Målinger av fysiologiske stressresponser i C. Elegans

* These authors contributed equally
JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her karakteriserer vi cellulære proteotoksiske stressresponser i nematoden C. elegans ved å måle aktiveringen av fluorescerende transkripsjonelle journalister og assaying følsomhet for fysiologisk stress.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Organismer blir ofte utsatt for varierende miljøer og endringer i intracellulær homeostase, som kan ha skadelige effekter på deres proteome og fysiologi. Dermed har organismer utviklet seg målrettet og spesifikke stressresponser dedikert til å reparere skade og opprettholde homeostase. Disse mekanismene inkluderer den utfoldede proteinresponsen til endoplasmatisk reticulum (UPRER),den utfoldede proteinresponsen til mitokondriene (UPRMT),varmesjokkresponsen (HSR) og oksidativ stressrespons (OxSR). Protokollene som presenteres her beskriver metoder for å oppdage og karakterisere aktiveringen av disse banene og deres fysiologiske konsekvenser i nematoden, C. elegans. For det første er bruk av veispesifikke fluorescerende transkripsjonelle reportere beskrevet for rask cellulær karakterisering, narkotikascreening eller storskala genetisk screening (f.eks. RNAi eller mutantbiblioteker). I tillegg beskrives komplementære, robuste fysiologiske analyser, som kan brukes til å direkte vurdere følsomhet en dyr til spesifikke stressfaktorer, og fungerer som funksjonell validering av transkripsjonsreporterne. Sammen tillater disse metodene rask karakterisering av cellulære og fysiologiske effekter av interne og eksterne proteotoksiske perturbasjoner.

Introduction

Evnen til en organisme til å reagere på endringer i det intra- og ekstracellulære miljøet er avgjørende for sin overlevelse og tilpasning. Dette oppnås på cellenivå gjennom mange beskyttende veier som sikrer cellens integritet. Mens mange cellulære komponenter er utsatt for stress-assosiert skade, en stor involvering av cellulære stress responser er å reparere og beskytte homeostase av cellulær proteome. Men kompartaliseringen av proteiner i spesielle strukturer, kalt organeller, utgjør en utfordring for cellen, da den ikke kan stole på en sentralisert form for proteinkvalitetskontroll for å sikre at alle proteinene i cellen er riktig brettet og funksjonelle. Derfor, for å håndtere perturbasjoner til sine proteiner, har organeller utviklet dedikerte kvalitetskontrollmekanismer, noe som kan føle feilfoldede proteiner og aktivere en stressrespons i et forsøk på å lindre stresset i det rommet. For eksempel er cytosol avhengig av varmesjokkresponsen (HSR), mens endoplasmatisk reticulum (ER) og mitokondrier er avhengige av deres kupéspesifikke utfoldede proteinresponser (UPR). OxSR tjener til å lindre de toksiske effektene av reaktive oksygenarter (ROS). Hver stressrespons utløses i nærvær av cellulære utfordringer og miljøfornærmelser og induserer en skreddersydd transkripsjonsrespons. Kjennetegnene på disse svarene inkluderer syntetiserende molekyler som re-fold misfolded proteiner (som chaperones) rettet mot riktig organelle, eller alternativt fjerne skadede proteiner ved protein nedbrytning. Unnlatelse av å aktivere disse stressresponsene resulterer i akkumulering av skadede proteiner, cellulær dysfunksjon forplantet til systemisk svikt i vev, og til slutt død av organismen. Funksjonen og reguleringen av de ulike stresssvarene gjennomgås andre steder1.

Mange innsikter om regulering og aktivitet av cellulære stressresponser har blitt tilskrevet nematode, Caenorhabditis elegans, en flercellet modell organisme i genetisk forskning. Nematoder tillater ikke bare å studere aktivering av stressresponser på cellenivå, men også på organismenivå; nematoder har blitt brukt til å studere effekten av genetiske perturbasjoner eller eksponering for narkotika og forurensende stoffer på deres vekst og overlevelse. Deres raske generasjonstid, isogeni, åpenhet, genetisk tractability og brukervennlighet under eksperimentering gjør dem ideelle for slike studier. I tillegg gjør den relativt raske fysiologiske responsen på stress (mellom timer og noen dager) og evolusjonær bevaring av cellulære veier nematoder til et fremtredende verktøy for å studere stressresistens.

Det er to vanlige E. coli stammer som brukes som matkilde for å vokse C. elegans: standard OP50, en B-stamme der de fleste eksperimentering har blitt historisk utført2 og HT115, en K-12 stamme som brukes til nesten alle RNAi eksperimenter3,4. Det er viktig å merke seg at det er betydelige forskjeller mellom OP50 og HT115 bakterielle dietter. Vekst på disse forskjellige bakterielle kildene har vist seg å forårsake store forskjeller i metabolsk profil, mitokondrie DNA kopi nummer, og flere store fenotyper, inkludert levetid5. Noen av disse forskjellene tilskrives Vitamin B12 mangel forbundet med vekst på OP50 bakterier, noe som kan resultere i defekter i mitokondrie homeostase og økt følsomhet for patogener og påkjenninger. Alle disse fenotypene har vist seg å bli lindret av vekst på HT115 bakterier, som har høyere nivåer av vitamin B126. Derfor anbefales det at alle eksperimenter på fysiologiske stressresponser utføres på HT115-bakterier, uavhengig av nødvendigheten av RNAi-forhold. Men på grunn av den enkle å opprettholde dyr på OP50, kan all standard vekst (dvs. vedlikehold og forsterkning av dyr) utføres på OP50, da betydelige forskjeller i de eksperimentelle paradigmene som er beskrevet her ikke ble oppdaget i ormer opprettholdt på OP50 så lenge de ble flyttet til HT115 postsynkronisering (dvs. fra luke etter bleking med eller uten L1 arrestere) før eksperimentering.

Her er karakteriseringen av aktiviteten til cellulære stressresponser ved hjelp av to funksjonelle metoder beskrevet. Det bør bemerkes at protokollene som presenteres er primært fokusert på cellulære stressresponser og deres innvirkning på protein homeostase. For det første benyttes fluorescerende transkripsjonsreportere, som reguleres av endogene genarrangører som er spesielt aktivert som svar på ulike cellulære påkjenninger. Disse fluorescerende transkripsjonelle journalistene er basert på transkripsjonsinduksjon av spesifikke gener som er opprinnelig en del av stressresponsen. For eksempel aktiveres HSP-4, et varmesjokkprotein ortolog til den menneskelige chaperone HSPA5/BiP, på ER-stress og lokaliserer til ER for å lindre stresset. Under forhold med ER-stress (f.eks. eksponering for tunikamycin), et grønt fluorescerende protein (GFP), plassert under regulering av hsp-4-promotoren, syntetiseres i høye nivåer som kan vurderes ved fluorescerende mikroskopi eller kvantitativt målt ved hjelp av cytometri av nematoder7. På samme måte benyttes arrangøren av en mitokondriechaperone, hsp-6 (ortolog til pattedyr HSPA9), til å overvåke aktiveringen av UPRMT8, og arrangøren av den cytosolic chaperone hsp-16.2 (ortolog til de menneskelige krystallinske alfagenene) brukes til å vurdere aktiviteten til HSR9. Disse reporterne tillater en rask karakterisering av banene aktivert som svar på ulike perturbasjoner.

Ofte er journalistene som presenteres her avbildet ved hjelp av mikroskopi, noe som gir en kvalitativ effekt av aktiveringen av stressresponser. Men mens bildeteknikker gir både informasjon om intensitet og vevplassering av journalistene beskrevet ovenfor, er kvantifiseringen ikke alltid nøyaktig eller robust. Selv om det er mulig å kvantifisere fluorescerende aktivering ved hjelp av bildeanalyseverktøy, er disse metodene relativt lave gjennomstrømnings- og prøvestørrelsen liten, på grunn av det relativt lave antallet dyr avbildet. Den enkle og evne til å oppnå store mengder dyr raskt gjøre C. elegans et ideelt modellsystem for å si aktivering av fluorescerende stress reportere gjennom bruk av en stor partikkel flyt cytometer. En stor partikkelflyt cytometer er i stand til å registrere, analysere og sortere basert på størrelse og fluorescens fra mange levende dyr. Ved hjelp av denne metoden er det mulig å få fluorescerende intensitet, størrelse og også romlig (2D) informasjon for tusenvis av ormer. Systemet styres ved hjelp av FlowPilot, som gjør det mulig for sanntidsdatainnsamling og analyse av de målte parametrene. Her tilbys metoder for både mikroskopisk avbildning og kvantitativ analyse ved hjelp av et cytometer for storpartikkelflyt som metoder for å måle aktiveringen av stressresponser.

Utover reporteranalyse kan følsomheten eller motstanden til dyr mot stress måles ved hjelp av fysiologiske stressanalyser. Dette oppnås ved å utsette dyr for stressende miljøer som aktiverer spesifikke cellulære stressveier. Her er det gitt flere metoder for å måle følsomheten til hele dyr til bestemte typer stressfaktorer.

ER stress påføres C. elegans ved hjelp av kjemisk middel, tunikamycin, som blokkerer N-koblet glykosylering, forårsaker akkumulering av feilfoldede proteiner i ER10. I C. elegans,vekst ved eksponering for tunikamycin resulterer i store perturbasjoner i ER funksjon, og en betydelig redusert levetid11. Ved å måle overlevelsen av dyr på tunikamycinholdige plater, kan ER stressfølsomhet av dyr kvantifiseres. For eksempel har dyr med ektopisk UPRER induksjon og dermed økt motstand mot protein feilfolding stress i ER økt overlevelse ved tunicamycin eksponering sammenlignet med villtype dyr12.

Oksidativt og mitokondriestress påføres C. elegans ved å utsette dyr for det kjemiske middelet, paraquat. Paraquat er et vanlig ugressmiddel, noe som forårsaker superoksiddannelse spesielt i mitokondriene13. På grunn av den spesifikke lokaliseringen av mitokondrier-avledede reaktive oksygenarter (ROS), brukes paraquatanalyser ofte som en "mitokondrie" stressanalyse. Imidlertid blir superoksid raskt omdannet til hydrogenperoksid ved mitokondriesuperoksiddismutaser (SODs)14. Hydrogenperoksid kan deretter spre seg ut av mitokondriene og forårsake oksidativt stress i andre rom i cellen. Derfor beskriver vi paraquat overlevelseanalyser som målefølsomhet for både mitokondrie- og oksidativt stress (andre oksidative stressanalyser kan bli funnet15).

Termotoleranse analyser utføres i C. elegans ved å plassere dyr i forhøyede temperaturer. Omgivelsestemperaturer for nematoder er ~ 15-20 °C og termisk stress induseres ved temperaturer over 25 °C16,17. Termotoleranse analyser utføres vanligvis ved temperaturer fra 30-37 °C, da dyr viser store cellulære defekter ved denne temperaturen, og overlevelsesanalyser fullføres innen 24 timer16,18. Her er det gitt to alternative metoder for å utføre termotoleranseanalyser: vekst ved 34 °C og vekst ved 37 °C. Sammen kan protokollene som presenteres her brukes til å utføre store skjermer når de kombineres med standard genknock-down ved hjelp av RNA-interferens eller kjemiske legemiddelbiblioteker.

Protokollen kan deles inn i 4 brede prosedyrer- vekst av C. elegans og forberedelse til bildebehandling (avsnitt 1 og 2), avbildning av transkripsjonelle reportere ved hjelp av fluorescerende mikroskopi (avsnitt 3-5), kvantitative målinger av journalister ved hjelp av et cytometer for stor partikkelstrøm (avsnitt 6) og fysiologiske analyser for å måle stressfølsomhet i C. elegans (avsnitt 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Standard vekstforhold for temperaturer og OP50 vs HT115

  1. Standard vekst og ekspansjon
    1. Vokse en kultur av OP50 i LB (Tabell 1) eller tilsvarende media av valget for 24-48 h ved omgivelsestemperatur (~ 22-25 °C). Vokse bakterier ved romtemperatur som OP50 er en uracil auxotroph og det er en høyere forekomst av revertants (f.eks suppressor mutanter) når dyrket ved 37 °C. Langsiktig lagring av OP50 kulturer anbefales ikke (maks 1 uke ved 4 °C).
    2. Frø et volum på ~ 100-200 μL mettet OP50 kultur på en 60 mm NGM plate (Tabell 1) for vedlikehold av ormer og 1 ml mettet OP50 kultur på en 100 mm plate for å utvide dyr for eksperimentering.
    3. La platene tørke over natten på en benkeplate.
      MERK: 100 mm plater kan trenge mer tid til å tørke, spesielt hvis du bruker ikke-ventilerte plater. Oppbevar alle C. elegansplater i lufttette beholdere som er lagret ved 4 °C. Ikke bruk plater siste 6 måneder gammel som uttørking av plater vil oppstå, noe som vil endre dyrefysiologi på plater på grunn av forskjellig osmotisk trykk og stivhet av plater.
    4. For standard vedlikehold, flytte 10-15 unge dyr (egg, L1, eller L2 stadier) på en 60 mm plate, selv om flere kan flyttes hvis håndtere mutanter eller transgene dyr med lavere fecundity. For dyr med utviklings- eller fecundity defekter, del en mer variabel pool av dyr for å hindre tap av bestanden. Hvis de holdes ved 15 °C, må du flytte dyr hver uke; i 20 °C, flytt dyr hver 3-4 dag.
    5. Utfør en fersk tining av dyr hver 25-30 passasjer (~ 6 måneder hvis dyrene flyttes en gang i uken og holdes ved 15 °C).
    6. For utvidelse, del en full 60 mm plate på 100 mm plater for ekspansjon. Som referanseramme kan dyr med villtype fecundity ha en full 60 mm plate skåret i 4ths-6ths og bli delt på en stor plate ved 20 °C i 2 dager eller 15 °C i 3 dager for å lage en full 100 mm plate uten å nå sult.

2. Iscenesettelse/synkronisering av ormer ved hjelp av bleking

  1. Bleking protokoll for å synkronisere ormer
    1. Vask gravid ormer (voksne fulle av egg) av agarplater ved hjelp av M9 (Tabell 1). Start fra en ikke-synkronisert populasjon av ormer (dvs. biter ormer fra trinn 1.1.6) til blekemiddel for eksperimenter, da betydelig genetisk drift kan oppstå ved påfølgende runder med synkronisering via bleking.
    2. Flytt orm/M9-blandingen inn i et 15 ml konisk rør ved hjelp av en glasspipette; flere plater av ormer kan samles inn i et enkelt 15 ml konisk rør.
    3. Spinn dyr ned for 30 s på 1000 x g. Aspirer M9 supernatant. Det er unødvendig å vaske av gjenværende bakterier med mindre det er en egregious mengde forurensning eller store klumper av bakterier. Hvis dette er tilfelle, utføre flere vasker med M9.
    4. Forbered et ferskt lager av bleking løsning (Tabell 1). Bleking løsning kan holdes i flere dager ved 4 °C, men bruk nylaget bleking løsning som ineffektiv bleking kan resultere i ujevn bleking, noe som vil forårsake skade på egg før du eliminerer alle orm skrotter.
    5. Tilsett 2-10 ml bleking løsning til dyrene (~ 1 ml blekemiddel løsning for hver ~ 0,1 ml dyr pellet). Inverter blekemiddel- og ormblandingen i ~ 5 min (ikke overstige 10 min; merk at blekingstidene kan variere og bør titreres spesielt for hvert laboratorium). Rist kraftig for å hjelpe oppløse ormskrotter raskere og for optimal bevaring av egg. Sett regelmessig under et disseksjonsmikroskop eller sett det koniske røret i lys for å observere når de voksne ormskrottene er fullstendig oppløst og bare egg forblir i røret.
    6. Pellet eggene ved å spinne på 1000 x g for 30 s og deretter aspirere supernatant. Egg kan sentrifugeres raskere enn ormer uten å forstyrre deres integritet, så hvis de er usikre på sentrifugehastighet, kan egg bli spunnet ned på opptil 2500 x g uten å påvirke fysiologien.
    7. Tilsett M9 opptil 15 ml og inverter røret for å fjerne blekemiddel av eggene.
    8. Gjenta trinn 2.1.6-2.1.7 (vaske-/pelletsprosess) 2-3 ganger til for å fjerne blekemiddel.
    9. Pipet egg/M9 bland på plater og vokse ved 15-20 °C for eksperimentering. For å få et mål på hvor mange ormer du skal bruke, utfør omtrentlige eggtellinger ved å pipe 5 μL eggblanding på en agarplate eller skyve og dele eggtellingen med 5 for å bestemme antall egg per 1 μL volum. I snitt av 3 uavhengige tellinger kan forbedre nøyaktigheten. For å unngå sult er et bord med anbefalte eggtellinger per plate tilgjengelig i tabell 2.
    10. Om nødvendig, L1 arrestere dyr for strammere temporal synkronisering ved å plassere egg / M9 bland i en rotator ved 20 °C i opptil 24 timer. For vill-type dyr, ingen defekter i dyrefysiologi ble oppdaget når L1 arrestere i opptil 48 timer. Men mutanter som er følsomme for sult (f.eks lysosomeller autofagi mutanter) gjør svært dårlig med L1 arrestere, og dermed anbefales det ikke å utføre denne synkroniseringsmetoden for mutanter som er kjent for å være følsomme for sult. Hvis det kreves strengere synkronisering for dyr som ikke kan bli L1 arrestert, bruker du eggleggingsmetoden som er beskrevet i avsnitt 2.2.
  2. Egg-lay protokoll for synkronisering ormer
    MERK: Som en alternativ metode for bleking kan en egg-lay analyse utføres. Egg-lay brukes når bleking av dyr gir ikke en nær nok synkronisering, da egg i eggsekken til voksne dyr kan være så forskjellige som 8-12 timer fra hverandre. For eksperimentelle paradigmer der det er avgjørende for dyr å være så nært iscenesatt som mulig, men hvor L1 arrestere er ikke mulig (f.eks, i sult mutanter), egg-lay analyser anbefales. Det bør imidlertid bemerkes at på grunn av arbeidskraften som er involvert i egg-lay-protokollen, er det mindre mulig å utføre høyskalaeksperimenter.
    1. Plasser 4-12 voksne gravid (se Merk etter trinn 2.2.2) på en standard OP50- eller HT115-seeded NGM-plate (se avsnitt 1 ovenfor for anbefalinger om bakteriestammer). Avhengig av omfanget av eksperimenter, kan flere plater brukes. Sørg for å nøye dokumentere hvor mange dyr som er på hver plate for trinn 2.2.
    2. Plasser dyr ved ønsket temperatur for eksperimenter (15-20 °C) i 4-8 timer.
      MERK: Antall timer dyr er igjen på platen vil avgjøre hvor tett synkronisert det første egget lagt og det siste egget lagt vil være, slik at timingen kan justeres etter behov. Siden kortere inkubasjonstider vil bety at hvert dyr har mindre tid til å legge egg, bør flere dyr plasseres på tallerkener for å sikre at nok egg legges. Mens den faktiske eggleggingshastigheten ikke er fullstendig normalisert på grunn av tendensen til dyr å gå gjennom korte utbrudd av egglegging i stedet for en normalisert hastighet på egg-lay, kan den gjennomsnittlige frekvensen av egg lagt per dyr estimeres til ~ 5 egg / time for dyr som viser villtype fecundity19. Når du prøver å dyrke dyr til dag 1 voksen stadium, tid egg-lay å ha <100 egg per tallerken for å unngå sult (se tabell 2 for mer informasjon om anbefalte dyr per tallerken).
    3. Fjern voksne dyr fra plater. Sørg for at alle voksne dyr fjernes fra plater, da dyr vil fortsette å legge egg og resultere i en usynkronisert populasjon og / eller sult av platen.

3. Vekstforhold for ormer for avbildning av transkripsjonelle reportere

  1. Vekst av ormer
    1. Inokulere bakteriell kultur av HT115 husing pL4440 RNAi plasmid (EV) og/ eller bærer en RNAi kassett mot ønsket mål gen(er) i LB media supplert med 100 μg / ml karbenicillin og 20 μg / ml tetracyklin.
    2. Vokse kultur over natten (~ 16 timer) til metning i en risting 37 °C inkubator.
    3. Spot 60 mm NGM RNAi plater med 200 μL mettet bakteriell kultur og 100 mm NGM RNAi plater med 1000 μL mettet bakteriell kultur. La tørke ved omgivelsestemperatur (~22 °C) over natten i mørket (dekket løst med aluminiumsfolie).
    4. Plasser synkronisert populasjon av transgene ormer som bærer fluorescerende reportere (se tabell 3 for fullstendig liste) på NGM RNAi plater sådd med bakterier av valget.
    5. Vokse ved 15-20 °C til nødvendige stadier for spesifikke journalister som beskrevet nedenfor.
  2. Hensyn for iscenesettelse av ormer for eksperimenteringer
    1. Utfør eksperimenter for transkripsjonelle reportere på dag 1 av voksen alder, med unntak av analyser som krever L4 dyr. Ifølge WormAtlas oppnås L4 dyr ca. 2,5 dager (~56 h) med vekst ved 20 °C fra eggstadiet (www.wormatlas.org).
    2. For "dag 1 voksne" bruk dyr på ca 3-4 dager (~ 65-96 h) av vekst ved 20 ° C etter plating egg.
      MERK: Dette brede området forklares som følger: ~65 h ved 20 °C er når dyr når "egglegging", som er den sanne "voksenalder" tilstand. 96 timer er når dyr kommer inn i det WormAtlas beskriver som "egglegging maksimal", som er når den voksne er gravid voksen og har en full egg sac. Dette er når dyr vil bli beskrevet som eldre enn dag 1 og kan begynne å vise forskjeller, og dermed protokollene beskrevet her anbefales alle å starte i denne "dag 1" scenen starter så tidlig som 65 timer og så sent som 96 h. For analysene som er beskrevet her, ble det ikke observert store forskjeller ved bruk av dyr i dette ~ 65-96 h-vinduet.
    3. For replikering av et enkelt eksperiment, bruk et lignende tidspunkt for mer robust reproduserbarhet (f.eks. utfør alle eksperimenter på ~ 65 h eller ~ 96 h etter plating egg).
      MERK: Noen transgene dyr og mutanter viser reduserte vekstrater. For dette finnes det to anbefalinger. 1) Bruk forskjøvet synkronisering, hvor dyr kan blekes til forskjellige tider for at eksperimentering skal utføres samtidig. Dette anbefales når teknisk variasjon i analysen kan være større enn de tekniske variasjonene som kan oppstå fra synkroniseringsanalysen (f.eks. overlevelsesanalyser, som kjører i lange varigheter, kan lide hvis de ikke utføres samtidig). 2) Bruk forskjøvet analyse, hvor dyr kan blekes samtidig, men analysen i seg selv utføres til forskjellige tider. Dette anbefales for svært enkle analyser som ikke har iboende variabilitet (f.eks. RNAi-induksjon av stressresponser).

4. Induksjon av stressresponser

  1. Bruke hsp-4p::GFP som en avlesning for aktivering av UPRER
    1. Indusere ER stress ved hjelp av RNAi
      1. Forbered plater oppdaget med RNAi-bakterier rettet mot genet av interesse på NGM RNAi plater (Tabell 1) som i avsnitt 3. Bruk EV som en kontroll for basal UPRER nivåer og RNAi knockdown av tag-335 (enzym for N-bundet glykosylering av ER bosatt proteiner; RNAi knockdown har lignende effekter til tunicamycin behandling) som en positiv kontroll for aktivering av UPRER under ER stress.
      2. Synkroniser hsp-4p::GFP reporter dyr ved hjelp av metoder som er beskrevet i seksjon 2.
      3. Plate egg på RNAi plater ved hjelp av kriterier anbefalt i tabell 2.
      4. Inkuber egg ved 20 °C i ca. 3-4 dager (~65-96 h) for å utføre eksperimenter på dag 1 i voksen alder. For UPRER ER-eksperimentene er det forskjeller i basal fluorescens av hsp-4::GFP-reporteren når den dyrkes ved forskjellige temperaturer. Utfør derfor alle eksperimenter ved 20 °C.
    2. Indusere ER stress ved hjelp av et kjemisk middel
      1. Synkroniser hsp-4p::GFP reporter dyr ved hjelp av metoder som er beskrevet i seksjon 2 og vokse ved 20 °C til dyrene når L4 scenen. Overfør dyr til et rør på M9. La ormene bosette seg (~ 2-3 min ved tyngdekraften eller en 30 s spinn på 1000 x g),og fjern deretter M9.
      2. Fortynn tunikamycin til 25 ng/ml i M9 (en 1:40 fortynning fra 1 mg/ml lager). Som en kontroll fortynner også et tilsvarende volum av DMSO i M9.
      3. Tilsett 25 ng/ml tunikamycin/M9 eller kontroller DMSO/M9-oppløsningen til ormer (bruk 400-500 ml for et 1,5 ml rør eller 2 ml for et 15 ml konisk rør). Inkuber ved 20 °C på en roterende plattform i 3-4 timer.
        MERK: Tunikamycin kan også fortynnes direkte i orm/M9-blanding.
      4. La ormene bosette seg, fjerne M9/TM-oppløsning og vask med 1 ml M9.
      5. Overfør dyr til NGM-plater eller NGM RNAi-plater og la det komme seg over natten (eller ~15-20 h) og nå dag 1 i voksen alder ved 20 °C før du utfører fluorescerende mikroskopi (avsnitt 5). En gjenoppretting over natten utføres for å tillate at et påvisbart nivå av GFP akkumuleres.
      6. Du kan også indusere hsp-4p::GFP ved å flytte L4-dyr til agarplater som inneholder 25 ng/μL tunikamycin til 16-24 timer. Dette har en mye mer robust induksjon av hsp-4p::GFP på grunn av lengre stressvarighet, og dermed er det dynamiske området mye lavere enn analysen beskrevet ovenfor.
  2. Bruke hsp-6p::GFP som en avlesning for aktivering av UPRMT
    1. Indusere mitokondriestress ved hjelp av RNAi
      1. Aktiver UPRMT etter samme protokoll som pkt. 4.1.1, bortsett fra bruk av RNAi-nedslåing av mitokondriegener, for eksempel cox-5b/cco-1 (cytokrom c oksidaseunderenhet 5B; knockdown hemmer elektrontransportkjedeaktivitet). For UPRMT-aktivering gjennom perturbasjoner i elektrontransportkjedefunksjonen må RNAi-knockdown utføres under tidlig utvikling20. Derfor utføre RNAi fra luke for disse eksperimentene.
    2. Indusere mitokondriestress ved hjelp av et kjemisk middel
      1. Forbered plater oppdaget med RNAi-bakterier rettet mot genet av interesse som i avsnitt 3. Bruk HT115-bakterier selv i eksperimenter som ikke involverer RNAi-knockdown (se avsnitt 1). Kontroller at både NGM RNAi-plater (eller NGM RNAi + DMSO0.2) og NGM RNAi + antimycin A-plater (tabell 1) begge er klargjort for trinn 4.2.2.5.
      2. Synkroniser hsp-6p::GFP eller hsp-60p::GFP reporter dyr ved hjelp av metoder som er beskrevet i seksjon 2.
      3. Plate egg på seeded plater av valget ved hjelp av kriterier anbefalt i tabell 2. Siden antimycin A er oppløst i DMSO, vokse dyrene på NGM RNAi + DMSO0.2 plater fra luke.
      4. Inkuber egg ved 20 °C i 2 dager (~56 h) til L4-trinnet. Alternativt kan du dyrke dyr ved 15 °C i 3 dager (~75 h) i stedet.
      5. Flytt ormer fra NGM RNAi + DMSO0.2 plater til NGM RNAi + antimycin A-plater eller NGM RNAi + DMSO0.2 plater som en kontroll. Ormer kan flyttes manuelt med et valg for småskala eksperimenter, men for store eksperimenter anbefaler vi å vaske dyr med M9, bosette seg med sentrifugering, aspiring M9, og deretter plating til NGM RNAi + antimycin A plater.
      6. Inkuber ormer for en ekstra ~ 20 h og bilde på dag 1 voksen (seksjon 5).
  3. Bruke gst-4p::GFP som en avlesning for oksidativ stressrespons.
    1. Indusere oxsr ved hjelp av RNAi
      1. Alternativt, indusere gst-4p::GFP ved hjelp av RNAi-knockdown av wdr-23 (det koder en negativ regulator av skn-1; dermed, sin knockdown induserer OxSR) ved hjelp av protokollen som er beskrevet i pkt. 4.1.1.
    2. Indusere oxsr ved hjelp av eksponering for kjemiskoksidant Tert-butyl hydroperoksid (TBHP)
      1. Forbered plater oppdaget med RNAi-bakterier rettet mot genet av interesse som i avsnitt 3. Bruk HT115-bakterier selv i eksperimenter som ikke involverer RNAi-knockdown (se avsnitt 1).
      2. Synkroniser gst-4p::GFP reporter dyr ved hjelp av metoder som er beskrevet i del 2.
      3. Plate egg på seeded plater av valget ved hjelp av kriterier anbefalt i tabell 2. Sørg for å forberede flere plater enn nødvendig som medikamentbehandling protokollen resulterer i tap av > 10-20% av dyrene. For bildebehandling starter du med >100 dyr, og for sortering, start med > 1000 dyr.
      4. Inkuber egg i 20 °C i 2 dager (~56 h) til L4-trinnet. Alternativt kan du dyrke dyr ved 15 °C i 3 dager (~75 h) i stedet.
      5. Vask L4 dyr av platene og delt inn i to 15 ml koniske rør per tilstand. Aspirate volum ned til minst 1 ml og legge til et likt volum av nylaget 2 mM TBHP. Bruk et totalt væskevolum til minst 2 ml, da lavere volumer kan forårsake betydelig død av ormer når du spinner. Ikke vask før medikamentbehandling, da gjenværende bakterier fra plater vil bidra til å sikre ormer å ikke oversulte under inkubasjon.
      6. Inkuber ormer på rotatoren i 4 timer ved 20 °C.
      7. Vask ormer ved å spinne på 1000 x g,aspirating M9 + TBHP blanding, og erstatte med 15 ml M9. Gjenta for en ekstra vask.
      8. Plate ormer på EV RNAi å gjenopprette over natten (~ 16-24 h) ved 20 °C. Ormer kan gjenopprettes på matchende RNAi av valget, men ingen signifikante forskjeller ble sett når gjenopprettet på EV RNAi, så dette kan gjøres for enkel eksperimentell oppsett. Ta bilder av dag 1 voksne etter utvinning.
        MERK: En gjenoppretting over natten utføres for å tillate at et påvisbart nivå av GFP akkumuleres. Uten denne gjenopprettingen er det ikke noe påviselig GFP-signal. Hvis en kortere gjenoppretting er ønsket, er det mulig å bruke analysen som er beskrevet i pkt. 4.3.3.
    3. Indusere oxsr ved hjelp av eksponering for kjemisk oksidant paraquat (PQ)
      1. Gjenta alle trinnene i pkt. 4.2.2 for å få 2 partier L4 gst-4p::GFP-dyr i 15 ml koniske rør per tilstand.
      2. Aspirer volumet ned til minst 1 ml og legg til et likt volum av nylaget 100 μM PQ. I likhet med 4.3.2.5 anbefales et minimumsvolum på 2 ml.
      3. Inkuber ormer på rotatoren i 2 timer ved 20 °C.
      4. Vask ormer ved å spinne på 1000 x g,aspirating M9 + PQ mix, og erstatte med 15 ml M9. Gjenta for en ekstra vask.
      5. Plate ormer på EV RNAi å gjenopprette i 2 h ved 20 °C, og deretter ta bilder umiddelbart etter utvinning.
        MERK: 2 timer med gjenoppretting var den minimale gjenopprettingen som kreves for å visualisere GFP-induksjonen.
  4. Bruke hsp-16.2p::GFP og hsp-70p::GFP som en avlesning for HSR-aktivering.
    1. Indusere HSR ved hjelp av eksponering for forhøyede temperaturer
      1. Forbered plater oppdaget med RNAi-bakterier rettet mot genet av interesse som i avsnitt 3. Bruk HT115-bakterier, selv i eksperimenter som ikke involverer RNAi-knockdown (se Introduksjon).
      2. Synkroniser hsp-16.2p::GFP eller hsp-70p::GFP reporter dyr ved hjelp av metoder som er beskrevet i seksjon 2.
      3. Plate egg på seeded plater av valget ved hjelp av kriterier anbefalt i tabell 2. Pass på å forberede 2x antall plater som er nødvendige da halvparten av prøven vil bli utsatt for forhøyede temperaturer for varmesjokkinduksjon, og den andre halvdelen vil fungere som en ikke-varmesjokkert kontroll.
      4. Inkuber egg ved 20 °C i ca. 3-4 dager (~65-96 h) for å utføre eksperimenter på dag 1 i voksen alder. Ikke dyrke ormer ved 15 °C for varmesjokkeksperimenter, da det bare er små forskjeller mellom dyr som opplever varmesjokk av 15 °C versus 20 °C.
      5. Flytt eksperimentelle grupper av dyr til en 34 °C inkubator i 2 h. Plasser plater i inkubatoren som et enkelt lag (dvs. ingen stabling av plater) for å sikre den raskeste og mest like fordelingen av varme over platene.
      6. Flytt varmesjokkerte dyr til en 20 °C inkubator for å komme seg i 2 timer og deretter bilde umiddelbart (se avsnitt 5). Dyr kan gjenopprettes lenger om nødvendig for høyere GFP induksjon.
        MERK: 2 timer med gjenoppretting var den minimale gjenopprettingen som kreves for å visualisere GFP-induksjonen.

5. Bildebehandling ved hjelp av et stereomikroskop eller mikroskop med lav forstørrelse

  1. Fremstilling av ormer for fluorescerende mikroskopi
    1. Pipette 5-10 μL av 100 mm natriumazid på toppen av en standard NGM-plate (dvs. ingen bakterier).
      MERK: Natriumazidkonsentrasjonen kan bringes ned så lavt som 10 mM, selv om den mest robuste immobiliseringen ble observert ved 100 mM natriumazid uten påviselig effekt på fluorescerende signal.
    2. Under et dissekerende mikroskop plukker du 10-20 dyr fra eksperimentelle plater og overfører til stedet for natriumazid. Dyr bør opphøre bevegelse kort tid etter landing i natriumazid, og natriumazid i seg selv vil fordampe i løpet av sekunder.
    3. Når natriumazid har fordampet, linje opp dyr til ønsket bildeoppsett. Flytt dyrene side om side med anterior og bakre sider i samme orientering for alle dyr. Bilde dyr umiddelbart.
      MERK: Det ble ikke observert endringer i reportersignalet for noen av transkripsjonsreporterne i tabell 3 i opptil 15 minutter etter lammende i natriumazid.
  2. Bildeinnhenting ved hjelp av et stereomikroskop
    MERK: For denne protokollen ble et Leica M205FA-mikroskop utstyrt med et Leica DFC3000G monokromatisk CCD-kamera, standard Leica GFP-filter (ex 395-455, EM 480 LP) og LAS X-programvare brukt. Anbefalte innstillinger for eksponeringstider finner du i tabell 4.
    1. Start LAS X-programmet.
    2. Start et nytt prosjekt: Åpne kategorien Anskaffelse, klikk åpne prosjekter og klikk Mappe for å åpne et nytt prosjekt. Dette prosjektet kan gis nytt navn ved å høyreklikke mappen og rulle ned til Gi nytt navn eller klikke F2. I kategorien anskaffelse finnes det også alternativer for å justere eksponeringstiden og zoome til ønskede innstillinger.
    3. Plasser ormprøven under mikroskopmålet og finn det riktige fokuspunktet for ormer ved hjelp av lysfeltinnstillingen for å minimere fluorescerende bleking. Midten av prøven er der egglinjen er tydelig synlig og ikke fuzzy. Sett eksponeringstid, zoom, fokus og lyse feltkondensatorer til ønskede innstillinger.
    4. Hent et bilde ved hjelp av Knappen Ta bilde.
    5. Lagre bildet i LIF-format (Leica Image File), da dette lagrer alle råbilder og metadata. En TIFF kan også eksporteres ved å høyreklikke på bildet (eller prosjektet), og under alternativet Lagre som klikker du PÅ TIFF. Dette vil lagre alle kanaler (f.eks. bright-field og GFP) med eventuelle modifikasjoner (f.eks. hvis kontrasten ble justert, vil dette bli lagret i TIFF).
  3. Kvantitativ analyse av fluorescerende bilder
    1. Hvis kvantitativ analyse vil bli utført, ta 3D-bilder. Dette utføres ved å klikke på z-seksjonsalternativet merket med "z" øverst til høyre. Z-seksjoner vil være aktive hvis denne boksen er rød.
    2. Optimaliser z-seksjoner ved å velge rekkevidde og skivetykkelse nederst til venstre for justerbare alternativer. Når det er mulig, kan du bruke Systemoptimalisert-knappen for optimale innstillinger.
    3. Ta bildet og lagre bildet som beskrevet ovenfor i avsnitt 5.2. Linje opp ormer med mellomrom mellom dem for enklere målinger.
    4. Importer TIFF-bilder til bildeprogramvaren (f.eks. ImageJ).
    5. Velg Angi målingerAnalyser-menyen for ImageJ. Kontroller følgende: område, gjennomsnittlig grå verdi, integrert tetthet, visningsetikett.
    6. Bruk roi -verktøyet (interesseområde) til å tegne en avkastning. Mål hver orm individuelt. Velg MålAnalyser-menyen, eller trykk På M. Tegn en avkastning i bakgrunnen der det ikke er ormer, og mål deretter bakgrunnen på samme måte. Kopier eller lagre målinger som vises i Resultater-vinduet.
    7. Trekk bakgrunnen integrert tetthet fra den integrerte tettheten til hver måltavkastning. Bakgrunnsintensiteten for en avkastning er definert som produktet av bakgrunnen betyr grå verdi og området for avkastningen trukket.
  4. Bildeinnhenting ved hjelp av et sammensatt/bredt feltmikroskop
    MERK: For avbildning av transkripsjonsreportere ved hjelp av et sammensatt/bredt feltmikroskop, bruker denne protokollen et Revolve ECHO R4-mikroskop utstyrt med et Olympus 4x Plan Fluorite NA 0.13 objektivobjektiv, et standard Olympus FITC-filter (f.eks. 470/40; em 525/50; DM 560), og en iPad Pro for kameraet og for å drive ECHO-programvaren. Anbefalte innstillinger for eksponeringstider finner du i tabell 4.
    1. Bruk styreplaten til å starte kontrollprogrammet. Opprett et nytt album og filnavn.
    2. Plasser platen under objektivobjektivet. Angi eksponeringstid og fluorescensintensitet ved hjelp av baseline (EV/kontrollbehandling) og positiv kontroll, slik at signalet er synlig, men ikke mettet.
    3. Lagre et bilde med lysfelt og GFP/FITC-bilde.

6. Kvantitative målinger av journalister ved hjelp av et cytometer for storpartikkelstrømning

MERK: Vekst og tilberedning av ormer for cytometeranalyse med stor partikkelstrømning kan følge de samme paradigmene som avsnitt 1-5 for fremstilling av ormer for fluorescerende avbildning, med unntak av at et større antall dyr er nødvendig. Bruk > 500 dyr per tilstand, da noen dyr går tapt under manipulering, passerer ikke alle dyr filtreringskriteriene under kvantifisering, og noen dyr leses ikke riktig av strømningscytometeret. Vask dyr klar for sortering av plater i 5-10 ml M9 løsning i 15 ml koniske rør for etterfølgende sortering på strømningscytometeret.

  1. Sorteringsoppsett ved hjelp av et stort partikkelflytcytometer
    1. Før du slår på strømningscytometeret
      1. Kontroller at kjedevæskeflasken ikke er tom. Forbered sliromvæske fra 250x-aksjen minst et par timer før du bruker sorteringen, da det er en liten mengde vaskemiddel i hylsvæsken, noe som kan forårsake bobler som kan forårsake gjenstander under oppkjøpet.
      2. Sørg for at alle avfallsbeholdere ikke er fulle.
    2. Slå på strømningscytometeret
      1. Slå på luftkompressoren. Slå den til Auto. Kontroller trykkmåleren - det skal være rundt 30 psi.
      2. Slå på instrumentet. Bruk strømbryteren som ligger ved siden av strømledningen til venstre for apparatet.
      3. Slå på lasere. En 488 nm lyskilde er vanligvis tilstrekkelig for de fleste eksperimenter, selv om en 561 nm lyskilde må brukes hvis høyere eksitasjon er nødvendig for rød fluorescens.
      4. Åpne FlowPilot-programvaren; instrumentet skal gjøre en rekke klikk som slår på de forskjellige ventilene.
      5. Slå på laserne i programvarevinduet ved å klikke Start. Start laser i popup-vinduet argonlaserkontroll ved å klikke Kjør. Dette bør føre til at laseren slår seg på og når rundt 12 mW. 488 lyskildenivået vil gå opp til rundt 12.
      6. Klikk på Ferdig for å lukke vinduet.
    3. Kontrollerer programvare før du går videre
      1. Kontroller trykkmålere - Se på de 4 trykkverdiene som vises nederst i vinduet. Verdiene skal være rundt det opprinnelige oppsettet (Sheath 5.5-5.7; Eksempel 5.7-6.0; Sorter 3.1-3.3; Rengjør 8,5-8,7). Hvis det ser ut som, merker du av i boksen ved siden av Trykk OK.
      2. Sjekk fluidics -For å sikre at det ikke er luftbobler og rusk blokkerer strømmen av kappe / prøve gjennom strømningscellen, klikk Rengjør flere ganger.
      3. Kontroller hylsflythastigheten - For dette må du samle inn hylsen i 60 s. Slå av sortering, og slå deretter På hylse i manuelle kontroller for å starte flyten av hylse. Samle i en 15 ml rør for 60 s; strømningshastigheten skal være ~ 9-10 ml/min.
    4. Rengjøring før bruk av strømningscytometeret
      1. Sett ~ 3-5 ml 10% blekemiddelløsning i samlingen 'kopp' og klikk Påkjøp. La løpe for ~ 30 s, klikk Avbryt, og fjern overflødig med vakuum.
      2. Skyll oppsamlingskoppen med deionisert vann og fjern med vakuum. Gjenta 2x.
      3. Sett ~ 3-5 ml COPAS rengjøringsløsning i samlingen 'kopp' og klikk Påkjøp. La løpe for ~ 30 s, klikk Påbryt, og fjern overflødig rengjøringsløsning med vakuum.
      4. Skyll oppsamlingskoppen med deionisert vann og fjern med vakuum. Gjenta 2x.
      5. Sett ~ 3-5 ml M9 løsning i samlingen 'cup' og klikk Påkjøp. La kjøre for ~ 30 s, klikk Stopp, og fjern overflødig M9 løsning med vakuum.
  2. Kjøre prøver på sorter
    1. Juster laser PMT kraft og størrelse gating basert på tilstanden som forårsaker den lyseste aktiveringen av transkripsjonsreporter av interesse. Anbefalte innstillinger finner du i tabell 4.
    2. Legg til forberedte ormer til "kopp". Klikk På Hent. Se for å sikre at all væsken ikke er tatt opp i maskinen; dette vil føre til at strømningscytometeret tar inn luft og skaper bobler i detektoren.
    3. Klikk på Avbryt når prøven er lav og/eller nok dyr er samlet inn.
    4. Klikk på Oppsett | Datalagring | Bare inngjerdet. Dette lagrer bare dataene basert på størrelsesbegrensningene. Klikk på Lagre inngjerdede data og lagre inngjerdede data. Klikk På Visase for å slette data.
    5. Skyll oppsamlingskoppen med deionisert vann og fjern med vakuum. Gjenta 2x.
    6. Gjenta trinn 6.2.1-6.2.5 med resten av prøvene.
  3. Kalibrering/ kvalitetskontroll - om nødvendig
    MERK: Dette krever løpekontroll 42 μM GYR fluorescerende partikler som følger med, for å kalibrere 488-laseren.
    1. Trykk metallleppen på toppen av prøvekoppen for å fjerne luftrøret. Skru av hetten og bruk en sprøyte til å fjerne væske fra prøvekoppen.
    2. Bland flasken med kontrollpartikler godt før bruk og tilsett få milliliter i prøvekoppen. Lukk hetten og sett luften på igjen ved å trykke den på til den klikker på plass.
    3. Gå til verktøyalternativet i programvaren, og klikk Kjør kontrollpartikler.
    4. For kontrollpartikler tilbakestiller du PMT-verdiene til: GRØNN - 325; GUL - 365; RØD - 575.
    5. Klikk På Hent. Hylsen skal slå seg på etterfulgt av prøve. Når perlene begynner å gå gjennom strømningscellen, vil strømningshastigheten ses nederst på skjermen. Optimalt bør strømningshastigheten være mellom 5/s og 15/s. Hvis strømningshastigheten er for lav eller null, dreier du prøveventilen fysisk med klokken for å øke strømningshastigheten. Hvis strømningshastigheten er for høy, dreier du prøveventilen fysisk mot urviseren for å redusere strømningshastigheten.
      MERK: Normalt, under perlesparingsmodus, leses 500 perler før du slår av. Dataene kan slettes og perler leses på nytt.
    6. Når avlesningen er fullført, se etter rene enkelttopper for de 5 parametrene samt CV-verdiene. Koeffisienten i Varians (CV) bør være <15%. Kontroller også at CV-verdiene for de tre forskjellige fluorescerende kanalene er nær hverandre.
    7. Lag en oversikt over QC-kontrollen: Klikk Lagre som skjermbildeunder Fil-fanen.
  4. Rengjøring og nedleggelse
    1. Bruk et vakuum til å fjerne prøven fra prøvekoppen og gjenta pkt. 4.1.4.
    2. Sett ~ 3-5 ml deionisert vann i samlingen 'kopp' og klikk Erverv, la kjøre for ~ 30 s, og klikk deretter Avbryt. Legg igjen litt destillert vann i prøvekoppen.
    3. Tøm prøvegjenopprettingskoppen og avfallsflasken.
    4. Slå av programvare. Klikk Avsluttunder Fil-fanen. Klikk Slå av uten utrenskningpå hurtigmenyen.
    5. Slå av laseren, slå av instrumentet, og slå deretter av luftkompressoren. Lukk luken for å dekke instrumentet.

7. Fysiologiske analyser for å måle stressfølsomhet en C. elegans

  1. Måling av ER-stressfølsomhet ved bruk av tunicamycineksponering
    1. Forbered NGM RNAi DMSO-plater oppdaget med RNAi-bakterier rettet mot genet av interesse som i avsnitt 3. Bruk HT115-bakterier selv i eksperimenter som ikke involverer RNAi-knockdown (se avsnitt 1). Husk også å frø NGM RNAi TM plater (se tabell 1). Frø en tilstrekkelig mengde plater: plan for ~ 5-7 sett med NGM RNAi DMSO plater og ~ 2-3 sett med NGM RNAi TM plater.
    2. Synkroniser dyr av valget ved hjelp av metoder som er beskrevet i del 2.
    3. Plate egg på NGM RNAi DMSO seeded plater av valget ved hjelp av kriterier anbefalt i tabell 2. Pass på å forberede 2x antall plater som er nødvendige da halvparten av prøven vil bli overført til NGM RNAi TM-plater.
    4. Inkuber egg ved 20 °C i ca. 3-4 dager (~65-96 h) til dag 1 i voksen alder.
    5. På dag 1, forberede levetidved å overføre dyr til separate plater. For å spare plater (som TM kostnader er høye), bruk 8 plater av 15 dyr per tilstand, for totalt 120 dyr per tilstand. Dette gir et håndterbart antall dyr per plate for scoring og tillater en tilstrekkelig mengde dyr for statistiske analyser, selv med noen sensur.
    6. For de første 5-7 dagene, flytte voksne dyr bort fra avkom hver dag på en ny plate til avkom ikke lenger er synlige. I løpet av dette stadiet, sensurdyr som er pakket, viser vulval fremspring / eksplosjoner, eller kryper opp sidene av platene, da disse ikke er dødsfall forbundet med ER stressfølsomhet. Vær oppmerksom på at TM behandling forårsaker arrest i dyr, og dermed bare 1-2 trekk av disse dyrene hver 2-3 dager er tilstrekkelig til å minimere kostnadene forbundet med å produsere TM-holdige plater. Wild-type dyr har en gjennomsnittlig overlevelse på ~ 15-17 dager på DMSO og 12-14 dager på tunicamcyin.
    7. Etter at dyr har sluttet å produsere avkom, score levetid hver 1-2 dager til alle dyr er scoret som døde eller sensurert. TM-behandle dyr hver dag i løpet av dagen 6-14 av voksen alder for høyere oppløsning.
  2. Måling av mitokondrie- og oksidativ stressfølsomhet ved bruk av eksponering for paraquat
    1. Forbered plater oppdaget med RNAi-bakterier rettet mot genet av interesse som i avsnitt 3. Bruk HT115-bakterier selv i eksperimenter som ikke involverer RNAi-knockdown (se Introduksjon).
    2. Synkroniser dyr av valget ved hjelp av metoder som er beskrevet i del 2.
    3. Plate egg på NGM RNAi seeded plater av valget ved hjelp av kriterier anbefalt i tabell 1. Analysen krever ~ 60-100 dyr per tilstand, så forberede tilsvarende.
    4. Inkuber egg ved 20 °C i ca. 3-4 dager (~65-96 h) til dag 1 i voksen alder.
    5. Forbered et nytt hetteglass med 100 mM paraquat i M9-løsning.
    6. Pipette 50-75 μL M9+paraquat i så mange brønner av en flat bunn 96-brønnplate som ønsket. Det anbefales vanligvis å ha ~ 8-10 brønner per tilstand som inneholder ~ 8-10 dyr per brønn. Dette gir mulighet for et lett synlig antall dyr per brønn med ~ 80 dyr per stamme.
    7. Plukk 8-10 dyr per tilstand og overfør dem til hver brønn som inneholder M9 + paraquat. Bruk et valg for å overføre dyr til brønnene i stedet for pipettering for å unngå forskjeller i volum og utilsiktede endringer i paraquat konsentrasjoner.
    8. Hver 2 h, score for død av dyr i hver brønn. Trykk forsiktig på platene, noe som vil føre til at levende dyr slår eller bøyer seg. Legg merke til at det er mulig at levende dyr noen ganger er lammet lenge nok til å bli scoret som døde. Derfor, hvis antall levende dyr overstiger antall levende dyr fra et tidligere tidspunkt, er det sannsynlig at dyret var i live og bør være uscoret (f.eks, hvis i en time 4, 2/10 dyr er scoret som døde, og i en time 6, bare 1/10 dyr er døde, time 4 bør rescores som 1/10 dyr døde).
  3. Måling av varmefølsomhet ved bruk av eksponering for forhøyede temperaturer
    1. Forbered plater oppdaget med RNAi-bakterier rettet mot genet av interesse som i avsnitt 3. Bruk HT115-bakterier selv i eksperimenter som ikke involverer RNAi-knockdown (se avsnitt 1).
    2. Synkroniser dyr av valget ved hjelp av metoder som er beskrevet i del 2.
    3. Plate egg på seeded plater av valget ved hjelp av kriterier anbefalt i tabell 1. Har 60-100 dyr per tilstand for termotoleranse analyser. For termotoleranse analyser, bruk L1 arrest eller egg lay analyser for den beste synkroniseringen som det er stor variasjon basert på alder av dyr i analysen.
    4. Inkuber dyr ved 20 °C i ca. 3-4 dager (~65-96 h) for å utføre eksperimenter på dag 1 i voksen alder. Ikke dyrke ormer ved 15 °C for varmesjokkforsøk, da det er en liten forskjell mellom dyr som opplever varmesjokk av 15 °C versus 20 °C.
    5. På dag 1, forberede dyr ved å overføre dem til separate plater. Det anbefales vanligvis å ha ~ 10-15 dyr per tallerken med 4-6 plater, for totalt 60 dyr. Dette gjør det mulig å få et håndterbart antall dyr per plate for scoring og gir minimal tid for dyr å bli trukket ut av forhøyede temperaturer.
    6. Plasser dyr i en 37 °C inkubator og score hver 2 h. Start scoring for termotoleranse ved 37 °C i time 5, da lite eller ingen død oppstår før 5 timer. Median termotoleranse oppnås på ~ 9 timer, så time 7, 9 og 11 er kritiske tidspunkter, men på grunn av inkubator og lab-til-lab variabilitet, dette kan trenge å bli titret per lab. Videre vil eventuelle metoder for å redusere variabilitet hjelpe (f.eks. ikke stabling plater, plassere plater i samme område innenfor en enkelt inkubator, minimere tid inkubatoren åpnes eller lukkes, tar så få plater ut av inkubatoren om gangen for å minimere tid dyr tilbringer utenfor 37 °C, etc. Se21).
    7. Som et alternativ til trinn 7.3.6, plasser dyr ved 34 °C i stedet for 37 °C. Median termotoleranse ved 34 °C er i litt over 14 timer, så tidspunkt ene 12, 14 og 16 er kritiske for 34 °C termotoleranseanalyser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Bruke transkripsjonelle reportere til å måle aktivering av stressresponser
Her brukes fluorescerende transkripsjonelle reportere, som fungerer som robuste verktøy for å måle aktivering av de fleste stressresponser i C. elegans. GFP-uttrykk drives under arrangøren av kanoniske mål for master transkripsjonelle regulatorer involvert i å svare på kupéspesifikke påkjenninger. En omfattende liste over vanlige transkripsjonelle reportere er tilgjengelig i tabell 3.

Perturbing ER homeostase via utfoldet eller feilbrettet proteiner eller lipid bilayer stress fører til aktivering av utfoldet protein respons av ER (UPRER) for å gjenopprette ER kvalitet og funksjon. UPRER består av 3 forskjellige grener definert av transmembransensorene: inositolkrevende protein 1 (IRE1), aktivering av transkripsjonsfaktor 6 (ATF6) og proteinkinase RNA (PKR)-lignende ER kinase (PERK), som alle er bevart i C. elegans7,22,23. Det vanligste verktøyet for å overvåke aktiveringen av UPRER i nematoden, er transkripsjonsreporterstammen som uttrykker GFP under kontroll av hsp-4-promotoren (hsp-4p::GFP)7. Genet hsp-4 koder en orthologue av pattedyr Hsp70, HSPA5 (eller BiP/Grp78). I tider med ER-stress når UPRER er aktivert, uttrykker hsp-4p::GFP-reporterbelastningen GFP. Denne reporteren har minimalt basaluttrykk i fravær av stress, men viser robust GFP uttrykk når dyr er utsatt for tunikamycin (Figur 1A). Disse forskjellene kan også kvantifiseres ved hjelp av et cytometer for storpartikkelstrømning (figur 1B). Videre kan induksjonen av hsp-4p::GFP under ER-stress bli fullstendig undertrykt av RNAi-knockdown av xbp-1, da aktiveringen av denne transkripsjonsreporteren er avhengig av transkripsjonsfaktoren, XBP-112.

I likhet med UPRERhuser mitokondriene sin egen beskyttende mekanisme mot proteotoksisk stress. Denne mekanismen, kalt mitokondrie UPR (UPRMT)24,er hovedsakelig regulert av transkripsjonsfaktoren, ATFS-1, som ikke klarer å gå inn i mitokondriene under stress på grunn av redusert importeffektivitet, noe som resulterer i inntreden av ATFS-1 inn i kjernen25. Interessant, ulike perturbasjoner til mitokondrieprosesser kan aktivere denne responsen, inkludert proteinaggregering, nedslåing av elektrontransportkjeden (ETC) komplekser underenheter, mitokondrie DNA-replikasjonsstress og mitokondrieproteinoversettelse8,26. Aktiveringen av UPRMT har blitt overvåket ved hjelp av ormer som uttrykker en transgen konstruksjon der GFP ble plassert under regulering av arrangørene av mitokondriechaperonegenene, hsp-6 og hsp-608. I likhet med hsp-4p::GFP-dyr, hsp-6p::GFP dyr viser minimal basal signal i fravær av stress. Den mest robuste metoden for å indusere UPRMT er gjennom RNAi-knockdown av følgende mitokondrieproteiner: cox-5B, cytokrom c oksidaseunderenheten Vb/COX4 (Complex IV)20, nuo-4, NADH dehydrogenase protein (Kompleks I)27, eller mrps-5, en mitokondrie ribosomal protein28, aktivert hsp-6p::GFP reporter. GFP-uttrykk gjennom denne reporteren er robust aktivert og kan enkelt visualiseres og kvantifiseres under disse forholdene (figur 2A-B). UPRMT kan også utløses gjennom kjemisk hemming av elektrontransportkjeden (ETC), for eksempel med antimycin A, som hemmer cytokrom c reductase (kompleks III). I likhet med RNAi-knockdown av ETC-komponenter, forårsaker antimycin A-behandling en robust induksjon av hsp-6p::GFP (Figur 2C-D).

Evnen for organismer til å føle og reagere på oksidativt stress er en bevart prosess tilstede fra bakterier til mennesker29. I C. elegansfungerer NRF2 homologue, SKN-1, som en viktig transkripsjonsfaktor, som er følsom for redoksendringer på grunn av reaktive cystein er gjennom hele proteinet. SKN-1 fungerer som en av transkripsjonsaktivatoren til OxSR gjennom binding til konservert konsensussekvens som ligner på antioksidantresponselementene bundet av NRF230. Hos mennesker er NRF2 negativt regulert av KEAP1, som antas å være følsomme for redoksendringer på grunn av reaktive cystein er gjennom hele proteinet31. Mens det ikke er noen direkte ortholog av KEAP1 i ormer, er SKN-1 negativt regulert av WD-gjentaproteinet, WDR-23, på en måte som er mekanistisk forskjellig fra KEAP1/NRF2 hemming32. Ved oksidativt stress, som tert-butylhydroperoksid (TBHP), aktiverer SKN-1 avgiftning og antioksidantgener som gst-4, en glutation S-Transferase. For å måle oksidativt stress, er GFP-uttrykk plassert under arrangøren av gst-4, en glutation S-transferase33. I motsetning til de andre transkripsjonsregulatorene som presenteres her, har gst-4p::GFP høyt basaluttrykk. Dette uttrykket kan imidlertid fortsatt aktiveres robust under forhold med oksidativt stress, som kan utføres både genetisk og kjemisk. For å genetisk indusere oksidativt stress, slår vi ned wdr-23, som koder et protein som spiller en rolle i proteasomal nedbrytning av SKN-134. wdr-23 knockdown resulterer i robust aktivering av gst-4p::GFP. Videre resulterer behandling av ormer med kjemisk oksidant, TBHP, i en mildere, men fortsatt signifikant aktivering av gst-4p::GFP (Figur 3). Både kjemisk og genetisk aktivering av gst-4p::GFP kan nesten helt undertrykkes av RNAi knockdown av skn-1, genet koding master transkripsjonsregulator av OxSR.

De fleste cellulære proteiner er oversatt i cytoplasma og bor der, selv om bare midlertidig før de blir målrettet andre steder. Dermed er cytoplasma vert for et variert utvalg av chaperones som fremmer riktig protein folding og funksjon, samt enzymer og proteiner som er ansvarlige for nedverdigende skadede, dysfunksjonelle eller overflødige proteiner. For å beskytte dette komplekse proteinlandskapet i cytoplasma, har cellen utviklet flere cytoplasmatiske stressresponsveier, inkludert varmesjokkresponsen (HSR)35,36. HSR er en vei dedikert til å fremme protein homeostase under forhold med varmestress og moduleres av master transkripsjonsregulator, HSF-137. Under steady state forhold, HSF-1 er bundet av cytoplasmatiske chaperones, HSP90 og HSP70/40, som holder den låst i en monomeriske, inaktiv tilstand. Under varmeforhold eller lignende stress, en økning i feilfolded proteiner resulterer i titrering av chaperones vekk fra HSF-1, slik at den kan trimere og translocate til kjernen for å aktivere HSR38,39. Kanskje de mest studerte nedstrøms målene for HSF-1 under HSR aktivering er varmesjokk proteiner (HSP), som HSP70, HSP90, DNAJ, og HSP6017,40. I C. eleganshar transkripsjonelle reportere for HSR blitt syntetisert ved å drive uttrykket av GFP under arrangørene av kanoniske HSp, hsp-16.2 og hsp-709,41. Som sine UPRMT og UPRER kolleger, hsp-16.2p::GFP og hsp-70p::GFP viser minimal basal uttrykk i fravær av stress. Begge journalistene er imidlertid robust indusert under tilstander av varmestress, som lett kan visualiseres av mikroskopi eller kvantifiseres ved hjelp av et stort partikkelflytcytometer (figur 4). Begge reporterne har stort dynamisk område, og induksjon er helt avhengig av hsf-1,som RNAi-knockdown av hsf-1 fullt undertrykker induksjon av hsp-16.2p::GFP og hsp-70p::GFP. Selv om disse journalistene kan brukes om hverandre i de fleste situasjoner, kan det være forskjeller i uttrykksnivåer og uttrykk på tvers av vev.

Fysiologiske analyser for å måle stressfølsomhet i C. elegans
C. elegans er en flott modell organisme for å måle stressfølsomhet på grunn av de lave kostnadene i vedlikehold og eksperimentering og enkel genomredigering eller genetisk knockdown ved hjelp av RNAi, som gir kapasitet til å utføre store eksperimenter i en hel organisme. For å si stresstoleranse mot ER stress, utsetter vi C. elegans til det kjemiske middelet, tunikamycin, som forårsaker akkumulering av skadede proteiner i ER ved å blokkere N-bundet glykosylering10. Dyr er utsatt for tunikamycin etter utvikling, da stoffet forårsaker utviklingsfeil. Når de utsettes for tunikamycin, viser voksne ormer en markert nedgang i levetiden. Videre, knockdown av genet, xbp-1, som koder en av de primære transkripsjonfaktorer involvert i UPRER induksjon, resulterer i en betydelig økning i følsomhet for tunikamycin (Figur 5A)12. Dermed fungerer dette som en robust analyse for å måle ER stressfølsomhet hos voksne ormer.

For å måle oksidativt stress og mitokondriestress utsetter vi dyr for det kjemiske middelet, paraquat. Paraquat forårsaker mitokondriestress ved syntese av ROS i mitokondriematrisen, som deretter kan konverteres til hydrogenperoksid og diffusut av mitokondriene forårsake helcelleoksidativ skade13. I likhet med ER stressanalyser utsetter vi dyr for paraquat i voksen alder. Vi utfører imidlertid analyser i væske for å redusere kostnader og manuell arbeidskraft og agar platebaserte analyser ville være vanskelig for de fleste laboratorier. Her viser vi at dyr eksponert for paraquat i væske viser median overlevelse på ca. 5 timer (figur 5B). Videre, knockdown av insulin reseptoren, daf-2, resulterer i en økt motstand mot paraquat som aktivering av DAF-16/FOXO resulterer i økt uttrykk for involvert i clearance av ROS, slik som sod-342,43. Analyser av paraquat overlevelse er korte, varer opptil 14 timer, og fungerer dermed som en effektiv metode for å avhøre mitokondrie- og oksidative stressresponser.

Til slutt brukes overlevelse ved forhøyede temperaturer til å avhøre den fysiologiske responsen på varmestress. Disse analyser kan utføres både i flytende eller solid agar, og det finnes mange forskjellige protokoller skissert21. Det anbefales å standardisere en enkelt analyse i laboratoriet for å redusere variasjon, noe som er eksepsjonelt høyt i denne analysen. Termotoleranse bør utføres i dag 1 voksne dyr på standard agarplater, enten ved 34 °C eller 37 °C. Ved 37 °C oppstår et flertall av dødsfallet mellom 7-11 timer, noe som gjør dette til en enkel enkeltdagsanalyse, mens 12-16 timers eksperimenter ved 34 °C er lettest utført over natten (Figur 5C-E). Mutasjon i genet, ttx-3, resulterer i svikt i spesifikasjonen av AIY interneurons ansvarlig for termosensorisk nevrale krets, og forårsaker en betydelig økning i termosensitivitet44. Mens termotoleransedata kan plottes som en overlevelseskurve (Figur 5C),bør disse analysene utføres minst 4-6 ganger, og alle replikater bør plottes mot hverandre (Figur 5D-E), da termotoleranse viser utrolig høy variasjon i forhold til andre stressanalyser. Dette skyldes de mange advarsler som finnes i å sette opp disse eksperimentene, inkludert variasjon i stammer av interesse, ulik sykling av luft i inkubatorer, ujevne agar plater, etc.21. Ved 34 °C oppstår median overlevelse ved ca. 14 timer, og tilsvarende 37 °C viser ttx-3 mutanter redusert overlevelse ved 34 °C (figur 5E).

Figure 1
Figur 1: Bruke hsp-4p::GFP som reporter for UPRER induksjon. (A) Representative fluorescerende mikrografer av hsp-4p::GFP uttrykker dyr dyrket på kontroll tom vektor (EV) eller xbp-1 RNAi. Dyr ble dyrket på RNAi fra luken til L4 ved 20 °C, deretter behandlet med 25 ng/μL tunikamin eller 1 % DMSO flytende i M9 ved 20 °C i 4 timer, og ble funnet på en OP50-plate i 16 timer ved 20 °C før bildebehandling. Dyr ble lammet i 100 μM natriumazid på en NGM agar plate og avbildet ved hjelp av et stereomikroskop. (B) Kvantitativ analyse av (A) ved hjelp av en stor partikkelbiosorter. Data er representert som integrert fluorescensintensitet over hele dyret der hver prikk representerer et enkelt dyr; DMSO kontroll er i grå og tunikamycin behandlede dyr er i rødt. Sentrallinje representerer medianen, og whiskers representerer interkvartilområdet. n = 123-291 dyr per stamme. p < 0.001 ved hjelp av ikke-parametrisk Mann-Whitney-testing. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 2
Figur 2: Bruke hsp-6p::GFP som reporter for UPRMT induksjon. (A) Representative fluorescerende mikrografer av hsp-6p::GFP uttrykker dyr dyrket på kontroll tom vektor (EV), cco-1, mrps-5,eller nuo-4 RNAi. Dyr ble dyrket på RNAi fra luke og avbildet på dag 1 av voksen alder ved 20 °C. Dyr ble lammet i 100 μM natriumazid på en NGM agar plate og avbildet ved hjelp av et sammensatt mikroskop. (B) Kvantitativ analyse av (A) ved hjelp av en stor partikkelbiosorter. Data er representert som integrert fluorescensintensitet over hele dyret der hver prikk representerer et enkelt dyr; EV-kontrollen er i grå RNAi-behandlede dyr er i rødt. Sentrallinje representerer medianen, og whiskers representerer interkvartilområdet. n = 303-384 dyr per stamme. p < 0.001 sammenlignet med EV-kontroll ved hjelp av ikke-parametrisk Mann-Whitney-testing. (C) Representative bilder av hsp-6p::GFP-dyr behandlet med DMSO eller Antimycin A. Dyr ble dyrket fra luke på 0,2% DMSO-plater og overført til plater som inneholder 0,2% DMSO eller 3 mM antimycin A i 16 timer før bildebehandling på et Revolve ECHO R4 sammensatt mikroskop. All vekst ble utført ved 20 °C. (D) Kvantitativ analyse av (C) ved hjelp av en stor partikkelbiosorter som ligner på (B). DMSO-kontrollene er i stor, og Antimycin A-behandlede dyr er i rødt. n = 495 for DMSO og 219 for Antimycin A. ***p < 0,001 sammenlignet med EV-kontroll ved hjelp av ikke-parametrisk Mann-Whitney-testing. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 3
Figur 3: Bruke gst-4p::GFP som reporter for OxSR. (A) Representative fluorescerende mikrografer av gst-4p::GFP uttrykker dyr dyrket på kontroll tom vektor (EV), skn-1,eller wdr-23 RNAi. Dyr ble dyrket på RNAi fra luken til L4 stadium ved 20 °C. Dyr ble dyrket på RNAi fra luken til L4 ved 20 °C, deretter behandlet med 2 mM TBHP i M9 eller bare M9 for "ubehandlet" kontroll ved 20 °C i 4 timer, og gjenopprettes på en EV-plate i 16 timer ved 20 °C før bildebehandling. Dyr ble lammet i 100 μM natriumazid på en NGM agar plate og avbildet ved hjelp av et sammensatt mikroskop. (B) Kvantitativ analyse av (A) ved hjelp av en stor partikkelbiosorter. Data er representert som integrert fluorescensintensitet over hele dyret der hver prikk representerer et enkelt dyr; ubehandlet kontroll er i grå og TBHP-behandlede dyr er i rødt. Sentrallinje representerer medianen, og whiskers representerer interkvartilområdet. n = 101-204 dyr per stamme. p < 0,001 sammenlignet med respektive EV-kontroll ved hjelp av ikke-parametrisk Mann-Whitney-testing. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 4
Figur 4: Bruke hsp16.2p::GFP og hsp-70p::GFP som reportere for varmesjokkresponsen. (A) Representative fluorescerende mikrografer av hsp16.2p::GFP uttrykker dyr dyrket på kontroll tom vektor (EV) eller hsf-1 RNAi. Dyr ble dyrket på RNAi fra luke ved 20 °C til dag 1. Dag 1 dyr ble enten igjen ved 20 °C (ubehandlet) eller utsatt for 2 timers varmestress ved 34 °C, deretter gjenvunnet i 2 timer ved 20 °C. Dyr ble lammet i 100 μM natriumazid på en NGM agar plate og avbildet ved hjelp av et stereomikroskop. (B) Kvantitativ analyse av (A) ved hjelp av en stor partikkelbiosorter. Data er representert som integrert fluorescensintensitet over hele dyret der hver prikk representerer et enkelt dyr; ubehandlet kontroll er i grå og varmesjokkerte dyr er i rødt. Sentrallinje representerer medianen, og whiskers representerer interkvartilområdet. n = 320-364 dyr per stamme. p < 0.001 ved hjelp av ikke-parametrisk Mann-Whitney-testing. (C) Representative fluorescerende mikrografer av hsp-70p::GFP uttrykker dyr dyrket på kontroll EV og hsf-1 RNAi og behandlet som beskrevet i (A). (D) Kvantitativ analyse av (C) som beskrevet i (B). n = 773-941 dyr per stamme. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 5
Figur 5: Fysiologisk overlevelse analyser under stress i C. elegans. (A) Levetid av nematoder dyrket på 1% DMSO som inneholder 25 ng / μL tunikamycin (TM) plater. Dyr ble dyrket på 1% DMSO plater fra luke til dag 1, og overført til respektive TM plater på dag 1. Dyr ble holdt på kontroll tom vektor (EV) eller xbp-1 RNAi fra luke til slutten av analysen ved 20 °C. Voksne dyr flyttes manuelt bort fra avkom hver dag til ~ dag 7-8 når avkom ikke lenger ble oppdaget, deretter scoret hver 2 dager til alle dyrene ble registrert som døde eller sensurert. Dyr med bagging, vulval fremspring / eksplosjoner, eller de som kravlet opp sidene av plater ble ansett sensurert. (B) Overlevelseskurve av nematoder i 100 mM paraquat (PQ) oppløst i M9-oppløsning. Dyr ble dyrket på EV eller daf-2 RNAi fra luke til dag 1 av voksen alder ved 20 °C. Dyr ble plassert i 50 μL m9 + PQ oppløsning i en 96 brønnplate ved 20 °C og visualisert hver 2. (C) Overlevelseskurve av nematoder ved 37 °C. Wild-type (N2), ttx-3 (KS5), og sur-5p::hsf-1 dyr ble dyrket på EV plater fra luken til dag 1 ved 20 ° C. På dag 1 ble dyr flyttet til 37 °C og scoret hver 2. (D) Samlede data av alle termotoleranse analyser utført ved 37 °C. Data er representert som prosent levende i time 9 av en termotoleranseanalyse, med hver linje som representerer et matchet eksperiment utført samme dag. (E) Samlede data av alle termotoleranseanalyser utført ved 34 °C. Data er representert som prosent levende i time 14 av en termotoleranseanalyse, med hver linje som representerer et matchet eksperiment utført samme dag. All statistikk for A-C ble utført ved hjelp av Log-Rank (Mantel-Cox) testing og finnes i tabell 5. Vennligst klikk her for å se en større versjon av denne figuren.

Reagens Oppskrift
Lysogeny Broth (LB) I denne protokollen ble kommersiellLB brukt (se Materialer), men alle standard LB hjemmelagde oppskrifter ved hjelp av Bacto-tryptone, gjærekstrakt og NaCl er tilstrekkelige.
Nematode Vekst Media (NGM) 1 mM CaCl2, 5 μg/ml kolesterol, 25 m KPO4 pH 6.0, 1 mM MgSO4, 2 % (w/v) agar, 0,25 % (w/v) Bacto-Peptone, 51,3 mM NaCl
Blekemiddelløsning 1,8 % (v/v) natriumhypokloritt, 0,375 M KOH
M9-løsning 22 mM KH2PO4 monobasic, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
NGM RNAi plater 1 mM CaCl2, 5 μg/ml kolesterol, 25 m KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/ml karbenicillin/ampicillin. Oppbevares ved 4 ° C i mørket i opptil 3 måneder
Tetracycline 10 mg/ml lageroppløsning (500x) i 100 % etanol. Oppbevares ved -20 °C
Carbenicillin (andre er i seg selv) 100 mg/ml lageroppløsning (1000x) i vann. Oppbevares ved 4 °C i opptil 6 måneder eller -20 °C for langtidslagring
Natriumazid 1 M lager (~6,5%) lageroppløsning av natriumazid i vann. Oppbevares i mørket ved 4 °C. Dette er en 10x løsning og fortynnes til en 100 mM arbeidslager for de fleste bildeeksperimenter
Tunikamycin (andre er i dag) 2,5 mg/ml lageroppløsning i 100 % DMSO. Oppbevares ved -80 °C for langtidslagring. Dette er en 100x løsning (25 ng/ μL arbeidsløsning)
Antimycin A 15 mM antimycin En lagerløsning i 100% DMSO. Oppbevares ved -20 °C. Dette er en 5000x løsning (3 μM arbeidslager)
Paraquat (andre har vært på samme siden) 50 μM løsning i vann – bør tilberedes frisk
Tert-butylhydroperoksid (TBHP) 7,7 M oppløsning i vann. Dette er en 3850x løsning (2 mM arbeider lager)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 μg/ml kolesterol, 25 m KPO4 pH 6,0, 1 mM MgSO4, 2 % (w/v) agar, 0,25 % (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/ml karbenicillin/ampicillin, 0,2 % DMSO
(kontroll for antimycin A)
NGM RNAi + antimycin A 1 mM CaCl2, 5 μg/ml kolesterol, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (m/v) agar, 0,25% (m/ v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/ml karbenicillin/ampicillin, 0,2% DMSO, 3 mM antimycin A
NGM RNAi DMSO 1 mM CaCl2, 5 μg/ml kolesterol, 25 m KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/ml karbenicillin/ampicillin; 1 % DMSO
(kontroll for tunikamycin)
NGM RNAi TM 1 mM CaCl2, 5 μg/ml kolesterol, 25 m KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0,25% (w/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 μg/ml karbenicillin/ampicillin; 1 % DMSO, 25 ng/μL tunikamycin
IPTG (andre er id) 1 M oppløsning i vann.

Tabell 1: Anbefalte oppskrifter for reagenser som brukes. Alle de nøyaktige oppskriftene på reagensene som brukes i denne protokollen er skissert her. Spesifikke selskaper hvor reagenser ble kjøpt, er også tilgjengelige i materialtabellen. Mange forskjellige kilder til kjemikalier ble testet, og de som er oppført i materialtabellen er de som viste de mest robuste og reproduserbare resultatene.

Plate Størrelse Bakterier Type # av dyr for å nå dag 1 voksenalder Antall dyr for å nå L4-scenen
60 mm Op50 (andre kan være på 100 -150 (100-150) 150 -300 (150-300)
60 mm 2007: 100 000 000 70 -100 (70-100) 120 -200 (120-200)
100 mm Op50 (andre kan være på 600-1000 1500-2000
100 mm 2007: 100 000 000 350-600 -600 -350 -600 700-1300 (700 -1300)

Tabell 2: Anbefalt antall dyr til plate etter synkronisering for å unngå sult. For å unngå sult anbefaler vi plating et bestemt antall dyr per tilstand. Siden OP50 vokser tettere enn HT115, kan flere dyr være belagt. Alle tallene som er oppført her er retningslinjene som brukes i laboratoriet vårt, og tallene kan være litt forskjellige på grunn av flere variabler og forskjeller mellom laboratorieforhold. Derfor, eller anbefalte tall er på undersiden i fet skrift. Maks tall er det som kan være belagt under optimale forhold i laboratoriet vårt uten å nå sult, men det anbefales ikke å bruke disse verdiene uten først å titrere dine forhold. Alle tall bestemmes med antagelsen om at bakterier seedes på plater og får lov til å vokse i ~ 24 timer ved omgivelsestemperatur (~ 22 °C) på plater før ormer blir plassert på dem. Selv om det ikke er noen stor forskjell i sultpriser når plating egg eller L1s, anbefaler vi plating ~ 10% høyere tall når plating egg, siden ikke alle egg vil klekke etter bleking.

Stamme navn Transgene (andre kan være på Formål Anbefalt påføring(er) av stress Kilde
SJ4005 (Andre) hsp-4p::GFP UPRER 25 μg/ml tunikamycin CGC (andre er i så mange
SJ4100 (Andre) hsp-6p::GFP UPR-merket 3 μM antimycin A; CGC (andre er i så mange
RNAi mot ETC eller mitokondrieribosom
SJ4058 (Andre) hsp-60p::GFP UPR-merket 3 μM antimycin A; CGC (andre er i så mange
RNAi mot ETC eller mitokondrieribosom
Cl2070 (andre er i 2009) hsp-16.2p::GFP varmesjokkrespons 34 °C 2 timer CGC (andre er i så mange
AM446 (andre er i seg selv) hsp-70p::GFP varmesjokkrespons 34 °C 2 timer Morimoto Lab
I 2009 ble det avis, det er ikke noe å si gst-4p::GFP Oxsr (andre er) 50 mM paraquat; CGC (andre er i så mange
2 mM tert-butylhydroperoksid
Cf1553 (andre betydninger) sod-3p::GFP OxSR og insulinsignalering RNAi mot daf-2 (insulinreseptor) CGC (andre er i så mange
Au78 (andre) T24B8.5p::GFP medfødt immunrespons patogeneksponering (f.eks. p. aeruginosa) CGC (andre er i så mange

Tabell 3: Transkripsjonelle journalister for å vurdere aktivering av cellulære stressresponser. Stammene som er oppført her er alle tilgjengelige gjennom CGC eller gjennom spesielle forespørsler til laboratorier for bruk i både kvalitative og kvantitative bildemetoder som er beskrevet i dette manuskriptet. Disse stammene er alle avledet fra Bristol N2 bakgrunn. Anbefalte metoder for å bruke stress for å aktivere journalistene er også gitt. Alle reportere, med unntak av sod-3p::GFP45 og T24B8.5p::GFP46 er beskrevet i teksten.

Transgene (andre kan være på Anbefalt påføring(er) av stress Eksponeringstid ved hjelp av et Leica M2250FA stereomikroskop Eksponeringstid ved hjelp av et Revolve ECHO-mikroskop PMT-verdier ved hjelp av en Union Biometrica COPAS biosorter
hsp-4p::GFP 25 μg/ml tunikamycin (~4 timer med over natten utvinning) 200 ms (andre kan være på 275 ms (andre kan være på samme siden) 450
hsp-6p::GFP 3 μM antimycin A (~16 timer); 100ms (andre kan være på 50 ms (andre kan være på 350
RNAi mot ETC eller mitokondrieribosom (fra luke)
hsp-60p::GFP 3 μM antimycin A (~16 timer); 200 ms (andre kan være på 100 ms (andre kan være på 450
RNAi mot ETC eller mitokondrieribosom (fra luke)
hsp-16.2p::GFP 34 °C 2 timer 400 ms (andre kan være på 200 ms (andre kan være på 500
hsp-70p::GFP 34 °C 2 timer 400 ms (andre kan være på 300 ms (andre kan være på samme tid) 500
gst-4p::GFP 50 mM paraquat (~ 2 timer); 100 ms (andre kan være på 50 ms (andre kan være på 350
2 mM tert-butylhydroperoksid (~ 4 timer med overnatting utvinning)
sod-3p::GFP RNAi mot daf-2 (insulinreseptor) 300 ms (andre kan være på samme tid) 300 ms (andre kan være på samme tid) 475
T24B8.5p::GFP patogeneksponering (f.eks. p. aeruginosa) 100 ms (andre kan være på 50 ms (andre kan være på 350

Tabell 4: Anbefalte innstillinger for fluorescerende mikroskopi og kvantifisering ved hjelp av en stor partikkelbiosorter. Denne tabellen fungerer som retningslinje for anbefalte eksponeringstider for fluorescerende mikroskopi- eller PMT-verdier for den store partikkelbiosorteren. Disse vil tjene som gode utgangspunkter, men eksponeringstiden og PMT-verdien bør justeres for hvert eksperiment for å sikre at det ikke oppstår metning, og at fluorescerende verdier er over deteksjonsgrensen for bakgrunnssignal. Hvis prøven med det lyseste signalet for et eksperiment er kjent (f.eks. positive kontroller for stressinduksjon), kan disse prøvene brukes til å bestemme den høyeste eksponeringstiden eller PMT som kan brukes uten mettingssignal. Hvis de lyseste prøvene ikke er kjent, kan kontrollen brukes, og en eksponeringstid eller PMT i midten av det dynamiske området i systemet kan brukes.

Tilsvarende figur Stamme, Behandling Median levetid # Dødsfall/# Totalt % endring i median levetid p-verdi (Logg-Rank; Mantel-Cox)
5A (andre kan være på N2, vektor RNAi, 1% DMSO 22 dager 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 dager 92/120 -36.4 < 0,001
N2, vektor RNAi, 25 ng/μL TM 14 dager 97/120 -36.4 < 0,001
N2, xbp-1 RNAi, 25 ng/μL TM 12 dager 98/120 -45.4 < 0,001
5B (andre kan være på den N2, vektor RNAi, 100 mM PQ 5 timer 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6,5 timer 74/74 30 < 0,001
5C (andre kan være på N2, vektor RNAi, 37 °C 8 timer 59/60 -- --
ttx-3(KS5), vektor RNAi, 37 °C 7 timer 60/60 -12.5 0.002
sur-5p::hsf-1, vektor RNAi, 37 °C 9 timer 59/60 12.5 0.012

Tabell 5: Statistikk for levetid og stressoverlevelsesanalyser. Alle utvalgsstørrelser, statistikker og sensurrater for figur 5 er tilgjengelig her.

Stress respons Mål gen Forover Primer Omvendt primer
UPRER Hsp-3 (Andre) TCGCTGGATTGAACGTTGTTCG GTTGCGTTCTCCGTCCTTCTTG
UPRER Hsp-4 (Andre) GAACAACCTACTCGTGCGTTGG (Andre) GAACAACCTACTCGTGCGTTGG (Andre)
UPRER Sissel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
UPRER Ire-1 (andre er ire-1) TCCTCAACCGCTCCATCAACAT (Andre) TCCTCAACCGCTCCATCAACAT (Andre)
UPRER Xbp-1 (andre betydninger) En maskinoversatt eller -redigert ble feil, og vi vet ikke riktig hva som ville nok. En maskinoversatt eller -redigert ble feil, og vi vet ikke riktig hva som ville nok.
UPRER xbp-1 (skjøtet) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
UPRER crt-1 (crt-1) Gaagtaatagccgagggaagc (andre er i seg selv) Gaagtaatagccgagggaagc (andre er i seg selv)
UPRER T14G8.3 (144G8.3) Cacctccatcaacaacaacat Cacctccatcaacaacaacat
Hsr Hsp-17 (Andre) TCGTTTTCCACCATTCTCCCCA (Andre) TGTTTGATCGGCCCAGTATGGT
Hsr Hsp-70 Leilighet TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 (Andre) TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTCtCtTTT
Hsr 16,2 i 2017 ble det TCCATCTGAGTCTTCTGAGATT (TCCATCTCTTCTGAGATT)
GTTA (ANDRE)
TGGTTTAAACTGTGAGACGTTGA (Nær TGGTTTAAACTGTGAGACGTTGA)
Hsr HSF-1 (Andre) TTTGCATTTTCTCGTCTGTC (TTTGCATTTTCTCGTCTGTC) TCTATTTCCAGCACACCTCGT (Andre)
UPR-merket Hsp-6 (Andre) Gagatcgtggaaccggaaagga CGGCATTCTTTTCGGCTTCCTT
UPR-merket Hsp-60 (andre kan være på stedet) CGGCATTCTTTTCGGCTTCCTT CGTCGTTGCAGAGCTCAAGAAG (andre kan være på vei)
UPR-merket Ymel-1 (Andre artilleri) CAAAACCTGATCTCGCTGGG TTCTCAATGTCGGCTCCAGT
UPR-merket Clpp-1 (andre kan være på vei til Clpp- TGATAAGTGCACCAGTGTCCA (Nær TGATAAGTGCACCAGTGTCCA) TGATTCTGGAGTTCGGGAGA (Andre)
UPR-merket Lonp-1 (andre kan være på vei til Årek CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT (andre kan være på samme side)
Cca (andre)
Oxsr (andre er) Gst-4 (andre kan være på vei til 2 GATGCTCGTGCTCTTGCTG (Andre) Ccgaattgttctccatcgac
Oxsr (andre er) Gst-6 (andre kan være på vei til 2 Ccgaattgttctccatcgac TTTGGCAGTTGTTGAGGAG (Nær TTTGGCAGTTGTTGAGGAG)
Oxsr (andre er) Gst-7 (andre kan være på vei til 2 TTTGGCAGTTGTTGAGGAG (Nær TTTGGCAGTTGTTGAGGAG) TGGGTAATCTGGACGGTTTG (Nær TGGGTAATCTGGACGGTTTG)
Oxsr (andre er) gcs-1 (andre kan være på engelsk) TGGGTAATCTGGACGGTTTG (Nær TGGGTAATCTGGACGGTTTG) ATGTTTGCCTCGACAATGTT
Oxsr (andre er) Skn-1 (andre kan være på vei til Skn- En maskinoversatt eller -vetikkefore for din andre som har TCAGGACGTCAACAGCAGAC (Andre)
Oxsr (andre er) sod-3 (andre kan være på Gtaacgggcgatagcatgag (nær Saacgggcgatagcatgag) Gcgagagcacattgatgac
Oxsr (andre er) ptps-1 (ptps-1) AATCGATTCCTTTGGAGACC (Andre) Caatctactgctcgcactgctt
Caaagc (andre vil)
Referanse Pmp-3 (andre kan være på vei til pmp- TGGCCGGATGATGGTGTCGC (Andre) Acgaacaatgccaaaggccagc
Referanse Y45F10.4 (4. 2010)-2010:00:0 CGAGAACCCGCGAAATGTCGGA (Andre) Cggttgccagggaagatgaggc (andre er i seg selv)
Referanse Sap-49 (Andre) TGGCGGATCGTCGTGCTTCC (Andre) Acgagtctcctcgttcgtccca
Referanse Tba-1 (Andre) TCAACACTGCCATCGCCGCC TCCAAGCGAGACCAGGCTTCAG (Nær TCCAAGCGAGACCAGGCTTCAG)

Tabell 6: Anbefalte genmål og primerpar for måling av transkripsjonsregulering av stressresponsgener.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her beskrives metoder for å avhøre cellulære stressresponser i C. elegans, ved hjelp av fluorescerende transkripsjonsreportere og fysiologiske stressoverlevelsesanalyser. Journalistene bruker alle GFP-uttrykk drevet under arrangøren av et nedstrøms transkripsjonsmål for transkripsjonsfaktorene som er involvert i montering av cellulære stressresponser. Bruken av hsp-4p::GFP modulert av XBP-1s-mediert UPRER, hsp-6p::GFP kontrollert av ATFS-1-mediert UPRMT, gst-4p::GFP under SKN-1-mediert OxSR, og hsp16.2p::GFP og hsp-70p::GFP under HSF-1-mediert varmesjokkrespons forklares. Andre standardiserte transkripsjonsreportere finnes i tabell 3. Alle transkripsjonelle reportere presentert her har et bredt dynamisk område og kan aktiveres robust ved å bruke stress enten gjennom genetiske perturbasjoner eller eksponering for stressfremkallende kjemikalier. Videre kan disse reporterne alle bli undertrykt av knockdown av transkripsjonsfaktorene oppstrøms av arrangørene ansatt. Til slutt er hver transkripsjonsreporter paret til en bestemt fysiologisk stressoverlevelsesanalyse for å gi en fysiologisk avlesning av virkningen av enten aktivering eller reprimering av en bestemt stressrespons.

For å kunne bruke bruken av transkripsjonelle reportere, er det viktig å bestemme det dynamiske området til hver reporter. På grunn av store variabiliteter fra lab til lab forårsaket av forskjeller i media, agar, omgivelsesmiljø osv., anbefales det å titrere hvert legemiddel eller stressinduksjonsparadigme for konsentrasjoner og timing ved hjelp av våre anbefalinger som baseline. Deretter er det viktig å sikre at dyrene er sunne og riktig synkronisert. Dyr som har opplevd en slags stress (f.eks sult, langsiktig eksponering for lys, eksponering for forhøyet temperatur, etc.) bør gjenopprettes i flere generasjoner før eksperimentering. Riktig synkronisering kan oppnås ved hjelp av metodene som er skissert i del 2, noe som er viktig da flere stressresponser har forskjellige nivåer av aktivering under aldringsprosessen. Til slutt er bildeprotokoller avgjørende for å standardisere, da det er ulike ting som kan påvirke bilde- og datakvaliteten. For eksempel bør varigheten av dyr i natriumazid minimeres, da dette forårsaker stress for dyr og kan påvirke reportersignalet. Videre bør mikroskop og biosorter spesifikasjoner være riktig satt til å maksimere signal-til-støy-forhold og dynamisk område, uten å forårsake metning. Mettede piksler kan forårsake store problemer i kvantitativ analyse av prøver, da maksimalt fluorescerende signal kan undervurderes alvorlig.

Mens transkripsjonsreporterne som er beskrevet her, gir et robust og effektivt middel for å måle aktivering av stressresponser, er det avgjørende å forstå at det er et enkelt genmål for en kjent transkripsjonsfaktor. Derfor, mens det fungerer som en pålitelig metode for store skjermer eller første-pass tester av stammer av interesse, bør riktige valideringer utføres. Vi anbefaler at du utfører qPCR for å måle flere kanoniske målgener aktivert ved induksjon av hver stressrespons som blir analyset. En liste over foreslåtte genmål finnes i tabell 6. I tillegg er transkripsjonsprofilering gjennom RNA-seq et annet alternativ for et bredere blikk på effekter på flere transkripsjonsmål samtidig. Spesielt oppmerksom, avbildning av fluorescerende journalister gir romlig informasjon om vev som påvirkes av perturbasjoner. Slik informasjon kan ikke hentes fra qRT-PCR eller RNA-seq, da den bruker helormekstrakter, unntatt ved scRNA-seq, FISH og vevsspesifikke RNAseq-protokoller47. Til slutt er disse stressreporterne generelt karakterisert som spesifikke for deres stressresponsmaskineri. Det er imidlertid viktig å huske at ikke alle stressresponsparadigmer er unike og distinkte. For eksempel kan ER stress aktivere OxSR og vice versa48, og overlappinger mellom varmesjokkrespons og ER-stressresponser har ofte blitt funnet49. Dette er bare noen få av de mange eksemplene i litteraturen om krysskommunikasjon og overlapping mellom stressresponser, og dermed er det viktig å forstå at alle analyser også bør testes for spesifisitet for å utlede endelige konklusjoner.

En annen begrensning av metodene som er beskrevet er at avbildning og kvantifisering gjennom en biosorter har begrenset gjennomstrømning. Mens biosorter kvantifisering kan utføres i 96-brønnplater for høyere gjennomstrømning, er det fortsatt begrenset av nødvendigheten av å overføre ormer til løsning, mens bildebehandling er begrenset av undersøkerens evne til å forberede ormer og utføre mikroskopi. Derfor vil store skjermer mest sannsynlig bare innebære en visuell screening av fluorescerende reportersignal, med bare treff som blir avbildet og kvantifisert.

En viktig påminnelse med bruk av disse fluorescerende journalistene er at aktivering eller undertrykkelse av stressresponser ikke alltid bidrar til fysiologisk meningsfulle fenotyper, eller kan gjenspeile andre globale effekter (f.eks. reduksjon i proteinsyntese). Derfor er hver transkripsjonsreporter paret til en metode for å si stressoverlevelse. Det anbefales å utføre tunicamycin overlevelse analyser for UPRER, paraquat overlevelse analyser for UPRMT og OxSR, og overlevelse i forhøyede temperaturer for varmesjokkresponsen. Selv om disse generelt er robuste, raske og enkle analyser, krever de intensivt manuell arbeidskraft, og dermed er sterkt begrenset i skalerbarhet. Videre har nesten alle termotoleranseanalyser publisert til dags dato stor variasjon, noe som gjør et stort antall replikater nesten essensielle21. Mens tunicamycin og paraquat overlevelse analyser ikke lider av denne mangelen på reproduserbarhet, har de sine egne utfordringer, inkludert omfattende praktisk arbeidskraft og varighet av protokollen. Ettersom ny teknologi er født i å automatisere levetid og overlevelseanalyser, er det sannsynlig at disse stressoverlevelsesanalyser også kan bli høy gjennomstrømning50. Men inntil disse automatiserte analysene blir standard, er overlevelsesanalyser for tiden begrenset til validering av fysiologiske konsekvenser i endring av dynamikken i stressresponsaktivitet.

Utover stressoverlevelsesanalysene som er beskrevet her, finnes det en rekke andre metoder for å måle fysiologi hos dyr. For eksempel kan en kommersielt tilgjengelig Seahorse XFp Analyzer tillate overvåking av cellulær åndedrett, noe som gir ytterligere mekanistisk innsikt51. Et annet alternativ til transkripsjonelle reportere er bruk av kjernefysisk lokalisering av fluorescerende merkede transkripsjonsfaktorer. Det finnes mange varianter av denne teknikken, men av særlig interesse for metodene som er beskrevet her inkluderer: HSF-1::GFP for varmesjokkresponsen52,DVE-1::GFP for UPRMT53og DAF-16::GFP og SKN-1::GFP for OxSR54,55. Til slutt kan direkte avhør av morfologi av spesifikke organeller av interesse utføres. Mitokondriemorfologi kan for eksempel visualiseres ved å bruke en fluorofor i mål rettet mot mitokondriematrisen ved hjelp av en mitokondrie-lokaliseringssekvens56. ER morfologi kan visualiseres ved å bruke en fluorofor rettet mot ER gjennom en signalsekvens smeltet til N-terminus og HDEL smeltet til C-terminus57 eller GFP smeltet til et ER membranprotein58. Til slutt kan actin cytoskeletal integritet brukes som proxy for termisk stressfølsomhet nedstrøms av HSF-1. Actin cytoskeleton er regulert av transkripsjonsmål for HSF-1, spesielt under aldring og varme-stress, og dermed actin organisasjon kan visualiseres for å bestemme funksjonell avlesning av HSF-1 og varmerelatert stress59,60.

Alle metodene som er beskrevet her kan brukes uavhengig eller i kombinasjon med hverandre for en omfattende analyse av gener eller legemidler av interesse og deres innvirkning på stressrespons. Storskala skjermer kan utføres ved hjelp av høy gjennomstrømning transkripsjonsmessige reporter analyser, og sekundære skjermer kan utføres ved hjelp av kvantitative analyser av disse reporterne. Nok en gang identifiseres håndterbare kandidatgen-/legemiddellister, fysiologiske analyser kan utføres for å identifisere de kandidatene som har direkte innvirkning på hele dyrefysiologien. De andre metodene som foreslås ovenfor kan også brukes som validering eller videre undersøkelser.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

R.BZ. støttes av EMBO langsiktig fellesskap og Larry L. Hillblom Foundation. R.H.S støttes av stipend 5F32AG032023-02 gjennom National Institute of Aging (NIA) og Glenn Foundation for Medical Research Postdoctoral Fellowship. A.F. støttes av gi F32AG051355 gjennom NIA. H.K.G. støttes av gi DGE1752814 gjennom National Science Foundation Graduate Research Fellowship Program. M.G.M. støttes av 1F31AG060660-01 til og med NIA. A.D. støttes av Thomas og Stacey Siebel Foundation, Howard Hughes Medical Institute, og 4R01AG042679-04 og 5R01AG055891-02 fra NIA, og 5R01ES021667-09 fra NIEHS. Vi takker Larry Joe, Melissa Sanchez, Naame Kelet og Anel Esquivel for betydelig teknisk assistanse. Vi takker Morimoto-laboratoriet og CGC (finansiert av NIH Office of Research Infrastructure Program P40 OD010440) for stammer.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics