séquences d'affinité plus faibles également potentiellement liés. Dans les tours 3 et 4 (transcription, liaison et amplification), la concentration en protéines a été multipliée par trois (étape 4.1). Ceci a été fait pour éliminer successivement les espèces d'ARN à faible affinité.
  2. Placer les tubes contenant les réactions de liaison pendant environ 30 min à 25 oC dans un bloc de température (ou sur de la glace).
  3. Fractionner l'ARN lié de l'ARN non lié pour les 4 premiers tours de sélection-amplification en utilisant les étapes suivantes.
    1. Filtrer l'échantillon (100 l) à température ambiante à l'abri d'un filtre à nitrocellulose fixé à un collecteur sous vide.
      REMARQUE : Le complexe ARN-protéine, mais pas l'ARN non lié, reste sur le filtre.
    2. Hacher le filtre avec de l'ARN retenu en fragments avec une lame de rasoir stérile; les insérer dans un tube de centrifugeuse. Récupérer l'ARN en dégringolant doucement le tube pendant un minimum de 3 h (ou pendant la nuit) avec des morceaux de filtre immergés dans le tampon protéinase K (PK).
    3. Déprotéiprogéiquer l'échantillon d'ARN en le vortexant en présence d'un volume égal de phénol-chloroforme (1:1) puis de chloroforme. Récupérer la phase aqueuse à chaque fois en centrifuant l'échantillon à grande vitesse pendant 5 min à température ambiante.
    4. Mélangez-le avec de l'acétate de sodium (0,1 volume de 3,0 M, pH 5,2) et de l'éthanol (2 à 3 volumes d'éthanol absolu, 200 preuves). Laisser le tube dans un congélateur de -80 oC pendant 30 min, le centrifuger à grande vitesse pendant 10 min et, après les étapes de lavage et de séchage (étape 3.8), solululiser l'ARN dans l'eau traitée avec deLAPC. Ces étapes sont décrites ci-dessus (étapes 3.6 à 3.9).
  4. Séparez les fractions d'ARN liées aux protéines des fractions non liées pour les 2 derniers tours (tours 5 et 6; transcription, liaison et amplification) comme suit. Réduisez la concentration de protéines dans la réaction de liaison (étape 4.1) en multipliant par trois la pression de sélection supplémentaire afin d'enrichir les séquences de liaison à haute affinité et d'éliminer de préférence les séquences à faible affinité.
    1. Pré-moulé un gel polyacrylamide indigène (5% avec 60:1 acrylamide:bis-acrylamide ratio) dans 0.5x Tampon TBE (Tris-Borate-EDTA) avant de mettre en place l'ARN ci-dessus: protéine-contraignant (étape 4.1) réaction. Électrophorese ce gel dans une chambre froide (4 oC) en appliquant 250 V pendant 15 min.
    2. Pipette l'ARN ci-dessus: réactions de liaison de protéine (étape 4.1) dans différents puits de ce gel.
      REMARQUE : La protéine est stockée à -80 oC et diluée avant d'être utilisée dans 20 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), pH 8.0, 20% de glycérol, 0,2 mM d'acide éthylènediaminetetratraacetic (EDTA), 0.05% NP-40, et 1 mM dithiothreitol (DTT). L'ajout du fluorure de sulfonyle de sulfonyle de sulfonyle (PMSF) de 0,5 à 1,0 mM est facultatif. Dans la réaction de liaison, ce tampon contribue à environ 6% de glycérol, ce qui permet le chargement direct des échantillons dans les puits sans avoir besoin de les mélanger avec un tampon de gel-chargement séparé.
    3. Fractionner l'ARN lié de l'ARN non lié à l'aide d'électrophoresis de gel dans une chambre froide (4 oC) à 250 V pour 1 à 2 h. Ce processus est également connu sous le nom d'analyse de changement de mobilité de gel.
      REMARQUE : La durée de l'électrophorèse varie en fonction des caractéristiques de l'ARN et de la protéine utilisées pour la liaison.
    4. Exposez le gel à un film radiographique et identifiez l'emplacement de l'ARN lié à l'aide de l'autoradiographie. Découper la tranche de gel avec l'ARN lié et l'insérer dans un tube.
    5. Incuber la tranche de gel écrasée dans le tampon PK utilisé pour l'élution pendant 3 h ou pendant la nuit.
    6. Répétez les étapes 3.5 à 3.9 décrites ci-dessus. En bref, vortex l'échantillon d'ARN élué vigoureusement d'abord avec le phénol-chloroforme, puis avec le chloroforme.
    7. Mélanger l'acétate de sodium et l'éthanol avec la phase aqueuse après l'extraction du chloroforme. Après l'incubation dans un congélateur de -80 oC, tourner à 4 oC pendant 5 à 10 min pour recueillir le granule d'ARN. Laver le granule d'ARN avec de l'éthanol et l'assécher à l'air en laissant le couvercle du tube ouvert. Dissoudre l'ARN dans l'eau traitée avec DEPC.
      REMARQUE : Le passage à l'évaluation de la mobilité du gel pour la fractionnement permet d'éliminer les espèces d'ARN indésirables qui auraient pu être enrichies pour être reliures, par exemple, au filtre à nitrocellulose ici (ou à toute matrice) utilisé dans les premiers tours pour la fractionnement.

5. Transcription inversée et amplification de PCR

  1. Synthétiser l'ADNc à partir de l'ARN dissous à l'aide de la transcriptase inverse et de l'amorce inverse en incuber la réaction de 20 L (2 L de 10x RT Buffer, 2 'L de transcriptase inverse AMV, 1'M amorce inverse, 10 'L d'ARN, inhibiteur de la RNase en option) à 42 'C pendant 60 min.
  2. Amplifiez l'ADNc à l'aide de cycles PCR de 20 à 25 comme décrit à l'étape 2.1.

6. Transcription et liaison protéique

  1. Répétez le processus de synthèse de l'ARN, de liaison protéique, de séparation des protéines liées et non liées, comme décrit à la section 3-5 ci-dessus.

7. Analyse des interactions ARN-protéines

  1. Utilisez l'exemple de changement de mobilité gel (étape 4.4) ou l'exemple de liaison du filtre (étape 4.3) pour déterminer l'affinité et la spécificité de liaison pour les pools sélectionnés ou les séquences individuelles dans chaque pool (voir l'étape 8.3).
  2. Utilisez l'autoradiographie ou un imageur de phosphore pour détecter et quantifier les bandes dans la fraction liée et la fraction non liée.

8. Clonage et séquençage

  1. Dig le produit final d'ADN PCR avec des enzymes de restriction Bcl1 et HindIII pendant 1/2 h, ligate avec le pGEM3 convenablement digéré ou d'autres plasmides portant les emplacements de restriction de 2 h à la nuit, transformer le produit de ligature en cellules bactériennes compétentes par choc thermique ou électroporation en utilisant des procédures de biologie moléculaire standard13.
  2. Cultivez des bactéries du jour au lendemain en placageant les cellules transformées sur des plaques d'agar avec le milieu Luria-Bertani (LB) et l'ampicilline (50 g/mL) à 37 oC. Choisissez des colonies pour inoculer des tubes de culture contenant du milieu liquide LB avec de l'ampicilline et atteindre 37 oC dans un incubateur secouant pendant la nuit. Purifie les ADN plasmides contenant des inserts d'ADN à l'aide d'un protocole d'isolement plasmide standard13.
    REMARQUE : Des kits commerciaux sont disponibles pour la purification du plasmide.
  3. Séquencer les plasmides avec des inserts d'ADN à l'aide du protocole de séquençage de la chaîne didéoxy, suivant les instructions du fabricant pour le séquençage14.
    REMARQUE : Le séquençage peut être effectué en maison ou commercialement.

9. Alignement de séquence

  1. Aligner les séquences et obtenir un site de liaison consensuelle à l'aide des outils d'alignement en ligne disponibles
    (https://www.ebi.ac.uk/Tools/msa/).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Les observations suivantes démontrent une sélection-amplification réussie (SELEX). Tout d'abord, nous avons analysé le pool 0 et les séquences sélectionnées pour se lier à la protéine utilisée pour l'approche itératif de sélection-amplification. La figure 2 montre que la protéine de liaison polypyrimidine-tract de mammifères (PTB) montre une liaison à peine détectable à la séquence du pool 0, mais une forte affinité pour le pool de séquences sélectionnés. Il y avait à peine une liaison détectable pour le pool 0 lorsque nous avons utilisé environ 300 fois plus de concentration de protéines pour la liaison que celle utilisée pour le pool sélectionné. Ainsi, il y avait au moins une différence de plusieurs centaines de fois dans les affinités de liaison de protéine entre le pool aléatoire ou de départ et le pool choisi. Cette observation confirme expérimentalement que le protocole de sélection-amplification décrit ici est réussi.

Deuxièmement, nous avons séquencé le pool sélectionné et déterminé un site de liaison consensuelle. La séquence consensuelle obtenue à partir de l'alignement de la majorité des séquences sélectionnées du bassin choisi par le PTB des mammifères était : GCCUG (Y/G)UGYYYYYYYYYYYYYYYYG (Y/G)CCC. Cela montre que nous avons sélectionné des séquences uniques riches en pyrimidine qui lient PTB11. Lorsque nous avons effectué la sélection-amplification itérative pour le domaine DE liaison d'ARN du Drosophila PTB, nous avons enrichi des séquences CU-riches interrompues par des guanosines. Parmi les séquences d'affinité élevée que le Drosophila PTB a sélectionnées, il y avait une séquence riche en pyrimidine s'est élevée à 84 % : GCUUUCCUCUCUCCUCUCUCUUCCCCCUG. En fait, cette séquence est similaire à la séquence riche en pyrimidine présente dans l'intron d'alpha-tropomyosine qui se lie avec une forte affinité et est réglementée par le mammifère PTB15. Nous avons utilisé avec succès cette approche à plusieurs reprises pour étudier les propriétés et les fonctions d'épissage de l'ARN et un facteur d'épissage11,15,16. Le tableau 1 montre des exemples réussis de protéines liant l'ARN pour lesquelles SELEX a été utilisé pour identifier leur site de liaison préféré ou consensuel.

Troisièmement, un test d'épissage in vitro, qui est basé sur le choix alternatif du site d'épissage de 3', montre la pertinence fonctionnelle des spécificités distinctes mais superposées d'ARN-liaison des protéines de liaison de polypyrimidine-tract. Alors qu'un site d'épissage en amont de 3' est utilisé par défaut, l'ajout du PTB recombinant conduit à l'activation du site d'épissage alternatif ou en aval de 3' (figure 3). En revanche, l'ajout de hnRNP C17 recombinant conduit à la répression des deux sites d'épissage de 3'. L'ajout du facteur d'épissage général recombinant U2AF65 inverse la répression du site d'épissage 3' médiée par hnRNP C1 (figure 3) ainsi que l'effet PTB-négocié sur l'activation du site d'épissage en aval de 3' (données non montrées). Une explication simple de ces effets est une concurrence directe entre la liaison du facteur d'épissage général U2AF65 et le PTB (également appelé hnRNP I), qui lie de préférence à certains sites d'épissage de 3' ou entre U2AF65 et hnRNP C, qui se lie et réprime les deux sites d'épissage de 3'.

Figure 1
Figure 1 : Résumé des étapes clés du processus de sélection-amplification itérative (SELEX). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Enrichissement des ARN liant le PTB. L'augmentation de la concentration (triangles remplis) de PTB recombinant a été utilisée avec l'ARN du pool 0 radio-étiqueté ou le pool sélectionné obtenu après six séries de sélection et d'amplification. Les positions de l'ARN non lié et du complexe RNA:protein sont indiquées. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : L'évaluation de commutation du site Splice valide les spécificités de liaison distinctes des protéines liant la pyrimidine. (A-Top) Schémas du substrat épissage. Le substrat épissé contient un site d'épissage de 5 po et deux autres sites d'épissage de 3 po flanquant l'intron. Rectangles (ouvert, avec des lignes horizontales, et solide) sont des exons et la ligne est un intron. (A-Bottom) hnRNP C1 réprime le site d'épissage en amont de 3' (sans activation du site d'épissage en aval de 3'), tandis que le PTB conduit à l'activation du site d'épissage en aval de 3'. Le substrat épissage a été incubé dans un extrait nucléaire de cellules HeLa. Les produits d'épissage (indiqués sur les côtés) ont été analysés à l'aide d'un analyse d'extension d'amorce18 avec des amorces de jonction d'épissage (flèches), qui reconnaissent l'épissage du site commun d'épissage de 5' au site d'épissage en amont ou en aval de 3'. (B) Recombinant U2AF65 (rU2AF65) renverse l'effet répressif du hnRNP C1. L'ajout des protéines recombinantes hnRNP C1, PTB ou rU2AF65 à la réaction d'épissage est indiqué par les symboles de l'I. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

protéine Séquence préférée (s)
U2AF65 Annonces U-riche contenant Cs
SXL (SXL) U-riche contenant 2-4 Gs
Ptb UCUUC-riche avec quelques Gs
hnRNP C1 U-rich (5-6 long)
CstF64 (en) Riche en GU
hnRNP E1/E2 et K C-riche
U2AF65/U2AF35 hétérodime UUUYYYYUnUAGGU

Tableau 1 : Sites de liaison privilégiés pour certaines protéines liant l'ARN.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Les protéines liant l'acide nucléique sont d'importants régulateurs du développement animal et végétal. Une exigence clé pour la procédure SELEX est le développement d'un analyse qui peut être utilisé pour séparer les fractions d'ARN liées aux protéines et non liées. En principe, cet analyse peut être un jeu in vitro de liaison comme l'analyse de liaison par filtre, l'analyse de changement de mobilité du gel, ou un analyse de liaison de matrice19 pour les protéines recombinantes, les protéines purifiées ou les complexes protéiques. L'analyse peut également être un test enzymatique où les précurseurs et les produits (ou intermédiaires) peuvent être séparés en fonction de la taille ou d'autres moyens20.

Tandis que la mutagénèse a été employée couramment pour caractériser des emplacements de liaison pour des protéines, elle est laborieuse, et les séquences longues et plus longues ne sont pas aussi facilement favorables à la mutagénèse de saturation. L'importance de l'approche itérative de liaison et d'amplification décrite ici est que non seulement elle surmonte certaines des limitations ci-dessus, mais elle peut surtout identifier des sites de liaison jusqu'alors inconnus et fournir des informations importantes sur nucléotides à chaque position en même temps.

Une considération importante pour le succès de la sélection itérative-amplification est l'affinité et la spécificité contraignantes. En règle générale, 12 à 15 séries de sélection-amplification sont utilisées et un espace de séquence de 1012 à 10molécules 15 peuvent être échantillonnés régulièrement. Les progrès et le succès éventuel du protocole de sélection-amplification peuvent être surveillés à l'aide d'un analyse obligatoire ou d'un séquençage direct, qui surveille l'affinité ou l'enrichissement de séquences spécifiques dans les pools intermédiaires, respectivement. Alors que l'analyse de liaison a été traditionnellement utilisé, l'avènement de la prochaine génération de séquençage permet d'analyser l'enrichissement de la séquence d'une manière qui n'est pas possible par le séquençage Manuel Sanger14.

Une étape critique dans le succès de SELEX est l'enrichissement de pliage des molécules désirées à chaque étape. Le nombre de cycles requis pour SELEX varie et dépend de plusieurs facteurs. Par exemple, si l'enrichissement de plis des séquences souhaitées ou spécifiques est plus élevé dans chaque tour, moins de tours seront suffisants. Toutefois, si un jeu d'enfant permet une proportion élevée de séquences indésirables dans le pool lié, des tours supplémentaires deviendront nécessaires pour enrichir les séquences d'ARN désirées. Une limitation de la technique ou une conséquence involontaire de la nécessité de cycles supplémentaires de sélection-amplification qui doivent être gardés à l'esprit est la possibilité qu'elle puisse introduire des artefacts ou enrichir des séquences qui ont des propriétés indépendantes telles que leur capacité d'amplifier. Enfin, bien que certaines applications bénéficient des liants d'affinité les plus élevés, pour d'autres utilisations, un équilibre doit être trouvé au cours du processus de sélection-amplification entre l'affinité de liaison et la fonction parce que les séquences de liaison les plus serrées pourraient ne pas nécessairement être les séquences les plus fonctionnelles dans des contextes biologiques (p. ex., si une séquence est reconnue plusieurs fois par différentes protéines pendant l'épissage).

Parmi les modifications et le dépannage pour améliorer la procédure, la sélection négative ou la sélection de compteur peut être employée pour augmenter la spécificité. De même, l'utilisation de différents protocoles de partitionnement, tels que l'analyse de liaison du filtre suivie de l'analyse de changement de mobilité du gel, peut éliminer l'enrichissement des séquences indésirables qui se lient, par exemple, au filtre à nitrocellulose ou à une matrice de colonne21. Étant donné que les interactions protéines-acides nucléiques ont des composants spécifiques et non spécifiques, les conditions tampons telles que le sel et le pH ont des effets sur les interactions ARN-protéines. En outre, l'utilisation d'une concentration de protéines appropriée peut avoir un effet direct sur la rétention de liants forts, faibles et non spécifiques. La pression de sélection peut être augmentée en plusieurs tours, par exemple en incluant un ARN concurrent, en réduisant la concentration en protéines ou en réduisant le temps d'incubation. Ainsi, des considérations soignent esfaites et l'optimisation de ces paramètres peuvent avoir un impact sur les résultats du protocole SELEX.

Récemment, de nombreuses variations ou modifications du protocole ORIGINAL SELEX ont été développées qui surmontent certaines des limitations mentionnées ci-dessus. Il s'agit notamment de haut débit-SELEX (HT-SELEX), qui combine SELEX et le séquençage massivement parallèle6, RNAcompete, qui implique l'incubation avec l'ARN non-aléatoire excédentaire, le retrait de l'ARN lié, l'étiquetage fluorescent de l'ARN, et l'analyse sur microarrays5, RNA Bind-n-Seq, qui combine l'analyse d'affinité de l'ARN dans une mode quantitative et à haut débit22, et RAPID-SELEX, qui raccourcit le processus et comprend une étape de non-amplification23.

Des bases chimiquement modifiées ont été utilisées pour élargir le répertoire des molécules d'ARN pour des applications spécifiques24. Le diagnostic, la thérapeutique, ainsi que les molécules ayant des activités catalytiques sont parmi les nombreuses applications (y compris en médecine) des molécules sélectionnées25. Les aptamers complètent les protocoles basés sur les anticorps et fournissent d'excellents outils dont le potentiel, par exemple, dans le diagnostic, la thérapeutique et d'autres applications, reste à être pleinement exploité26,27,28. À l'avenir, par exemple, les avantages cliniques sont parmi les nombreuses applications souhaitées, au-delà de ce que le premier aptamer approuvé par la FDA (Pegaptanib sodium) pourrait offrir pour la dégénérescence maculaire liée à l'âge. La technologie protéomique évolutive pour les mesures des protéines offre une étape vers la compréhension de la santé et des maladies24.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

L'auteur déclare qu'il n'a pas d'intérêts financiers concurrents.

Acknowledgments

L'auteur remercie les National Institutes of Health pour le financement passé.

Materials

Name Company Catalog Number Comments
Gel Electrophoresis equipment Standard Standard
Glass Plates Standard Standard
Nitrocellulose Millipore HAWP
Nitrocellulose Schleicher & Schuell PROTRAN
polyacrylamide gel solutions Standard Standard
Proteinase K NEB P8107S
Recombinant PTB Laboratory Preparation Not applicable
Reverse Transcriptase NEB M0277S
Vacuum manifold Fisher Scientific XX1002500 Millipore 25mm Glass Microanalysis Vacuum Filter
Vacuum manifold Millipore XX2702552 1225 Sampling Vacuum Manifold
X-ray films Standard Standard

DOWNLOAD MATERIALS LIST

References

  1. Pribnow, D. Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter. Proceedings of the National Academy of Sciences of the United States of America. 72, (3), 784-788 (1975).
  2. Breathnach, R., Chambon, P. Organization and expression of eucaryotic split genes coding for proteins. Annual Review of Biochemistry. 50, 349-383 (1981).
  3. Wickens, M., Stephenson, P. Role of the conserved AAUAAA sequence: four AAUAAA point mutants prevent messenger RNA 3' end formation. Science. 226, (4678), 1045-1051 (1984).
  4. Kozak, M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research. 15, (20), 8125-8148 (1987).
  5. Ray, D., Ha, K. C. H., Nie, K., Zheng, H., Hughes, T. R., Morris, Q. D. RNAcompete methodology and application to determine sequence preferences of unconventional RNA-binding proteins. Methods. 118, 3-15 (2017).
  6. Jolma, A., et al. Multiplexed massively parallel SELEX for characterization of human transcription factor binding specificities. Genome Research. 20, (6), 861-873 (2010).
  7. Tuerk, C., Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science. 249, (4968), 505-510 (1990).
  8. Ellington, A. D., Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature. 346, (6287), 818-822 (1990).
  9. Cowperthwaite, M. C., Ellington, A. D. Bioinformatic analysis of the contribution of primer sequences to aptamer structures. Journal of Molecular Evolution. 67, (1), 95-102 (2008).
  10. Jenison, R. D., Gill, S. C., Pardi, A., Polisky, B. High-resolution molecular discrimination by RNA. Science. 263, (5152), 1425-1429 (1994).
  11. Singh, R., Valcarcel, J., Green, M. R. Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science. 268, (5214), 1173-1176 (1995).
  12. Milligan, J. F., Uhlenbeck, O. C. Synthesis of small RNAs using T7 RNA polymerase. Methods in Enzymology. 180, 51-62 (1989).
  13. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular Cloning. Cold Spring Harbor Laboratory Press. New York. (1989).
  14. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  15. Robida, M., Sridharan, V., Morgan, S., Rao, T., Singh, R. Drosophila polypyrimidine tract-binding protein is necessary for spermatid individualization. Proceedings of the National Academy of Sciences of the United States of America. (2010).
  16. Banerjee, H., Rahn, A., Gawande, B., Guth, S., Valcarcel, J., Singh, R. The conserved RNA recognition motif 3 of U2 snRNA auxiliary factor (U2AF(65)) is essential in vivo but dispensable for activity in vitro. RNA. 10, (65), 240-253 (2004).
  17. Gorlach, M., Burd, C. G., Dreyfuss, G. The determinants of RNA-binding specificity of the heterogeneous nuclear ribonucleoprotein C proteins. J Biol Chem. 269, (37), 23074-23078 (1994).
  18. Valcarcel, J., Singh, R., Zamore, P. D., Green, M. R. The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA. Nature. 362, (6416), 171-175 (1993).
  19. Wilson, C., Szostak, J. W. Isolation of a fluorophore-specific DNA aptamer with weak redox activity. Chemistry & Biology. 5, (11), 609-617 (1998).
  20. Joyce, G. F. Reflections of a Darwinian Engineer. Journal of Molecular Evolution. 81, (5-6), 146-149 (2015).
  21. McKeague, M., Derosa, M. C. Challenges and opportunities for small molecule aptamer development. Journal of Nucleic Acids. 2012, 748913 (2012).
  22. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Molecular Cell. 54, (5), 887-900 (2014).
  23. Szeto, K., et al. RAPID-SELEX for RNA aptamers. PLoS One. 8, (12), e82667 (2013).
  24. Rohloff, J. C., et al. Nucleic Acid Ligands With Protein-like Side Chains: Modified Aptamers and Their Use as Diagnostic and Therapeutic Agents. Molecular Therapy - Nucleic Acids. 3, e201 (2014).
  25. Gold, L., et al. Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS One. 5, (12), e15004 (2010).
  26. Zhuo, Z., et al. Recent Advances in SELEX Technology and Aptamer Applications in Biomedicine. International Journal of Molecular Sciences. 18, (10), (2017).
  27. Blind, M., Blank, M. Aptamer Selection Technology and Recent Advances. Molecular Therapy. Nucleic Acids. 4, e223 (2015).
  28. Jijakli, K., et al. The in vitro selection world. Methods. 106, 3-13 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics