Induzierte Differenzierung von M-Zell-ähnlichen Zellen in menschlichen Stammzell-abgeleiteten Ileal Enteroid Monolayern

Immunology and Infection
 

Summary

Dieses Protokoll beschreibt, wie die Differenzierung von M-Zellen in menschlichen Stammzell-abgeleiteten ilealen Monolayern und Methoden zur Beurteilung ihrer Entwicklung induziert werden kann.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (Mikrofalte) Zellen des Darms funktionieren Antigen aus dem apikalen Lumen zu den zugrunde liegenden Peyer-Pflastern und Laminaproprien, wo sich Immunzellen befinden, und tragen somit zur Schleimhautimmunität im Darm bei. Ein vollständiges Verständnis, wie sich M-Zellen im Darm unterscheiden, sowie die molekularen Mechanismen der Antigenaufnahme durch M-Zellen fehlen. Dies liegt daran, dass M-Zellen eine seltene Population von Zellen im Darm sind und weil In-vitro-Modelle für M-Zellen nicht robust sind. Die Entdeckung eines sich selbst erneuernden Stammzellkultursystems des Darms, sogenannte Enteroide, hat neue Möglichkeiten zur Kultivierung von M-Zellen geschaffen. Enteroide sind vorteilhaft gegenüber Standard-kultivierten Zelllinien, da sie in mehrere Hauptzelltypen im Darm unterschieden werden können, einschließlich Kelchenzellen, Paneth-Zellen, enteroendokrine Zellen und Enterozyten. Das Zytokin RANKL ist für die M-Zellentwicklung von wesentlicher Bedeutung, und die Zugabe von RANKL und TNF-A zu Kulturmedien fördert eine Teilmenge von Zellen aus ilealen Enteroiden, um sich in M-Zellen zu differenzieren. Das folgende Protokoll beschreibt eine Methode zur Differenzierung von M-Zellen in einem transwell epitheliaal polarisierten Monoschichtsystem des Darms mit humanen Ileal-Enteroiden. Diese Methode kann auf die Untersuchung der M-Zellentwicklung und -funktion angewendet werden.

Introduction

M (Mikrofalte) Zellen sind spezialisierte Darmepithelzellen, die in erster Linie im Follikelassoziierten Epithel (FAE) des Darms überhängenden kleinen lymphoiden Regionen gefunden werden, die Peyer-Pflaster1. M-Zellen haben kurze unregelmäßige apikale Mikrovilli und sind auf ihrer basolateralen Seite tief invaginated, wodurch Immunzellen sich eng an ihren Zellkörper befinden2. Diese einzigartige Morphologie ermöglicht es M-Zellen, Antigen aus dem apikalen Lumen des Darms zu proben und direkt an die zugrunde liegenden Immunzellen2zu liefern. Auf diese Weise sind M-Zellen wichtig für die Immunüberwachung im Darm, können aber auch von Krankheitserregern für den Eintritt in die Lamina propria1,2,3,4,5, 6,7.

Die Untersuchung von M-Zellen wurde durch mehrere Faktoren behindert. Zunächst werden M-Zellen in geringer Häufigkeit in der Maus und im menschlichen Darmgefunden 8. In kultivierten Zellsystemen wurden M-Zell-ähnliche Zellen induziert, durch Ko-Kultivierung einer polarisierten Adenokarzinom-Zelllinie, Caco-2, mit entweder B-Lymphozyten aus Maus-Peyer-Pflastern oder der B-Zell-Lymphom-Zelllinie, Raji B9,10, zu unterscheiden. . Dies führt zu einer Teilmenge von Caco-2-Zellen, die die M-Zellmarker Sialyl Lewis A Antigen und UEA-1 im polarisierten Epithel9,10ausdrücken. (Diese Marker werden auch auf Kelchenzellen in Darmgeweben exprimiert, so dass heutzutage weniger häufig als definitive M-Zellmarker11,12verwendet werden.) Dieses Caco-2-M-Zellsystem wurde zur Untersuchung der Partikelaufnahme und der Bakterientranslokation13,14verwendet. Caco-2-Zellen sind jedoch eine etablierte Zelllinie aus einem großen Darmadenokarzinom mit dem Verwirrenden Faktor, dass verschiedene Quellen von Caco-2-Zellen verschiedene Phänotypen unter den Laboren15zeigen. Darüber hinaus können sie die Transkriptionsniveaus echter M-Zellen möglicherweise nicht vollständig rekapitulieren, da sie keine Expression der derzeit bekannten M-Zellmarker GP2 und SpiB16haben. Daher sind zusätzliche und physiologisch relevantere Kulturmodelle erforderlich, um die Entwicklung und Funktion von M-Zellen untersuchen zu können.

Innerhalb der letzten zehn Jahre hat sich das Feld der enteroidabgeleiteten Modellsysteme des Darms rasch von der ersten Entdeckung entwickelt, dass Darmstammzellen aus der menschlichen Darmbiopsie sich in der Kultur selbst vermehren und sich selbst erneuern könnten. 17 , 18. Wichtig ist, dass die Entfernung von Stammzellförderfaktoren aus den Wachstumsmedien es diesen Stammzellkulturen ermöglicht, sich in die vielen Zelltypen im Darm zu differenzieren18. Darüber hinaus legen neuere Arbeiten die Bedeutung der RANKL-RANK-Signalisierung bei der M-Zellentwicklung im Darm19,20nahe. Der RANK-Rezeptor ist ein Mitglied der TNF-Familie von Rezeptoren, die auf Epithel-Vorläuferzellen im Darm19 exprimiert wird, während RANKL (der RANK-Rezeptor-Ligand) durch Stromalzellen der Peyer-Pflaster freigesetzt wird20. Da die epithelialen Zelltypen in ilealen Enteroiden keine RANKL produzieren, kann die M-Zelldifferenzierung in ilealen enteroiden Kulturen durch die Zugabe von RANKL zu den Kulturmedien21,22induziert werden. Die Aufnahme von TNF in die Kulturmedien unterstützt die M-Zellentwicklung in ilealen Enteroiden23. Hier beschreiben wir die Methoden zur Induktion der Differenzierung von M-Zellen in Darmmonolayern, die von menschlichen ilealen Enteroiden abgeleitet sind. Unsere Methoden basieren zum Teil auf Modifikationen aus den folgenden Protokollen21,22,23.

Protocol

Alle hier beschriebenen Methoden wurden von der Tufts University IBC und IRB zugelassen.

1. Induzieren von M-Zelldifferenzierung in humanen Ileal Enteroid-abgeleiteten Monolayern

HINWEIS: Dieses Protokoll verwendet ileale Enteroide, die aus der Biopsie des menschlichen Gewebes abgeleitet sind. Bitte beachten Sie die veröffentlichten Protokolle für Methoden zum Wachsen und Durchführen dieser Zellen18,24. Die folgenden Methoden zur Entwicklung von Monolayern wurden von Zou et al.24adaptiert. Methoden zur Induktion von M-Zellen in ilealen enteroid-abgeleiteten Kulturen wurden aus früheren Berichten21,22,23angepasst. Alle Arbeiten werden in einer sterilen Gewebekulturhaube durchgeführt und Inkubationen befinden sich in Kapuze oder Gewebekultur Inkubator wie angegeben. Siehe Tabelle der Materialien, die benötigt werden, um ileal enteroide Monolayer und verschiedene Medien vorzubereiten.

  1. Wachsen Sie ileale Enteroide für 4-10 Tage in extrazellulärer Matrix (ECM) (siehe Materialtabelle) (Abbildung 1), abhängig von ihren intrinsischen Wachstumsraten, bevor sie auf Transwells gesät werden.
  2. Beschichtung transwell Membranen
    1. Platzieren Sie die gewünschte Anzahl von Transwells in einer 24-Well-Platte, wodurch ein Zweikammersystem entsteht.
    2. ECM 25-fach in kaltsteriler Phosphat-gepufferter Saline (PBS) verdünnen und 100 l kalt verdünnte Lösung in jede obere Kammer auf die Membran geben.
      HINWEIS: ECM und verdünnte ECM-Lösung müssen bis unmittelbar vor der Zugabe auf Eis gehalten werden.
    3. Bedecken Sie die 24-Well-Platte mit Deckel und legen Sie die Platte bei 37 °C bei 37 °C für 2 h, um eine ECM-Erstarrung auf der Membran zu ermöglichen.
    4. Nach 2 h die Platte aus dem Inkubator entfernen und in eine Gewebekulturhaube geben. Mit steriler Pinzette, invertieren Sie jeden Transwell, um die verbleibende Lösung vorsichtig zu entfernen. Lassen Sie die Membranen in der Haube mit geöffnetem Deckel lüften, während Zellen gesammelt werden (Schritte 1.3.1- 1.3.11).
  3. Dissoziieren der ilealen Enteroide in einzelne Zellen
    1. Entfernen Sie die Platte der ilealen Enteroide aus dem Inkubator und entfernen Sie vorsichtig die Kulturmedien aus jedem Brunnen durch Vakuumaspiration oder mit einer Pipette.
      HINWEIS: Ein Brunnen von ilealen Enteroiden, die etwa 100 gesunde Zysten enthalten, reicht aus, um 1,5-2 Brunnen auszusäen.
    2. Fügen Sie jedem Brunnen, der ileale Enteroide enthält, die im ECM suspendiert sind, 500 l eiskalte 0,5 mM Ethylendiamintetraessigsäure (EDTA) hinzu, um das ECM aufzubrechen. Pipette kräftig nach oben und unten mit einem P1000 Pipettor auf 500 l gesetzt, um ECM aufzubrechen, wodurch ileale Enteroide in die Lösung freisetzen. Um die Auflösung von ECM zu verbessern, nach dem Pipetieren, schütteln Sie die Platte bei 4 °C für 30 min kräftig.
    3. Sammeln Sie die Lösung von jedem Brunnen in 15 ml konische Rohre.
      HINWEIS: Sammeln Sie bis zu 10 Bohrungen pro 15 ml konischem Rohr für eine optimale Einzelzellen-Sammlung.
    4. Pellet die Zellen in einer Zentrifuge bei 140 x g und 4 °C für 5 min. Pellet sollte sichtbar sein, kann aber leicht gelöst werden, so langsam entfernen Sie den Überstand durch Vakuumaspiration oder mit einer Pipette.
      HINWEIS: Wenn Sie über den Verlust von Pellet und Zellen besorgt sind, verwenden Sie eine Pipette und speichern Sie den Überstand in einem separaten Rohr.
    5. Um enge Knotenverbindungen zu verdauen und die ilealen Enteroide in einzelne Zellen aufzuteilen, setzen Sie das Pellet in 500 l Raumtemperatur Trypsin pro 5 In-Schritt 1.3.3 gesammelten Brunnen wieder auf. Mit einer P1000 Pipette nach oben und unten, um die Klumpen zu disaggregieren und die Rohre in einem 37 °C Wasserbad für 5 min oder weniger zu bebrüten.
      HINWEIS: Die Optimierung ist erforderlich, um die angemessene Zeit zu bestimmen, die für die Inkubation der Rohre erforderlich ist, damit die Zellen aufgebrochen, aber nicht so weit, dass sie absterben, übertrypsinisiert werden. Verwenden Sie Trypan blue in Schritt 1.3.9, um sicherzustellen, dass die Zellen nach der Trypsin-Behandlung lebensfähig sind.
    6. Fügen Sie 1 ml Advanced DMEM/F12 mit 10% Fetal Bovine Serum (FBS) pro 500 l Trypsin hinzu, um das Trypsin zu inaktivieren.
    7. Pipette nach oben und unten mit einem P1000, der mindestens 50 Mal an der Seite des konischen Rohres auf 500 l eingestellt ist, um die verbleibenden Klumpen weiter in einzelne Zellen zu zerlegen.
    8. Legen Sie ein 40-m-Zellensieb über ein 50 ml konisches und fügen Sie 1 ml Advanced DMEM/F12 mit 10% FBS hinzu, um das Zellsieb zu befeuchten. Pipette die Einzelzellsuspension von der 15 ml konischen auf das Sieb. Waschen Sie das Sieb mit 1 ml Advanced DMEM/F12 mit 10% FBS.
    9. Übertragen Sie die Zellen, die durch das Zellsieb aus dem 50 ml konischen in ein neues 15 ml konisches Rohr gegangen sind. Während des Zentrifugationsschritts 1.3.10 wird das Zellpellet in einem 15 ml konischen Rohr leichter zu sehen sein. Zählen Sie die Zellen mit einem Hämozytometer. Verwenden Sie Trypan blue, um zu überprüfen, ob die Zellen noch am Leben sind. In der Regel wird die Rentabilität von >95 % beobachtet.
    10. Zentrifugieren Sie die Zellen im neuen 15 ml-Rohr bei 400 x g und platztemperatur für 5 min. Zellpellet sollte sichtbar sein. Entfernen Sie den Überstand vorsichtig mit einer Pipette und retten Sie den Überstand erneut, falls das Pellet ausfällt.
    11. Bereiten Sie modifizierte komplette Wachstumsmedien25 (MCMGF+ Media) vor, die mit 10 M Y-27632 ergänzt werden. Resuspend pelletierte Zellen bei 2,5 x 105 Zellen/200 l in MCMGF+. Siehe Bemerkungen in der Diskussion zur Optimierung der Zellenaussaatnummer.
      HINWEIS: MCMGF+ Medien sind Advanced DMEM/F12 mit 75% L-Wnt3a konditionierten Medien, 10% R-Spondin konditionierte Medien, 5% Noggin konditionierte Medien, 1x B27 Supplement, 1x N2 Supplement, 1 mM N-Acetylcystein, 50 ng/mL Maus rekombinante EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES, 2 mM GlutaMAX und 1x Penicillin/Streptomycin (optional).
    12. Stellen Sie sicher, dass die in Schritt 1.2 hergestellten ECM-beschichteten Membranen vollständig getrocknet sind, wie vom Auge beurteilt. Waschen Sie die obere Kammer mit 200 l MCMGF+. Fügen Sie in jeder oberen Kammer 200 L Zelllösung hinzu.
    13. Fügen Sie jeder unteren Kammer 700 l MCMGF+ mit 10 M Y-27632 hinzu. Legen Sie die Platte in einen 37 °CGewebekultur-Inkubator mit 5% CO2 .
    14. Entfernen Sie nach 1 Wachstumstag die Medien aus der oberen Kammer und ersetzen Sie sie durch 200 L frisches MCMGF+, um das Wachstum mehrerer Zellschichten zu verhindern.
  4. Ersetzen des Mediums
    1. Sobald Monolayer zu 80 % konfluent sind, in der Regel zwischen den Tagen 1-3 nach der Aussaat, ersetzen Sie basolaterale Medien durch Differenzierungsmedien (DM) für Kontrollbrunnen (siehe Schritt 1.4.2 für weitere Details) oder durch M-Zellmedien für M-Zell-Induktionsbrunnen (siehe Schritt 1.4.3 für weitere Details). Ersetzen Sie das Medium in der oberen Kammer durch DM für beide Bedingungen.
      HINWEIS: DM ist Advanced DMEM/F12 mit 5% Noggin konditionierten Medien, 1x B27 Supplement, 1x N2 Supplement, 1 mM N-Acetylcystein, 50 ng/mL MausrekombinantEEGf, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES Buffer, 2 mM GlutaMAX und 1x Penicillin/Streptomycin (optional ). M Zellmedien werden mit 200 ng/mL RANKL und 50 ng/mL TNF ergänzt.
    2. Für Kontrollbrunnen, die keine M-Zellen enthalten sollten, fügen Sie der oberen Kammer 200 L DM und der unteren Kammer 700 l DM hinzu.
    3. Um M-Zellen zu induzieren, fügen Sie der oberen Kammer 200 l DM und der unteren Kammer 700 l M-Zellmedien hinzu.
    4. Ersetzen Sie die Medien alle 2 Tage. Für Steuerbrunnen DM in den oberen und unteren Kammern ersetzen. Bei M-Zellbrunnen DM in der oberen Kammer und M-Zellmedien in der unteren Kammer ersetzen.
      HINWEIS: Am Tag 7 nach der Zellaussaat werden M-Zellen vollständig in den Monolayern induziert.

2. Überprüfung der M-Zelldifferenzierung durch qRT-PCR

HINWEIS: Führen Sie die folgenden Arbeiten an einem sterilen RNAse-freien Bankraum durch. Eine Liste der bevorzugten Materialien für qRT-PCR finden Sie in der Tabelle der Materialien.

  1. Entfernen Sie das Medium aus den oberen und unteren Kammern und waschen Sie die obere Kammer 2x sanft mit 300 l Raumtemperatur PBS.
  2. Fügen Sie jeder oberen Kammer 300 l Trizol hinzu. Bei Raumtemperatur 5 min inkubieren.
    VORSICHT: Tragen Sie Handschuhe und Augenschutz bei der Verwendung von Trizol, um den Kontakt mit der Haut zu vermeiden, wie in den Anweisungen des Herstellers angegeben.
  3. In der Zwischenzeit Mikrozentrifugenröhrchen für jeden Brunnen beschriften und 700 l Trizol zu jedem Röhrchen hinzufügen.
  4. Sammeln Sie die Zellhomogenatdurchlage, indem Sie 3x vorsichtig mit einem P1000 auf und ab pfeifen und den Inhalt in das entsprechende Mikrozentrifugenrohr übertragen. Wirbel für 5 s zu mischen.
  5. Bewahren Sie die Proben bei Raumtemperatur für weitere 3 min auf. Dann bei -80 °C bis zu einem Monat lagern.
  6. Befolgen Sie die standardqRT-PCR-Methodik für RNA-Isolation, DNase-Behandlung, Reverse Transcription und qRT-PCR-Reaktionen. Siehe Primerliste in Tabelle der Materialien.

3. Überprüfung der M-Zell-Differenzierung durch Immunfluoreszenz

HINWEIS: Halten Sie die untere Kammer der Platte immer mit PBS gefüllt, damit die Membranen nass bleiben. Dieses Verfahren wird auf der Bank durchgeführt. Eine Liste der bevorzugten Materialien für die Immunfluoreszenz finden Sie in der Tabelle der Materialien.

  1. Entfernen Sie das Medium aus der oberen Kammer und waschen Sie 2x vorsichtig mit 300 l Raumtemperatur PBS. Fügen Sie der oberen Kammer 100 l Raumtemperatur 4% PFA in PBS hinzu. Bedecken Sie die Platte mit Folie und lassen Sie 25 min bei Raumtemperatur stehen. Entfernen Sie 4% PFA.
    VORSICHT: 4% PFA sollten ordnungsgemäß als gefährliche chemische Abfälle entsorgt werden.
  2. Waschen Sie die obere Kammer 3x mit 300 l Raumtemperatur PBS. An dieser Stelle können die Proben bis zu einem Monat vor der Färbung bei 4 °C bleiben. Einmal gebeizt, sollten Proben innerhalb einer Woche für Bilder in bester Qualität visualisiert werden.
  3. Inkubieren Sie die Monolayer mit 100 l 5% Rinderserum Albumin (BSA), die in PBS für 30 min bei Dunkelheit bei Raumtemperatur gelöst sind, um die Monolayer zu blockieren.
  4. Bereiten Sie die GP2-Primärantikörperlösung in 1% BSA in PBS bei einer Verdünnung von 1:100 vor. Fügen Sie 100 l pro Brunnen hinzu. Fleck für 1 h bei Raumtemperatur im Dunkeln. Entfernen Sie die Lösung.
    HINWEIS: Durchlässigen Sie die Monolayer nicht, bevor der primäre Fleck für GP2 auftritt, da eine optimale primäre GP2-Oberflächenfärbung von M-Zellen ohne Permeabilisierung erreicht wird.
  5. Waschen Sie die obere Kammer 3x mal mit 300 l Raumtemperatur PBS.
  6. Bereiten Sie sekundäre Fleckenlösung von fluoreszierend getaggten Ziegenanti-Maus-IgG bei 1:200, Phalloidin bei 1:100 und DAPI in 1% BSA+ 0,1% Triton in PBS vor. Fügen Sie 100 l pro Brunnen hinzu. Fleck für 30 min bei Raumtemperatur im Dunkeln.
    HINWEIS: Triton wird der sekundären Fleckenlösung hinzugefügt, um die Zellen während dieses Schritts für den richtigen Phalloidin-Fleck zu permeabilisieren.
  7. Waschen Sie 3x mit 300 l PBS.
  8. Legen Sie einen 5-L-Tropfen der Montagelösung (Tabelle der Materialien) auf eine Glasrutsche. Entfernen Sie den Brunnen von der 24 Well Platte und invertieren. Schneiden Sie die Membran vorsichtig aus dem Brunnen mit einem Skalpell. Legen Sie die Membran mit den Zellen nach oben auf das Tröpfchen der Montagelösung auf dem Glasschlitten. Fügen Sie 10 L Montagelösung auf die Oberseite und Mitte der Membran und legen Sie einen Deckelrutsch auf die Oberseite, um die Membran zwischen dem Glasschlitten und dem Deckelzuschlag zu versiegeln.
  9. Trocknen Sie die Dias bei Raumtemperatur im Dunkeln für 24 h. Gefärbte Dias sollten auf konfokalen Mikroskop innerhalb von 1 Woche nach der Färbung visualisiert werden.

Representative Results

Ileale Enteroide, die in ECM angebaut werden, werden visuell und per qRT-PCR auf ihren relativen Gesundheitszustand und Differenzierungszuständen als Mittel zur Qualitätskontrolle für ileale enteroide Kulturen und für den Einsatz in Monolayern analysiert. Undifferenzierte ileale Enteroide, die in ECM angebaut werden, erscheinen in der Morphologie klar und zystisch, was auf das Vorhandensein vieler Stammzellen hinweist (Abbildung 1A). Im Laufe der Zeit können undifferenzierte ileale Enteroide, die in Wachstumsmedien angebaut werden, einen Zwischenphänotyp annehmen, bei dem einige zystisch und einige undurchsichtig erscheinen (Abbildung 1B). Häufig ähneln unsere undifferenzierten Stichproben den in Abbildung 1B und nicht in Abbildung 1Adargestellten Beispielen. Diese Zwischenkulturen enthalten terminal differenziertere Enterozyten, gemessen anhand des Ausdrucks des Enterozytenmarkers, sucrase isomaltase (SI), und vermutlich extrudierte tote Enterozyten im Lumen tragen zu ihrem dichten Erscheinungsbild bei. Ileal-Enteroide können in diesem Zwischenzustand für die Monolayer-Entwicklung verwendet werden, aber es ist zu beachten, dass die Menge der in den Kulturen vorhandenen Darmstammzellen gering sein kann und einige differenzierte Zelltypen vorhanden sein können (siehe z. B. qRT-PCR In undifferenzierten Stichproben, die im ECM angebaut werden, ähnlich Abbildung 1B in Abbildung 2). Zum Vergleich: Ileal-Enteroide, die mit Differenzierungsmedien im ECM für 5+ Tage kultiviert wurden, erscheinen einheitlich verdunkelt und lobular und Kulturen mit dieser Morphologie sind keine guten Kandidaten für die Aussaat von Monolayern (Abbildung 1C).

Die Expression von Stammzellgenen und Genen der Darmzelldifferenzierung kann mit qRT-PCR als weiteres Mittel zur Bewertung des Gesundheitszustands von ilealen Enteroiden, die in ECM angebaut werden, und ihrer Differenzierungsfähigkeiten analysiert werden, sobald sie als Monolayer auf Transwells gesät wurden. Die Expression eines Stammzellgens, LGR5, ein Enterozytengen, SI, ein Kelchenzellgen, MUC2, und ein Paneth-Zellgen, LYZ, wird zwischen undifferenzierten ilealen enteroiden Kulturen, die in ECM angebaut werden, und differenzierten ilealen enteroide Monolayer in Gegenwart oder Abwesenheit von RANKL/TNF (Abbildung 2). Während die Werte zwischen den Experimenten unterschiedlich sein können, sollte die Expression von LGR5 nach Differenzierung der Monolayer18,26abnehmen. Die LGR5-Expression wird in den differenzierten ilealen Monolayern ohne RANKL und TNF-Expression in der Regel nicht am Tag 7 nachgewiesen. Umgekehrt nimmt die Expression von Differenzierungsmarkern bestimmter Zelltypen, wie SI und MUC2, nach Differenzierung18zu. Der Ausdruck von LYZ nimmt in der Regel nach Differenzierung in unseren Kulturen ab. Wenn die ilealen enteroiden Kulturen, die zur Herstellung von Monolayern verwendet werden, eher wie Abbildung 1B aussehen als Abbildung 1A,kann der Anstieg der Darmdifferenzierungsmarker nach der Differenzierung bescheiden sein, da diese Anfangskulturen in Intestinalzelltypen und haben einen höheren Basalgehalt von SI und MUC2. Die Differenzierung in Monolayern erfolgt jedoch nach wie vor, wie durch den Verlust der LGR5-Expression und Mikroskopie beurteilt wird (siehe unten). Darüber hinaus reduziert die Zugabe von RANKL und TNF zu den Differenzierungsmedien den Verlust des LGR5-Ausdrucks (Abbildung 2). Parallel dazu ist die Expression von SI und MUC2 etwas niedriger als in der differenzierten Bedingung ohne RANKL und TNF, obwohl ihre Werte über den undifferenzierten Zustand steigen.

Die M-Zelldifferenzierung in Monolayern wird sowohl durch qRT-PCR als auch durch Immunfluoreszenz mit zwei M-zellspezifischen Markern wie Zelloberflächenglykoprotein 2 (GP2) und Transkriptionsfaktor SpiB21bestimmt. Die Expression von GP2 und SPIB wird in den ilealenteroid-abgeleiteten Monolayern in Gegenwart von RANKL und TNF- hochreguliert und nicht in nicht-RANKL- und TNF-behandelten Proben nachgewiesen (Abbildung 3). Die Expression dieser Marker kann auch auf ein Stück dünnes Darmgewebe22normalisiert werden, sofern verfügbar. Dies ermöglicht den Faltenwechsel dieser M-Zellmarker, mit Gewebe zu vergleichen, das M-Zellen hat, anstatt Monolayer zu kontrollieren, die keine Expression dieser Marker haben, und ermöglicht die Standardisierung zwischen Experimenten in einem Labor. M-Zellen werden auch durch Oberflächenexpression von GP2 durch Immunfluoreszenz nachgewiesen (Abbildung 4). Typischerweise werden in einer konfluenten Monoschicht 1 bis 5 M-Zellen in einem gegebenen Mikroskopfeld bei 40-facher Vergrößerung durch Tage 6 bis 8 in Proben beobachtet, die mit RANKL und TNF behandelt wurden (Abbildung 4A-D). In den unbehandelten Proben ist kein GP2-Ausdruck zu sehen (Abbildung 4E). Die orthogonale Ansicht der XZ-Ebene, die mit einer Phalloidinsonde überlagert ist, zeigt Aktinstrukturen, die jede Zelle umgeben, und die GP2-Expression auf der apikalen Oberfläche von M-Zellen (Abbildung 4F-G). Dieses Modell rekapituliert die niedrige Häufigkeit von M-Zellen im menschlichen Darmgefunden 1,2,8. Um M-Zellen für weitere Untersuchungen zu reinigen und zu isolieren, können M-Zellen mit GP2-Oberflächenexpression gebeizt und mit FACS für GP2+-Zellen sortiert werden.

M-Zellen binden und transportieren Antigen aus dem Darmlumen zu den Immunzellen, die sich unter dem Epithel2befinden. SekretorischeIg im Darm produziert bindet an Bakterien und kann an die apikale Oberfläche der M-Zellen binden, um den Transport der Mikroben zu erleichtern27,28. Um festzustellen, ob die in diesem Modell entwickelten M-Zellen in der Lage sind, sich an IgA zu binden, wird das humane Serum IgA in die obere Kammer gegeben, erlaubt für 1 h zu binden, und dann werden die Monolayer für die Immunfluoreszenzanalyse vorbereitet. Das Vorhandensein von IgA auf M-Zellen wird mit einem fluorkonjugierten Sekundärantikörper visualisiert, der die schwere Kette des menschlichen Serums IgA erkennt. M-Zellen, die mit IgA für 1 h behandelt wurden, haben IgA an die apikale Oberfläche gebunden (Abbildung 5A), während M-Zellen in Kontrollbrunnen, die nur mit dem sekundären Antikörper zu IgA behandelt wurden, kein nachweisbares Signal haben (Abbildung 5B). Darüber hinaus bindet IgA speziell an die apikale Oberfläche von M-Zellen und wird nicht an Zellen ohne GP2-Oberflächenfleck gebunden gefunden. Darüber hinaus haben M-Zellen charakteristisch kürzere dichte Actin auf ihrer apikalen Oberfläche2. Um die M-Zellmorphologie in diesem Modell zu analysieren, werden ileal enteroidabgeleitete Monolayer für 7 Tage angebaut und für die Immunfluoreszenzanalyse von F-Actin mit Phalloidin geerntet. Messungen der Aktin-Pixel-Intensität werden für M-Zellen und für Nicht-M-Zellen berechnet, die direkt an jede M-Zelle mit ImageJ-Software angrenzen (Abbildung 6A). Die Actin-Intensität wird auf GP2+ M-Zellen in diesem Modell reduziert und ein repräsentatives Bild ist in Abbildung 6Bdargestellt. Insgesamt haben die m-Zellen, die in diesem ilealen enteroidabgeleiteten Monolayer-Modell entwickelt wurden, charakteristische Genexpression, Morphologie und einige M-Zellfunktionen menschlicher Darm-M-Zellen, wie z. B. Die Bindung an IgA.

Figure 1
Abbildung 1: Repräsentative Morphologie menschlicher ilealer Enteroide im ECM eine Woche nach der Spaltung. (A) Klare und zystische undifferenzierte ileale Enteroide. (B) Zwischenphänotyp mit einigen zystischen ilealen Enteroiden und einigen opaken lobulären ilealen Enteroiden. (C) Verdunkelte und lobuläre differenzierte ileale Enteroide. Bilder, die durch die Linse eines optischen Lichtmikroskops bei 4-facher Vergrößerung mit einer iPhone7-Kamera aufgenommen wurden. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Relative Expression von Stammzellen und Differenzierungsmarkern menschlicher ilealer Enteroide, die im ECM angebaut oder als Monolayer unterschieden werden. Ileale Enteroide wurden 7 Tage lang in ECM (Undifferenziert) oder als Monolayer ohne (Differentiated) oder mit RANKL und TNF (Differentiated +R/T) angebaut und differenziert. Ileale Enteroidkulturen oder Monolayer wurden in Trizol zur RNA-Extraktion geerntet. Die Genexpression wurde durch qRT-PCR bestimmt und wird relativ zu GAPDHausgedrückt. Die Daten sind durchschnittlich 3 unabhängige Brunnen von ilealen Enteroiden oder Monolayern pro Zustand. Fehlerbalken zeigen SEM an. ND wird nicht erkannt. Die statistische Signifikanz wurde anhand von logtransformierten Werten anhand von einseitiger ANOVA mit Dunnetts Mehrfachvergleichstest im Vergleich zum Undifferenzierten ermittelt. ** p < 0.01, *** p < 0.001 Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Relative Expression der M-Zellspezifischen Marker GP2 und SPIB aus humanen ilealenteroidabgeleiteten Monolayern. RANKL/TNF-behandelte und nicht behandelte humane ileal enteroid-abgeleitete Monolayer wurden in Trizol zur RNA-Extraktion nach 7 Tagen nach der Aussaat geerntet. Die Genexpression wurde durch qRT-PCR bestimmt und wird relativ zu GAPDHausgedrückt. Die Daten sind durchschnittlich 6 unabhängige Monolayer pro Zustand. Fehlerbalken zeigen SEM an. ND wird nicht erkannt. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Immunfluoreszenz der OBERFLÄCHEN-GP2-Expression auf M-Zellen in humanen ilealenteroid-abgeleiteten Monolayern im Laufe der Zeit. RANKL/TNF-behandelte und nicht behandelte humane ileal enteroid-abgeleitete Monolayer wurden in 4% PFA fixiert und an verschiedenen angegebenen Tagen nach der Aussaat für Immunfluoreszenz gefärbt. Bilder wurden mit ImageJ-Software analysiert. DAPI = Blau; Glykoprotein 2 (GP2) = Rot. (A-D) RANKL/TNF-behandelte Monolayer an verschiedenen Tagen nach der Aussaat. (E) Nicht behandelte Monoschicht, die am Tag 7 nach der Aussaat geerntet wird. (F-G) Orthogonale XZ-Ebene von Monolayern am Tag 7 nach der Aussaat mit Phalloidinsonde für F-Actin überzogen. Phalloidin = Cyan. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: IgA bindet spezifisch an die apikale Oberfläche von M-Zellen. DIE mit RANKL/TNF behandelten humanen ilealen Enteroid-abgeleiteten Monolayer wurden 7 Tage lang angebaut und dann (A) mit 10 g humanem Serum IgA für 1 h oder (B) mit PBS nur (Keine IgA-Kontrolle) behandelt. Nach 1 h wurden Monolayer 2x in PBS gewaschen, in 4% PFA fixiert, mit 0,1% TritonX-100 permeabilisiert und für Immunfluoreszenz gefärbt. Die Bilder wurden mit der ImageJ-Software analysiert und sind repräsentativ für 3 unabhängige Experimente. DAPI = Blau; Glycoprotein 2 (GP2) = Rot; Antikörper gegen humanes Serum IgA = Grün; Phalloidin = Cyan. Schwarze Pfeile bezeichnen IgA, die an die apikale Oberfläche der M-Zelle gebunden ist. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 6
Abbildung 6: M-Zellen haben eine reduzierte Aktinintensität im Vergleich zu benachbarten Nicht-M-Zellen. RANKL/TNF-behandelte humane ileal enteroid-abgeleitete Monolayer wurden 7 Tage lang angebaut und dann in 4% PFA fixiert und für Immunfluoreszenz gefärbt. (A) Mit ImageJ wurden GP2+ M-Zellen mit dem Freihandauswahl-Tool skizziert und Messungen von Fläche und integrierter Dichte wurden im Phalloidin-Kanal durchgeführt. Die gleiche Analyse wurde dann für jede benachbarte Nicht-M-Zelle abgeschlossen, die der M-Zelle angrenzt. Die Rohe Integrierte Dichte wurde zur Normalisierung durch die Fläche jeder einzelnen Zelle geteilt. Die durchschnittliche integrierte Dichte/Fläche wurde für jede benachbarte Nicht-M-Zelle für jede M-Zelle berechnet. Die Bilder wurden aus 3 unabhängigen Experimenten analysiert; Jeder Punkt ist eine M-Zelle oder ein Durchschnitt benachbarter Zellen. Fehlerbalken geben SD an. Die statistische Signifikanz wurde für logtransformierte Werte mit einem Paired t-Test ermittelt. p = 0.0001 (B) Repräsentatives Bild von XZ Plane aus Plot in A. Bilder wurden mit ImageJ Software analysiert. DAPI = Blau; Glycoprotein 2 (GP2) = Rot; Phalloidin = Cyan. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Discussion

Um Monolayer zu entwickeln, die sich richtig in die wichtigsten Darmzelltypen und M-Zellen differenzieren, ist es wichtig, sich mehrerer Faktoren bewusst zu sein. Ileale Enteroide müssen aus ECM-Kulturen geerntet werden, die undifferenziert sind und einen hohen Anteil an Lgr5+ Stammzellen haben. Optisch sollte die Mehrheit der ilealen Enteroide in den ECM-Kulturen nicht abgedunkelt und multilobular sein, und die LGR5-Expression sollte in diesen Kulturen durch qRT-PCR-Analyse nachgewiesen werden. Die Qualitätskontrolle konditionierter Medien ist für die Verbreitung undifferenzierter Kulturen im Laufe der Zeit unerlässlich und muss für jede produzierte Charge konditionierter Medien abgeschlossen werden. Die Qualitätskontrolle kann durch das Testen einer neuen Mediencharge auf einigen ECM-Kulturen und den Vergleich der Morphologie der ilealen Enteroide mit einer früheren Charge von Medien im Laufe einer Woche abgeschlossen werden. Die LGR5-Expression sollte in den ilealen Enteroidkulturen, die in der neuen Mediencharge angebaut werden, im Vergleich zur vorherigen Charge relativ ähnlich bleiben.

Bei der Vorbereitung der ilealen Enteroide für die Aussaat als Monolayer ist es wichtig, die Zelllösung nach der Inkubation mit Trypsin kräftig zu pipetten, um die ilealen Enteroide in einzelne Zellen aufzuteilen. Zellklumpen können zu mehrschichtigen Bildungen führen, wenn sie für Monolayer gesät werden. Darüber hinaus ist es wichtig, empirisch die Anzahl der Zellen zu bestimmen, die erforderlich sind, um eine Monoschicht für jede einzelne ileale Enteroidlinie zu bilden, die erhalten wird. Typischerweise kann dieser Wert zwischen 2,5 x 105 – 5,0 x 105 Zellen/Gut reichen, hängt aber vom Grad der zystischen bis nicht zystischen ilealen Enteroide in Kulturen ab und variiert für jede einzelne ileale Enteroidlinie. Aus Erfahrung erfordern ileale Enteroide, die in ECM angebaut werden und weniger zystisch erscheinen, eine höhere Zellsaatdichte, um Monolayer zu erreichen. Es ist ratsam, die obere Kammer nach 1 Tag des Wachstums zu waschen, indem Sie die Medien 2-3 Mal sanft nach oben und unten pfeifen und durch frische Wachstumsmedien ersetzen. Dieser Prozess löst Zellen, die auf anderen Zellen gelandet sind, wodurch die Wahrscheinlichkeit einer mehrschichtigen Bildung verringert wird. Die Umstellung der Medien in der oberen Kammer von Wachstumsmedien auf M-Zellmedien, wenn die Monolayer zu 80 % konfluent sind, was normalerweise bei Tag 2 nach der Aussaat auftritt, trägt zu einer guten M-Zelldifferenzierung bei. Die Zugabe von RANKL/TNF a in die obere Kammer während der M-Zell-Induktion führt nicht zur Entwicklung einer größeren Anzahl von M-Zellen pro Monoschicht und kann daher aus den oberen Kammermedien herausgelassen werden. Transwells unterschiedlicher Porengrößen können in diesem Protokoll verwendet werden, ohne die Entwicklung von M-Zellen zu beeinträchtigen; Allerdings muss die Zellsädichte für Personen mit größeren Porengrößen optimiert werden. Kollagen IV kann für ECM als Kellermembran-Proteinbeschichtung für Transwells oder Brunnenplatten ersetzt werden, die für bestimmte Anwendungen besser geeignet sind.

Ileal enteroid-abgeleitete Monolayer auf Transwells bieten ein Zweikammersystem, das die Erstellung definierter apikaler und basolateraler Oberflächen ermöglicht, so dass die 4-5 verschiedenen Arten von epitheliaalen Darmzellen polarisieren können, um Oberflächenmarker auf jedem Seite relativ zu der im Darm gefundenen. Beiden Seiten können zusätzliche Faktoren hinzugefügt werden, z. B. Partikel, Infektionserreger oder andere Zelltypen. Bis heute gibt es jedoch noch einige Einschränkungen. Wie beschrieben, ist dieses System ein statisches System, das physiologischen Fluss, Darmkontraktionen und Darmgehalt fehlt. Darüber hinaus geht die Villus-Crypt-Architektur durch die Bildung einer flachen Monoschicht verloren. Diesen Systemen fehlen Peyers Patchregionen, Immunzellen und Stromalzellen. Ob der Mangel an Immun- und Stromalzellen, die sich eng unter M-Zellen befinden, die Invaginationen beeinflusst, die in diesem System nicht beobachtet werden, und andere physiologische Funktionen ist ein wichtiger zukünftiger Untersuchungsbereich. Dieses Protokoll kann an eine 96-Well-Platte oder ein Multi-Well-Plattenformat angepasst werden. Das Verfahren zur Beschichtung der 96-Well-Platte mit ECM und der Aussaat mit Einzelzellen aus ilealen Enteroiden bleibt das gleiche wie bei Transwells. Die Titration der Zellsädichte, die erforderlich ist, um Monolayer zu erhalten, muss durchgeführt werden, reicht aber in der Regel von 1,0 x 105 – 3,0 x 105 Zellen/Gut in einem 96-Well-Plattenformat. M-Zellen werden induziert, indem die Wachstumsmedien durch M-Zellmedien ersetzt werden, wenn die Monolayer in der Regel durch Tage 1-3 zusammenfließen, abhängig von der anfänglichen Zellsaatdichte.

Diese Methode zur Unterscheidung von M-Zellen von ilealen Enteroiden in vitro bietet signifikante Verbesserungen gegenüber der Caco-2-Methode. Die ilealen Enteroide sind Primärzellen und mindestens 4-5 Epithelzellentypen sind im System vorhanden. Darüber hinaus können ileale enteroide Linien, die von verschiedenen Menschen abgeleitet wurden, untersucht werden, um zu untersuchen, wie Genetik oder Krankheitszustand die Entwicklung und das Verhalten von M-Zellen beeinflussen. Eine zusätzliche Manipulation der ilealen Enteroide während der M-Zelldifferenzierung ermöglicht ein besseres Verständnis der M-Zellentwicklung einschließlich der Charakterisierung von M-Zellvorläuferzellen. Da die molekularen Mechanismen der M-Zellphagozytose und Transzytose noch nicht vollständig verstanden sind3,29, bietet dieses Modell die Möglichkeit, Antigen- und Partikelaufnahme durch M-Zellen zu untersuchen und zu visualisieren.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Diese Arbeit wurde von NIAID U19AI131126 an Dr. Isberg (Tufts University School of Medicine) und Dr. Kaplan (Tufts University) unterstützt; (JM ist Projektleiter von Project 2) und NIAID R21AI128093 an JM. ACF wurde teilweise von NIAID T32AI007077 unterstützt. SEB und MKE wurden von NIAID U19AI116497-05 unterstützt. Wir danken den Mitgliedern des Mecsas-Labors, des Ng-Labors und Dr. Isberg an der Tufts University School of Medicine für nützliche Diskussionen. Die konfokale Bildgebung wurde am Tufts Center for Neuroscience Research, P30 NS047243, durchgeführt.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics