Determination of Vaccine Immunogenicity Using Bovine Monocyte-Derived Dendritic Cells

Summary

The methodology describes the generation of bovine monocyte-derived dendritic cells (MoDCs) and their application for the in vitro evaluation of antigenic candidates during the development of potential veterinary vaccines in cattle.

Abstract

Dendritic cells (DCs) are the most potent antigen-presenting cells (APCs) within the immune system. They patrol the organism looking for pathogens and play a unique role within the immune system by linking the innate and adaptive immune responses. These cells can phagocytize and then present captured antigens to effector immune cells, triggering a diverse range of immune responses. This paper demonstrates a standardized method for the in vitro generation of bovine monocyte-derived dendritic cells (MoDCs) isolated from cattle peripheral blood mononuclear cells (PBMCs) and their application in evaluating vaccine immunogenicity.

Magnetic-based cell sorting was used to isolate CD14⁺ monocytes from PBMCs, and the supplementation of complete culture medium with interleukin (IL)-4 and granulocyte-macrophage colony-stimulating factor (GM-CSF) was used to induce the differentiation of CD14⁺ monocytes into naive MoDCs. The generation of immature MoDCs was confirmed by detecting the expression of major histocompatibility complex II (MHC II), CD86, and CD40 cell surface markers. A commercially available rabies vaccine was used to pulse the immature MoDCs, which were subsequently co-cultured with naive lymphocytes.

The flow cytometry analysis of the antigen-pulsed MoDCs and lymphocyte co-culture revealed the stimulation of T lymphocyte proliferation through the expression of Ki-67, CD25, CD4, and CD8 markers. The analysis of the mRNA expression of IFN-γ and Ki-67, using quantitative PCR, showed that the MoDCs could induce the antigen-specific priming of lymphocytes in this in vitro co-culture system. Furthermore, IFN-γ secretion assessed using ELISA showed a significantly higher titer (**p < 0.01) in the rabies vaccine-pulsed MoDC-lymphocyte co-culture than in the non-antigen-pulsed MoDC-lymphocyte co-culture. These results show the validity of this in vitro MoDC assay to measure vaccine immunogenicity, meaning this assay can be used to identify potential vaccine candidates for cattle before proceeding with in vivo trials, as well as in vaccine immunogenicity assessments of commercial vaccines.

Introduction

Veterinary vaccination represents a crucial aspect of animal husbandry and health, as it contributes to improving food security and animal welfare by conferring protection against diseases that affect the livestock sector globally¹. An effective in vitro method to assess the immunogenicity of possible vaccine candidates would help accelerating the process of vaccine development and production. It is, therefore, necessary to expand the field of immune assays with innovative methodologies based on in vitro studies, as this would help to unveil the complexity of the immune processes related to immunization and pathogen infection. Currently, in vivo animal immunization and challenge studies, which require periodic sampling (e.g., blood and spleen), are used to measure the immunogenicity of candidate vaccines and adjuvants. These assays are expensive, time-consuming, and have ethical implications, because in most cases, animal euthanasia is carried out by the end of the trials.

As an alternative to in vivo assays, peripheral blood mononuclear cells (PBMCs) have been used to evaluate vaccine-induced immune responses in vitro². PBMCs are a heterogeneous population of cells composed of 70%-90% lymphocytes, 10%-20% monocytes, and a limited number of dendritic cells (DCs, 1%-2%)³. PBMCs harbor antigen-presenting cells (APCs) such as B cells, monocytes, and DCs, which constantly patrol the organism searching for signs of infection or tissue damage. Locally secreted chemokines facilitate the recruitment and activation of APCs to these sites by binding to cell surface receptors. In the case of monocytes, chemokines direct their fate to either differentiate into DCs or macrophages⁴. As soon as DCs encounter and capture a pathogen, they migrate to secondary lymphoid organs, where they can present the processed pathogen peptide antigens using major histocompatibility complex (MHC) class I or class II surface proteins to CD8⁺ T cells or CD4⁺ T cells, respectively, thus triggering an immune response^5,6.

The key role played by DCs in orchestrating a protective immune response against various pathogens makes them an interesting research target for understanding intracellular immune mechanisms, especially when designing vaccines and adjuvants against infectious agents⁷. Since the fraction of DCs that can be obtained from PBMCs is rather small (1%-2%), monocytes have instead been used to generate DCs in vitro⁸. These monocyte-derived DCs (MoDCs) were initially developed as a possible treatment strategy in cancer immunotherapy⁹. More recently, MoDCs have been used for vaccine research^10,11,12, and classical monocytes are the predominant subtype (89%) for MoDC production¹³. The production of MoDCs in vitro has previously been achieved through the addition of granulocyte-macrophage colony-stimulating factor (GM-CSF) given in combination with other cytokines such as interleukin-4 (IL-4), tumor necrosis factor α (TNF-α), or IL-13^14,15,16.

The success of an in vitro MoDC assay relies on the capability of antigen-stimulated mature MoDCs to modulate the extent and type of the immune response specific to the type of antigen detected¹⁷. The type of pathogen recognized and presented by MoDCs determines the differentiation of CD4⁺ T helper (Th) cells into either Th1, Th2, or Th17 effector cells and is characterized by a pathogen-specific secretory cytokine profile. A Th1 response is elicited against intracellular pathogens and results in the secretion of interferon-gamma (IFN-γ) and tumor necrosis factor beta (TNF-β), which modulates phagocytic-dependent protection. A Th2 response is triggered against parasitic organisms and is characterized by IL-4, IL-5, IL-10, and IL-13 secretion, which initiates phagocytic-independent humoral protection. Th17 offers neutrophil-dependent protection against extracellular bacterial and fungal infections mediated by the secretion of IL-17, IL-17F, IL-6, IL-22, and TNF-α^18,19,20,21. Based on previous studies, it has been noted that not all pathogens fall within the expected cytokine profile. For example, dermal MoDCs, in response to Leishmania parasitic infection, stimulate IFN-γ secretion from CD4⁺ T cells and CD8⁺ T cells, thus inducing a protective proinflammatory Th1 response²².

It has also been shown that, in chicken MoDCs primed with Salmonella lipopolysaccharide (LPS), can induce a variable response against Salmonella typhimurium by activating both Th1 and Th2 responses, whereas Salmonella gallinarum induces a Th2 response alone, which could explain the higher resistance of the latter toward MoDC clearance²³. The activation of MoDCs against Brucella canis (B. canis) has also been reported in both canine and human MoDCs, meaning this could represent a zoonotic infection mechanism²⁴. Human MoDCs primed with B. canis induce a strong Th1 response that confers resistance to severe infection, whereas canine MoDCs induce a dominant Th17 response with a reduced Th1 response, subsequently leading to the establishment of chronic infection²⁵. Bovine MoDCs show an enhanced affinity for foot-and-mouth disease virus (FMDV) conjugated with immunoglobulin G (IgG) as compared to non-conjugated FMDV alone, as the MoDCs form a viral-antibody complex in response to the former¹⁰. Taken together, these studies show how MoDCs have been used to analyze the complexity of immune responses during pathogen infection. The adaptive immune responses can be evaluated by the quantification of specific markers associated with lymphocyte proliferation. Ki-67, an intracellular protein detected only in dividing cells, is regarded as a reliable marker for proliferation studies²⁶, and similarly, CD25 expressed on the surface of T cells during the late phase of activation corresponds to lymphocyte proliferation^27,28.

This study demonstrates a standardized method for the in vitro generation of cattle MoDCs followed by their application in an in vitro immune assay used for testing the immunogenicity of vaccines. A commercially available rabies vaccine (RV) was used to validate the efficacy of this assay. T lymphocyte activation and proliferation were measured by flow cytometry, real-time quantitative polymerase chain reaction (qPCR), and enzyme-linked immunosorbent assay (ELISA) through the analysis of well-established cell activation markers such as Ki-67 and CD25 and the secretion of IFN-γ^28,29,30,31. No animal or human experimental trials are performed during the MoDC assay.

Protocol

Blood collection is performed by a certified veterinarian service in accordance with the ethical guidelines of the Austrian Agency for Health and Food Safety(AGES) and in compliance with the accepted animal welfare standards³². The study received ethical approval from the Austrian Ministry of Agriculture. The experimental design for MoDCs generation and its subsequent application is illustrated in Figure 1.

1. Production of naive MoDCs

NOTE: Whole blood samples were obtained from a single pathogen-free calf by jugular vein puncture with heparinized vacutainers (eight 9 mL blood tubes were used for this study). Transport the blood in an ice box. Store the samples at 2-4 °C for later use, or process them immediately. Keep the blood rotating to avoid blood clotting. Sterilize the vacutainers with 70% ethanol. All the following experiments were performed with one biological sample and six technical replicates.

1. Density gradient centrifugation to isolate PBMCs from the heparinized blood
   1. Mix the blood well by inverting it 10x.
   2. Using a 10 mL pipette, transfer 20 mL of heparinized blood to a sterile 50 mL tube, and dilute it with 10 mL of phosphate-buffered saline (PBS).
   3. Pipette 15 mL of lymphocyte isolation medium to a sterile 50 mL tube.
      NOTE: Allow the lymphocyte-isolating medium to reach room temperature prior to pipetting.
   4. Tilt the 50 mL tube containing the lymphocyte isolation medium to a 45° position. Point the tip of a 25 mL pipette perpendicularly, and carefully layer the 30 mL of blood-PBS on top of the lymphocyte isolation medium, without mixing the two. Very slowly, bring the 50 mL tube back to a vertical position.
   5. Centrifuge at 800 × g for 35 min at 20 °C with maximum acceleration and without braking (deceleration function turned off).
   6. Use a Pasteur pipette to collect the PBMC layer (the thin white layer right after the first layer of plasma) and transfer it into a new 50 mL tube.
      NOTE: Density gradient centrifugation separates whole blood into different layers. As a result, the erythrocytes settle at the bottom as a pellet, the mononuclear cells (PBMCs) settle at the interface layer, and the plasma forms the top layer. Granulocytes are found between the pellet and the PBMC layer.
   7. Wash the harvested PBMCs 2x by adding PBS up to a volume of 40 mL and mixing thoroughly by pipetting up and down. Then, centrifuge at 500 × g at 4 °C for 7 min with maximum acceleration and maximum deceleration.
   8. Discard the supernatant by decantation, resuspend the pellet in 15 mL of 1x ammonium-chloride-potassium (ACK) buffer, and incubate at room temperature for 10-15 min.
      NOTE: Do not incubate for more than 15 min. Commercially available ACK buffer is used to ensure the lysis of the residual red blood cells (RBCs) present in the PBMC fraction.
   9. Add PBS up to a volume of 40 mL, and then centrifuge at 500 × g and 4 °C for 7 min with maximum acceleration and deceleration.
   10. Discard the supernatant by decanting, and repeat step 1.1.9.
   11. Discard the supernatant, and resuspend the pellet in 10 mL of complete culture medium (at room temperature).
       NOTE: The complete culture medium is composed of RPMI 1640 cell culture medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.
2. Magnetic separation of the CD14^+/− cells from the PBMC population using CD14-conjugated magnetic beads
   1. Count the cells with a clean hemocytometer cell counter using 10 µL of cell suspension mixed with 10 µL of trypan blue (0.4%) solution.
      NOTE: Trypan blue dye is a toxic chemical and potential carcinogen. It should be handled while wearing personal protective equipment (PPE) to avoid contact, and waste should be discarded in an airtight specialized toxic waste container. Dead cells will appear blue, whereas live cells will appear clear under the microscope.
   2. Centrifuge for 7 min at 500 × g.
   3. Discard the supernatant using a pipette, and resuspend the pellet in fluorescence-activated cell sorting buffer (FACS) using a volume of 40 µL for every 1 × 10⁷ cells. Mix thoroughly using a pipette.
      NOTE: FACS buffer is composed of 2% FBS and 2 mM ethylenediaminetetraacetic acid (EDTA) dissolved in PBS.
   4. Add 5 µL of CD14 microbead buffer per 1 × 10⁷ cells, and mix thoroughly using a pipette.
   5. Incubate for 30 min at 4-8 °C for the positive selection of bovine CD14⁺ monocytes³³. Vortex every 15 min during the incubation period.
   6. Optional step (for flow cytometry analysis): Add 10 µL of CD14-FITC (fluorescein isothiocyanate) staining antibody with subsequent incubation for 15 min at 4-8 °C. Refer to the flow cytometry analysis in step 5 for details.
   7. Add 1 mL of FACS buffer, and centrifuge for 7 min at 500 × g.
   8. Discard the supernatant, and resuspend the pellet in 500 µL of FACS buffer per 1 × 10⁸ cells.
   9. Insert the immunomagnetic cell separation column into the separator (magnetic column holder), and place a 15 mL collection tube under the column outlet for collecting the flowthrough.
   10. Wash the column with 1 mL of degassed FACS buffer. After rinsing, replace the used 15 mL tube with a new one.
   11. Allow the cell suspension (from step 1.2.8) to pass through the column by pipetting 1 × 10⁸ cells in 500 µL of buffer at a time.
       NOTE: Pay attention not to generate air bubbles while mixing the cells before allowing them through the column.
   12. Rinse the column 3x with 3 mL of degassed FACS buffer each time.
   13. Collect the flowthrough, and label this first eluted fraction as the CD14⁻ cell fraction (PBMCs minus CD14⁺ monocytes); this is also termed the naive lymphocyte fraction.
       NOTE: The CD14⁻ cells are maintained in complete culture medium until antigen-pulsed MoDCs are produced.
   14. Remove the column from the separator.
   15. Place a new sterile 15 mL tube under the column for the collection of the effluent.
   16. Pipette 5 mL of FACS buffer into the column, and immediately push it through using a plunger.
   17. Collect the flowthrough, and label this second eluted fraction as the CD14⁺ cell fraction; this is also called the naive monocyte fraction.
   18. Add complete culture medium to the harvested CD14⁺ monocytes to attain 1 × 10⁶ cells/mL.
       NOTE: Count the live cells in the eluted CD14⁺ cell fraction to estimate the volume of complete culture medium required to attain the desired cell count.
   19. Take a sterile 24-well plate, and add 1 mL of the cell suspension (1 × 10⁶ cells/mL) to each well.
3. Differentiation of the CD14⁺ naive monocytes into naive MoDCs by the addition of 3% w/v cytokine cocktail (GM-CSF + IL-4) with a total of 5 days of incubation
   1. Supplement each well containing CD14⁺ monocytes with 40 µL (3% w/v) of the cytokine cocktail provided in the kit.
   2. Incubate the plate in a humidified incubator with 5% CO₂ and at 37 °C for 48 h.
   3. On day 2, transfer half of each well's content (500 µL) using a pipette to individual 1.5 mL tubes, and centrifuge at 500 × g at 4 °C for 7 min.
   4. Discard the supernatant, and resuspend the pellet in 500 µL of fresh complete culture medium.
   5. Transfer 500 µL of this cell suspension from step 1.3.4 back to each designated well so that the final volume is 1 mL.
   6. Enrich each well with 20 µL of cytokine cocktail.
   7. Incubate the culture for 72 h in a humidified incubator with 5% CO₂ and at 37 °C.
   8. After the incubation on day 5, remove the plate from the incubator.
      NOTE: Each well will contain 1 mL of a cell suspension of naive MoDCs. The number of MoDCs will be a percentage (~20%) of the original monocytes plated (1 × 10⁶/mL).

2. MoDC endocytic activity assay

NOTE: The antigen uptake assay or endocytic activity assay measures the ability of naive MoDCs to internalize foreign material. Perform the assay using naive MoDCs cultured with 3% w/v cytokine cocktail and with 5 days of incubation, as previously described³⁴.

1. Harvest the naive MoDC cell suspension from the 24-well plate, and transfer it to a 15 mL tube; also collect any residual cells by rinsing the wells with PBS.
2. Centrifuge for 500 × g for 7 min. Discard the supernatant, and resuspend the pellet in 1 mL of culture medium supplemented with 1% FBS.
3. Count the live MoDC cells to estimate the volume of medium required to attain the desired cell count (2 × 10⁵ cells/mL).
4. Culture the naive MoDCs in 100 µL of complete culture medium in a 24-well plate with a final cell concentration of 2 × 10⁵ cells/mL.
5. Supplement each well with 1 mg/mL FITC-conjugated dextran (fluorescent probe used as the endocytosis tracer).
   NOTE: The FITC-dextran acts as a fluorescent probe and is used as an endocytosis tracer.
6. Cover the plate, and incubate in the dark at 5% CO₂ and 37 °C for 60 min.
   ​NOTE: For the background control, incubate the additional MoDC cells (2 × 10⁵ cells/mL) with 1 mg/mL FITC-dextran on ice, as this type of incubation prevents the entry of the tracer molecule (FITC-dextran) into the cells.
7. After incubation, immediately transfer the 24-well plate on ice to stop the endocytosis of FITC-dextran.
8. Wash the cells with ice-cold FACS buffer.
9. Harvest, centrifuge, and resuspend the pellet in 500 µL of FACS buffer.
10. Analyze the fluorescence intensity of the FITC-dextran within the cells using flow cytometry. Refer to the flow cytometry analysis in step 5.2 for details.

3. Generation of antigen-pulsed MoDCs

NOTE: A commercially available and clinically approved vaccine against rabies virus (RV) can induce the differentiation of naive MoDCs into mature antigen-presenting MoDCs. Use 0.1% (~1 µL) of a single RV vaccination dose to generate antigen-pulsed MoDCs. Furthermore, it is preferred to produce RV-pulsed MoDCs in the same culture plate used (in step 1.3.8) to generate naive MoDCsbecause transferring the naive MoDCs to a new 24-well plate will negatively affect them.

1. From step 1.3.8) Add 1 µL/mL of RV suspension to 1 mL of naive MoDC culture in the 24-well plate, and incubate for 48 h at 5% CO₂ and 37 °C.
   NOTE: Naive MoDCs cultured without RV stimulation are used as a background control (and as non-specific stimulation for co-culture with lymphocytes in the next steps).
2. After incubation, on day 7, keep the 24-well plate containing the antigen-pulsed MoDCs on ice for 10 min.
3. Add 1 mL of ice-cold PBS per well. Mix each well thoroughly by pipetting, and transfer the suspension to a 15 mL tube.
4. Wash the wells with 2 mL of ice-cold PBS to collect the residual cells left within each well.
5. Transfer the contents into their respective tubes, and centrifuge the cell suspension at 500 × g for 7 min.
6. Discard the supernatant, resuspend the cell pellet (antigen-pulsed MoDCs) in complete culture medium, and adjust the volume to a final cell concentration of 1 × 10⁵ cells/mL.
   NOTE: Count the live cells to estimate the volume of medium required to attain the desired cell count. Use RV-pulsed MoDCs from day 7 for the MoDC-lymphocyte co-culture system.

4. MoDC-lymphocyte co-culture

NOTE: The in vitro MoDC-lymphocyte co-culture system determines the ability of MoDCs to prime antigen-specific lymphocytes. The different treatment groups of cells after 16 days of co-culture include specific, non-specific, and control. The specific group is defined as lymphocytes co-cultured with RV-pulsed MoDCs; the non-specific group is defined as lymphocytes co-cultured with non-antigen-pulsed MoDCs; and the control group is defined as lymphocytes cultured without MoDCs.

1. Add complete culture medium to the eluted naïve lymphocyte fraction (CD14⁻ cells) to attain a cell concentration of 2 × 10⁶ cells/mL.
   NOTE: Count the live cells in the CD14⁻ cell culture that have been maintained in complete culture medium in a 24-well plate since their collection to estimate the volume of medium required to attain the desired cell count.
2. On day 7, take a sterile 24-well plate, and seed the wells with 1 mL of naive lymphocyte cell suspension (2 × 10⁶ cell/mL) plus 1 mL of antigen-pulsed or non-antigen-pulsed MoDC suspension (1 × 10⁵ cell/mL).
   NOTE: The total volume in each well will be 2 mL with a ratio of 1:20 MoDCs to lymphocytes per well.
3. Incubate the plate for 48 h at 37 °C and 5% CO₂.
4. Culture enrichment and restimulation with antigen-pulsed MoDCs
   1. After the incubation of the antigen-pulsed MoDC-lymphocyte co-culture, on day 9, supplement each well with 20 ng/mL recombinant IL-2, and continue to incubate for another 120 h (5 days incubation).
   2. On day 14, transfer 1 mL of the co-culture to a sterile 1.5 mL tube, and centrifuge at 500 × g for 7 min.
   3. Discard the supernatant, and resuspend the cell pellet with 1 mL of antigen-pulsed or non-pulsed MoDCs (1 × 10⁵ cell/mL). Mix gently by pipetting, and transfer the cell suspensions back to their designated wells.
      NOTE: At this step, the total volume in each well is 2 mL.
   4. Continue with incubation at 5% CO₂ and 37 ˚C for 48 h. After incubation on day 16, the co-culture is ready for analysis using flow cytometry, qPCR, and ELISA.
      ​NOTE: For every 2 mL in each well of the MoDC-lymphocyte co-culture, 1 mL of resuspended cells is stained for flow cytometry, 1 mL is used for RNA extraction, and the supernatants from both are used for ELISA.

5. Flow cytometric analysis

NOTE: Stain the cells with appropriate markers/mAb prior to running the samples on a flow cytometer. Refer to the Table of Materials for details on the reagents (staining mAb and isotype controls), kit, instrument, and software used for the flow cytometry analysis.

1. Flow cytometer staining protocol
   NOTE: Perform cell surface staining for the PBMCs and naive lymphocytes and monocytes using anti-CD14 mAb (step 1.2.6). For the cell surface staining of naive MoDCs, use anti-CD86-specific, anti-CD40-specific, and anti-MHC II-specific mAb. For the cell surface staining of cells from day 16 co-cultures, use anti-CD4, anti-CD8, anti-CD25 mAbs; for intracellular staining, use anti-Ki-67 mAb. Furthermore, stain the cells either with negative isotype control mAb or without mAb (FMO: fluorescent minus one). The main difference when staining for surface and intracellular markers is that for cell surface markers, the cells must be stained with specific surface mAb prior to live/dead (L/D) staining or any other processes. However, intracellular staining is performed after L/D staining and requires a fixation plus permeabilization step to allow intracellular penetration.
   1. Transfer 1 mL of cell suspension to a sterile 1.5 mL tube using a pipette, and centrifuge for 10 min at 500 × g.
      NOTE: After centrifugation, when processing the cells from the MoDC-lymphocyte co-culture, save the supernatant for ELISA analysis.
   2. Resuspend the pellet in 1 mL of PBS, and transfer it to a 15 mL tube. Collect the residual cells using 1 mL of PBS, and combine this with the resuspended pellet.
   3. Add 10 mL of PBS to the 15 mL tube containing the cells, mix by pipetting, and centrifuge for 7 min at 850 x g.
   4. Discard the supernatant, and repeat step 5.1.3.
   5. Discard the supernatant, and carefully resuspend the cell pellet with the residual suspension (approximately 180 µL) left after decanting the supernatant.
   6. Transfer the cell suspension to a v-bottom 96-well plate, and seal the wells to avoid spillage.
   7. Centrifuge the plate at 1,400 × g for 5 min. After centrifugation, flick the plate over a waste container to empty the wells of liquid, and tap the plate on absorbent paper to ensure the removal of excess liquid.
   8. Add 25 µL of surface staining master mix per well, and gently mix using a pipette, followed by incubation at 4 ˚C for 30 min.
      NOTE: To prepare surface staining master mix for a single well, add 2.5 µL of surface mAb to 20 µL of FACS buffer.
   9. Add 200 µL of FACS buffer per well, and centrifuge at 1,400 × g for 5 min. After centrifugation, empty the wells of liquid by decanting, and tap the plate on absorbent paper to remove excess liquid.
   10. Add 100 µL of L/D staining solution per well. Mix thoroughly using a pipette, followed by incubation at 4 ˚C for 15 min in the dark.
       NOTE: For a single well, dissolve 0.25 µL of L/D dye in 100 µL of FACS buffer. The L/D dye helps distinguish between live and dead cells.
   11. Add 100 µL of FACS buffer. Cover the wells with the lid, and centrifuge the plate for 1,400 × g for 5 min. Discard the supernatant by decanting, and tap the plate on absorbent paper.
   12. Repeat step 5.1.11.
   13. Add 50 µL of fixation solution per well (provided with the kit), and mix with a pipette before incubating the plate at room temperature in the dark for 10 min.
   14. Add 150 µL of the 1x permeabilization-wash buffer (PW) provided with the kit, and cover the wells with the lid.
       NOTE: To prepare 10 mL of 1x PW buffer, dilute 1 mL of 10x perm buffer in 10 mL of dH₂O.
   15. Centrifuge the plate at 1,400 × g for 5 min at 4 ˚C. Discard the supernatant by decanting, and tap the plate on absorbent paper.
   16. Add 200 µL of 1x PW, followed by centrifugation at 1,400 × g for 5 min at 4 ˚C. Discard the supernatant by decanting, and tap the plate on absorbent paper.
   17. For intracellular staining, add 25 µL of intracellular staining master mix (anti-human Ki-67 mAb) per well. Mix well, and incubate the plate for 30 min at 4 ˚C or on ice in the dark.
       NOTE: To prepare intracellular staining master mix for a single well, add 1 µL of Ki-67 mAb to 24 µL of 1x PW. The intracellular staining marker is used only when processing cells from day 16 co-culture. Intracellular staining is not done while processing PBMCs, naive lymphocytes, monocytes, and naive MoDCs.
   18. Following incubation, add 200 µL of 1x PW to each well. Mix with a pipette, and centrifuge for 1,400 × g for 5 min. Discard the supernatant by decanting, and tap the plate on absorbent paper.
   19. Add 200 µL of FACS buffer, followed by centrifugation at 1,400 × g for 5 min. Discard the supernatant by decanting, and tap the plate it on absorbent paper.
   20. Resuspend the cell pellet in 200 µL of FACS buffer, and transfer the contents of each well to separate sterile flow cytometer tubes. Use 300 µL of FACS buffer per well to collect the residual cells. The cells are now ready for flow cytometry analysis.
2. Running the sample on a flow cytometer
   NOTE: The samples were run on a flow cytometer (using 488 nm, 638 nm, and 405 nm lasers) according to the manufacturer's manual³⁵. Refer to the manual for details, troubleshooting, and customization of the protocol.
   1. Perform routine cleaning procedures before and after reading the samples.
      NOTE: Do not skip a position while loading the tubes in the instrument.
      1. For the cleaning cycle, use a total of four tubes, with the first tube containing flow cleaning reagent and the remaining three tubes containing dH₂O; each tube will have 3 mL. During the cleaning run, acquire data with a medium flow rate for approximately 1 min by capturing 100,000 events per tube under 330 V for forward scatter (FSC) against 265 V for side scatter (SSC).
         NOTE: No debris or cellular events should be reported during the cleaning; if this happens, perform the cleaning step again. For running the samples, make sure that all the samples are in a homogeneous suspension prior to acquiring the data because this ensures an accurate reading.
   2. To connect and power on the cytometer, click on the Application Button located on the left-hand corner of the title bar. From the application dropdown menu, select the option Cytometry, and click on the option Power On.
      NOTE: From the application dropdown menu, the option Open allows users to browse through the preprogramed assays, while the option New Protocol allows users to create new protocols.
   3. Initially load the negative control sample in the multi-tube holder. Select New Protocol, and observe the worklist on the left side of the workspace/screen.
   4. On the worklist, define the position of the sample in the multi-tube holder, and give a name to the sample and protocol for identification.
   5. From the Hardware Panel located on the left side of the workspace, adjust and select multiple parameters such as the detectors (FSC, SSC, and 10 fluorescence ranges), the voltages (V) and gains of the photomultipliers, and the area-height-width (AHW) of signal.
      NOTE: The following settings for the detectors were selected based on the experiment and instrument used: FSC-AHW: AHW, V: 270, G: 5; SSC-AHW: A, V: 350, G: 10; FL1 (CD8/FITC Dextran)-AHW: A, V: 400, G: 1; FL2 (CD25/PE)-AHW: A, V: 500, G: 1; FL6 (CD4/Alexa Fluor 647)-AHW: A, V: 700, G: 1; FL7 (Ki-67/Alexa Fluor 700)-AHW: A, V: 625, G: 1; FL9 (L/D)-AHW: A, V: 425, G: 1.
   6. From the Instrument-Acquisition Control Panel located under the title bar, adjust the options for flow rate (medium), Time (5 min), and Events (see step 5.2.8) desired to be detected. Click on the option Acquire Single to allow the instrument to draw/run the sample and show the real-time preview of the events detected.
   7. From the real-time preview, adjust the threshold of fluorescence (voltage and gain) and cell size to eventually draw gates around the desired cell population while excluding any cellular debris.
      NOTE: FSC helps to distinguish cells on the basis of size, thus allowing users to differentiate between cells of the immune system, such as monocytes and lymphocytes; monocytes are larger and show a higher FSC intensity compared to lymphocytes.
   8. Acquire approximately a total of 5,000 live MoDC, 50,000 live lymphocyte, and 50,000 live monocyte events.
   9. Once all the parameters are adjusted in reference to the negative control sample, click on Stop, and save the protocol.
   10. Now load all the samples onto the multi-tube loader. Define each sample on the worklist, and apply the parameters adjusted in reference to the negative control to all the samples within the experiment. Click on the option Acquire to allow all the samples in the experiment to be run consecutively.
   11. Once the data from all the samples are acquired, save and transform into readable data using an appropriate data analysis software that allows the generation of sequential bi-parametric and mono-parametric histograms.

6. Messenger RNA (mRNA) expression analysis

1. RNA extraction
   NOTE: Extract total RNA from the antigen-pulsed MoDC-lymphocyte co-culture (specific), the non-antigen-pulsed MoDC-lymphocyte co-culture (non-specific), the lymphocyte culture without MoDCs (control), and from naive lymphocytes (CD14⁻ cells isolated prior to co-culturing). For the RNA extraction, prepare ethanol using RNase-free water. Refer to the Table of Materials for details on the extraction kit and reagents.
   1. Transfer 1 mL of cell suspension from the MoDC-lymphocyte co-culture plate (~1 × 10⁶ cells/mL) to a sterile 1.5 mL sterile tube using a pipette, and centrifuge for 10 min at 500 × g.
   2. Save the supernatant for ELISA. Resuspend the cell pellet in 1 mL of PBS, and transfer it to a 15 mL tube. Collect any residual cells using 1 mL of PBS.
   3. Centrifuge for 10 min at 500 × g.
      NOTE: All the samples should be handled delicately as living cells until cell lysis is carried out using the lysis buffer provided in the kit. Cell death releases RNases that quickly hydrolyze the RNA templates needed for quantification downstream. RLT buffer lyses cells in a solution that inhibits RNases.
   4. Add 350 µL of lysis buffer to each empty well, and incubate for 2-3 min to lyse the adherent cells that were not harvested in the previous steps.
   5. Once the centrifugation in step 6.1.3 is completed, discard the supernatant, and combine the cell pellet with the 350 µL of lysis buffer added in step 6.1.4.
      NOTE: At this point, it is possible to store the tubes at −80 ˚C or proceed with RNA extraction (following steps).
   6. Pipette 350 µL of 70% ethanol to the lysate in step 6.1.5. The final volume per sample is 700 µL.
   7. Insert the extraction column within a 2 mL collection tube (provided with the kit).
   8. Transfer the 700 µL of sample per extraction column, and centrifuge at 10,000 × g for 15 s. Discard the flowthrough in the collection tube, and place it back into the spin column.
   9. In the extraction column, add 350 µL of stringent wash buffer (provided in the kit), and centrifuge at more than 10,000 × g for 15 s. Discard the flowthrough.
   10. Add 80 µL of DNase I incubation mix per sample onto the membrane of the extraction column, and allow it to set for 15 min at 20-30 ˚C.
       NOTE: To prepare DNase I incubation mix per sample, add 10 µL of DNase I stock solution to 70 µL of DNase buffer for a final volume of 80 µL. Mix thoroughly by inverting the tube several times, followed by a short spin in the centrifuge.
   11. Wash the extraction column with 350 µL of stringent wash buffer, followed by centrifugation at 10,000 × g for 15 min. Discard the flowthrough in the collection tube after centrifugation.
   12. Wash the extraction column 2x with 500 µL of mild wash buffer each time and with centrifugation at 10,000 × g for 15 s and a second time for 2 min. Discard the flowthrough after each centrifugation.
   13. Centrifuge the column at maximum speed for 1 min to dry the membrane, and discard the collection tube.
   14. Place the extraction column in a new 1.5 mL collection tube.
   15. Pipette 50 µL of RNase-free water onto the column membrane, and incubate for 3-5 min at room temperature.
       NOTE: For RNA concentrations below 100 ng, reduce the elution volume to 30 µL, and re-elute the extraction column membrane using the product from the first elution to concentrate the final product.
   16. Centrifuge at 10,000 × g for 1 min to elute the RNA.
   17. Measure the concentration of RNA by detecting the absorbance at 260 nm using 0.5-2 µL of sample. Adjust the final RNA concentration to 0.1-1 µg/µL using RNase-free water.
   18. Store the RNA aliquots at −80 ˚C for later use.
2. Synthesis of complementary DNA
   1. Synthesize complementary DNA (cDNA) from extracted template RNA according to the manufacturer's protocol provided with the kit (refer to the Table of Materials for details).
      NOTE: A summary of the reagents and the volumes used is shown in Table 1 and Table 2. A complete protocol is detailed in Supplementary File 1.
3. Real-time quantitative polymerase chain reaction
   1. For qPCR, run the cDNA samples in triplicates. Quantify the bovine mRNA transcript levels for Ki-67 and IFN-γ using specific primer sets in reference to the GAPDH gene, as shown in Table 3.
      ​NOTE: A complete protocol is detailed in Supplementary File 1.

7. Enzyme-linked immunosorbent assay

1. Process the collected culture supernatants rich in secretory proteins for the quantification of IFN-γ through ELISA.
   NOTE: Refer to the Table of Materials for details on kit use. A complete protocol is detailed in Supplementary File 1.

8. Statistical analysis

1. Analyze the data, and make graphical illustrations of experimental design using commercial software. Use an unpaired non-parametric test for the comparative analysis. Consider P values < 0.05 to be statistically significant.

Representative Results

This methodology describes the in vitro generation of cattle MoDCs for the evaluation of candidate vaccine antigens prior to performing in vivo studies. Figure 1 illustrates the experimental scheme of bovine MoDC generation and the application of the MoDCs for the in vitro assay. Using the magnetic-based cell sorting technique, it was possible to collect approximately 26 million CD14⁺ myocytes from the harvested PBMCs, which were previously isolated from 50 mL of cattle blood. The eluted cell fraction free of CD14⁺ monocytes was rich in lymphocytes and was used as a source of naive CD4⁺ and CD8⁺ T cells (CD14⁻ lymphocyte cell fraction).

The naive monocyte fraction was composed of 98% CD14⁺ monocyte cells, as observed after CD14 cell staining and flow cytometry (Figure 2A,B). The purified naive monocyte cells, when subjected to culturing in the presence of the 3% cytokine cocktail (GM-CSF and IL-4) with a subsequent incubation of 5 days, differentiated into a DC-like phenotype. From a starting culture of 26 million CD14⁺ monocytes, a total of approximately 12 million MoDCs could be obtained after 5 days of incubation. The naive MoDCs were functionally capable of antigen uptake, as observed using the flow cytometry analysis of FITC-dextran (Figure 3). Furthermore, the naive MoDCs were phenotypically characterized by assessing the expression of MHC class II and co-stimulatory CD86 and CD40 cell surface markers, which validated the DC-like phenotype (Figure 4).

The antigen-pulsed stimulation of naive MoDCs was achieved by culturing them in the presence of inactivated RV for 2 days. The activation of naive lymphocytes (the CD14⁻ cell fraction) was achieved by antigen-pulsed MoDC-lymphocyte co-culturing with the subsequent supplementation of IL-2. During the MoDC-lymphocyte co-culture on day 9, a morphological change was observed in the RV-pulsed MoDCs, as they showed dendrite extension, which is a characteristic of MoDC maturation (Figure 5). On day 14, lymphocyte activation was enhanced by restimulating the co-culture through the addition of newly produced RV-pulsed MoDCs from the same animal.

Compared to the non-pulsed MoDC-lymphocyte co-culture, a significant increase (p < 0.01) in lymphocyte proliferation was demonstrated by the upregulation of the Ki-67 and CD25 activation markers on both the CD4⁺ and CD8⁺ T cells on day 16 in the pulsed MoDC-lymphocyte co-culture (Figure 6). The CD8⁺ T cells from the mature RV-pulsed MoDC co-cultures exhibited an eight-fold upregulation (p < 0.01) of Ki-67 when compared to the non-specific group (Figure 7A). The CD4⁺ T cells in the same co-culture showed a seven-fold increase (p < 0.01) in Ki-67 compared to controls (Figure 7B). This demonstrates the ability of RV-primed MoDCs to successfully present the RV antigen to naive lymphocytes and subsequently activate them in an in vitro condition, similar to what happens in a living animal. In addition to analyzing the cells using flow cytometry, the co-cultures were also subjected to qPCR and ELISA to quantify the RV-specific lymphocyte activation using RNA transcription (Ki-67 and IFN-γ) and extracellular secretion (IFN-γ), respectively (Figure 8). These additional detection methods can also be used as confirmatory tests to further validate the results of flow cytometry. The RNA expression for Ki-67 and IFN-γ demonstrated by qPCR and the IFN-γ levels demonstrated by ELISA showed similar patterns of increase, indicating lymphocyte proliferation, in the antigen-specific co-culture as compared to the non-specific treatment group. Therefore, the qPCR and ELISA results correlated with the flow cytometry results. The qPCR showed a >30% increase in IFN-γ expression and a >5% increase in Ki-67 expression in all the co-cultures using GAPDH as a calibrator (Figure 8A,B). A significantly higher concentration of secreted IFN-γ (**p > 0.01) was measured with ELISA using culture supernatants from the RV-pulsed MoDC-lymphocyte co-culture compared to the non-specific treatment group (Figure 8C).

Figure 1: Experimental design of the bovine MoDC-based in vitro assay. (A) Harvesting and cell sorting of the CD14⁺ monocyte and CD14⁻ lymphocyte cell fractions from bovine PBMCs. Cattle blood is processed by density gradient centrifugation to collect PBMCs, followed by magnetic-based cell sorting using immunomagnetic cell separation columns and the subsequent culturing of the harvested CD14⁺ naive monocyte cell fraction in supplemented RPMI 1640 medium. (B) The production of MoDCs using 3% cytokine cocktail (GM-CSF + IL-4) with 5 days of incubation and MoDC-lymphocyte co-culture. On day 0, the monocytes are cultured in the presence of the cytokine cocktail and incubated for 48 h to induce differentiation. On day 2, the culture is restimulated with the same cytokine cocktail, followed by incubation for 72 h, which leads to the production of naive MoDCs. On day 5, the vaccine antigen (rabies vaccine) is added to the naive MoDC cell culture, followed by 48 h incubation. On day 7, the co-culturing of antigen-pulsed MoDCs with naive lymphocytes (the CD14⁻ cell fraction) is performed, followed by incubation. On day 9, IL-2 is added to the co-culture. On day 14, the enrichment/restimulation of the activated/primed lymphocytes is performed by the addition of antigen-pulsed MoDCs, followed by incubation for 48 h. Lastly, on day 16, the cells and culture supernatant are harvested for the lymphocyte proliferation assay. Abbreviations: MODCs = bovine monocyte-derived dendritic cells; PBMCs = peripheral blood mononuclear cells; GM-CSF = granulocyte-macrophage-colony-stimulating factor. Please click here to view a larger version of this figure.

Figure 2: Morphology and purity of bovine CD14⁺ monocytes harvested from PBMCs using anti-CD14-conjugated microbeads. (A) Morphology of bovine monocytes incubated for 4 h at 37 ˚C in complete culture medium to remove microbeads, fixed on poly-lysine-coated slides, and stained with modified Giemsa stain. Scale bar = 50 µm. (B) Flow cytometry histogram showing the eluted CD14⁺ cell fraction with a 98.6% purity level observed using anti-CD14 antibody (red) and FITC-conjugated mouse IgG1 isotype control antibody (green). Abbreviations: PBMCs = peripheral blood mononuclear cells; FITC cont = fluorescein isothiocyanate control. This figure has been modified from Kangethe et al., 2018¹¹. Please click here to view a larger version of this figure.

Figure 3: Endocytic activity of bovine MoDCs generated in vitro. Flow cytometry histogram showing the uptake of the tracer molecule (FITC-dextran) by day 5 naive MoDCs. MoDCs incubated at 37 °C for 60 min with the tracer molecule (blue) and MoDCs incubated on ice with the tracer molecule (grey) used as a background control. Abbreviations: MODCs = bovine monocyte-derived dendritic cells; FITC = fluorescein isothiocyanate. This figure has been modified from Kangethe et al., 2018¹¹. Please click here to view a larger version of this figure.

Figure 4: Phenotyping of in vitro-generated bovine MoDC-specific cell surface markers. Flow cytometry histograms for (A) gating strategies of MoDCs and for (B) day 5 naive MoDCs stained with three different DC-specificmAbs (blue), including the following: anti-sheep MHC II mAb, anti-bovine CD86 mAb, and anti-bovine CD40 mAb. All compared with their corresponding isotype controls (red). Abbreviations: DC = dendritic cells; MODCs = bovine monocyte-derived DCs; MHC II = major histocompatibility complex II. This figure has been modified from Kangethe et al., 2018¹¹. Please click here to view a larger version of this figure.

Figure 5: Signs of maturation of in vitro-produced MoDCs during MoDC-lymphocyte co-culture. Observation of the characteristic extended dendritic structure by antigen-pulsed MoDCs with inverted microscopy on day 9 of the MoDC-lymphocyte co-culture. (A) Mature MoDCs within a highly confluent area of co-cultured lymphocytes. (B) Mature MoDCs are easily distinguishable in an area with fewer lymphocytes in co-culture. Scale bars = 50 µm. Abbreviation: MODCs = bovine monocyte-derived dendritic cells. This figure has been modified from Kangethe et al., 2018¹¹. Please click here to view a larger version of this figure.

Figure 6: Sequential gating strategy adopted for dot plots against Ki-67 and CD25 expression by lymphocytes in MoDC-lymphocyte co-culture. (A) The full gating strategy for cells harvested from day 16 MoDC-lymphocyte co-culture. (B) The Ki-67 expression from CD4⁺-gated lymphocytes and (C) from CD8⁺ lymphocytes compared with the FMO control (without mAb) and mouse IgG1-k isotype control mAb. The CD25 expression on gated (D) CD8⁺ and (E) CD4⁺ lymphocytes compared with mouse IgG1 isotype control mAb. The treatment group specifically represents lymphocytes co-cultured with RV-pulsed MoDCs, whereas the control represents lymphocytes cultured in the absence of MoDCs. Abbreviations: MODCs = bovine monocyte-derived dendritic cells; FMO = fluorescent minus one; RV = rabies vaccine. This figure has been modified from Kangethe et al., 2018¹¹. Please click here to view a larger version of this figure.

Figure 7: Flow cytometry data analysis of Ki-67 and CD25 expression by CD4⁺ and CD8⁺ lymphocytes after priming with the antigen. Ki-67 and CD25 expression from day 16 co-culture. The treatment group (specific) is defined as lymphocytes cultured with RV-pulsed MoDCs; the non-specific group corresponds to lymphocytes cultured with non-antigen-pulsed MoDCs; the control group corresponds to lymphocytes cultured without MoDCs. The horizontal bars represent the mean of six technical replicates. (A) Intracellular expression of the Ki-67 marker by CD8 T cells and (B) by CD4 T cells. (C) Cell surface expression of the CD25 marker by CD8 T cells and (D) by CD4 T cells. Abbreviations: MODCs = bovine monocyte-derived dendritic cells; RV = rabies vaccine. This figure has been modified from Kangethe et al., 2018¹¹. Please click here to view a larger version of this figure.

Figure 8: Th1 marker (IFN-γ and Ki-67) activation by MoDCs primed with the rabies virus antigen, as detected through qPCR and ELISA. Data taken from one animal with six technical replicates. The horizontal bars represent the mean. Three PCR replicates shown as fold changes compared to naive lymphocytes after normalization with a GAPDH reference gene. (A) IFN-γ expression, (B) Ki-67 expression. (C) Comparison of IFN-γ secretion in the culture supernatant between three treatment groups, as detected by ELISA. The specific group is defined as lymphocytes cultured with RV-pulsed MoDCs; the non-specific group corresponds to lymphocytes cultured with non-antigen-pulsed MoDCs; the control group corresponds to lymphocytes cultured without MoDCs. Abbreviations: MODCs = bovine monocyte-derived dendritic cells; RV = rabies vaccine. This figure has been modified from Kangethe et al., 2018¹¹. Please click here to view a larger version of this figure.

Reagents	Final Concentration	Volume Per reaction
dNTPs Mix (10 mM)	1,000 µM	1 µL
Random Hexamer Primers (50 ng/µL)	25 µM	1 µL
RNA template	0.1 – 1 µg/µL	χ µL (as required)
RNAse Free water	-	χ µL (as required)
Final Reaction Volume	-	10 µL

Table 1: Master mix composition (RNA primer mix).

Reagents	Final Concentration	Volume Per reaction
RT buffer 10x	1x	2 µL
MgCl2 25 mM	5 mM	4 µL
DTT 0.1 M	10 mM	2 µL
RNAse inhibitor 40 U/µL	2 U	1 µL

Table 2: The 2x PCR reaction mix. Abbreviations: RT = reverse transcriptase; DTT = dithiothreitol.

Cytokine	Species	Accession Number		Sequence			Length	Tm
IFN-γ	Bos taurus	FJ263670		F- GTGGGCCTCTCTTCTCAGAA			234	80.5
				R- GATCATCCACCGGAATTTGA
Ki-67	Bos taurus	XM_015460791.2		F-AAGATTCCAGCGCCCATTCA			148	86.5
				R-TGAGGAACGAACACGACTGG
GAPDH	Bos taurus	Sassu et al., 2020		F-CCTGGAGAAACCTGCCAAGT			214	85.5
				R-GCCAAATTCATTGTCGTACCA

Table 3: Primer sets used for amplification⁵⁰.

Reagents	Final Concentration	Volume Per reaction
Supermix	1x	5 µL
Forward Primer (5 µM)	250/ 125 nM	1 µL
Reverse Primers (5 µM)	250/ 125 nM	1 µL
cDNA 1:10 diluted	1.25 ng	2 µL
Nuclease-free Water	-	1 µL
Final Reaction Volume	-	10 µL

Table 4: qPCR master mix

Tube No.	Concentration of Standard		Serial Dilution
1	50 ng/mL		50 µL of standard + 350 µL of wash buffer
2	12.5 ng/mL		150 µL from tube 1 + 450 µL of wash buffer
3	6.25 ng/mL		250 µL from tube 2 + 250 µL of wash buffer
4	3.13 ng/mL		250 µL from tube 3 + 250 µL of wash buffer
5	1.56 ng/mL		250 µL from tube 4 + 250 µL of wash buffer
6	0.78 ng/mL		250 µL from tube 5 + 250 µL of wash buffer
7	0.2 ng/mL		150 µL from tube 6 + 450 µL of wash buffer
8	0.1 ng/mL		250 µL from tube 7 + 250 µL of wash buffer
9	0.025 ng/mL		100 µL from tube 8 + 300 µL of wash buffer

Table 5: IFN-γ standard dilution series

Supplementary File 1: Protocols for the synthesis of complementary DNA, real-time quantitative polymerase chain reaction (qPCR), and enzyme-linked immunosorbent assay (ELISA). Please click here to download this File.

Supplementary Figure S1: The antigen uptake ability MoDCs with different concentrations of the cytokine cocktail and with 3 days or 5 days of culture. Different concentrations (5% w/v and 3% w/v) of the cytokine cocktail containing GM-CSF and IL-4 were tested either with 3 days or 5 days of culture to assess the best combination to generate high-performance antigen uptake MoDCs (using the tracer molecule FITC-dextran). Please click here to download this File.

Supplementary Figure S2: CD4 and CD8 priming with diptheria toxoid (DT) and Bluetongue virus serotype 4 (BTV). The expression of Ki-67 by CD8 cells after pulsing with (A) DT and (C) BTV and the expression of Ki-67 by CD4 cells after pulsing with (B) DT and (D) BVT at day 16. Comparisons were made with cultures pulsed with DT and BVT (specific), (C,D) with CD40L, and with non-specific priming and control treatments. The horizontal bars indicate the mean. *p < 0.05, **p < 0.01 according to a Mann-Whitney test. Please click here to download this File.

Discussion

This study demonstrates a standardized in vitro method for generating and phenotyping bovine MoDCs and their subsequent use in measuring the vaccine immunogenicity of a commercial vaccine (e.g., RV). Bovine MoDCs can be used as a tool for screening potential vaccine antigens against cattle diseases and predicting their potential clinical impact based on immune responses before proceeding toward in vivo animal trials. The MoDCs generated were identified based on their morphological, phenotypic, and functional characteristics. We showed that the MoDCs derived from cattle CD14⁺ monocytes exhibited features seen in DCs, such as extended dendrites, the expression of cell surface markers for antigen presentation such as MHC II, the expression of co-stimulatory molecules on MoDCs such as CD40 and CD86, endocytic activity, and the ability to activate naive lymphocytes.

The cell culture media used in this experiment (DMEM and RPMI) are widely used for cell differentiation and cultivation, with RPMI being more frequently adopted for monocyte differentiation³⁶. RPMI supplementation with either FBS or HS (horse serum) does not affect monocyte differentiation³⁷. Recombinant GM-CSF and IL-4 supplementation provides an inflammatory condition that triggers monocyte differentiation and is routinely used for the production of functionally viable MoDCs capable of antigen uptake and presentation to immune cells^38,39. In this study, RPMI 1640 medium supplemented with 10% FBS (complete culture medium), 1% penicillin-streptomycin, and the addition of a commercially available cytokine cocktail (GM-CSF plus IL-4) induced bovine monocyte differentiation, resulting in the production of viable MoDCs. When the generated MoDCs were incubated with RV before co-culturing with naive lymphocytes, they induced a T cell-dependent immune response specific against RV, proving that mature MoDCs can adequately present RV antigens to lymphocytes that have never come across RV. This is a crucial characteristic of adaptive immunity that we can now replicate in the lab.

We observed that a higher concentration of cytokine cocktail (5%) coupled with a longer incubation time (5 days) produced MoDCs with lower endocytic ability for antigen uptake than those treated with a lower concentration of cytokine cocktail (3%) with the same incubation time (5 days), as shown in Supplementary Figure S1. Hence, we conclude that a lower concentration of cytokine cocktail (e.g., 3%) with 5 days of incubation is optimal to produce functionally potent MoDCs. Cell surface markers such as MHC II, CD40, and CD86 are present on APCs, and their upregulation indicates functional cell activation^40,41,42. We demonstrated enhanced expression of MHC II, CD40, and CD86 after monocyte differentiation into naive MoDCs using the cytokine cocktail (Figure 4).

Optimizing the ratio of naive lymphocytes and MoDCs in a culture system is a key factor that influences the outcome of the MoDC assay, with different MoDC to lymphocyte ratios inducing varied lymphocyte responses⁴³. However, after evaluating MoDC to lymphocyte ratios of 1:10-1:40, we observed that increasing the concentration of MoDCs did not increase the lymphocyte activation, and we eventually settled on an optimal ratio of 1:20, which is similar to previously reported studies^44,45. It should be noted that the eluted naive lymphocyte fraction might contain non-specifically activated T cells; therefore, it is imperative to have a control group corresponding to only naive lymphocyte culture.

Activated CD4⁺ and CD8⁺ T cells express specific markers and secrete a variety of cytokines, and their quantification indicates immune activation. The intracellular expression of Ki-67, a well-characterized immune activation marker, was upregulated in this MoDC-lymphocyte co-culture^29,46. Similarly in this study, the enhanced IFN-γ secretion by lymphocytes indicated a Th1 response elicited against the RV antigen^30,31,47. IL-2 expression by CD4⁺ T cells is also a good marker for visualizing T cell activation; however, its incorporation on day 9 of the MoDC-lymphocyte co-culture made it an unsuitable target for measuring lymphocyte proliferation for this study⁴⁸. The upregulation of CD25 in the presence of IL-2 has been previously shown to determine the priming of both CD4⁺ and CD8⁺ T cells and was used in this study to measure the priming of naive lymphocytes by RV-pulsed MoDCs²⁸.

Cytotoxic CD8 T cells are major effector cells against intracellular vaccine antigens or viral pathogens⁴⁹. By measuring lymphocyte activation markers (Ki-67 and CD25) and cytokine expression (IFN-γ), we found that the antigen-loaded MoDCs had significant (p < 0.01) activation of both CD8 and CD4 T cell responses, with the CD8 response and Th1 polarization being more prevalent against the RV antigen. An important factor that needs to be considered when designing an MoDC assay for adjuvant-conjugated vaccines is adjuvant-induced lymphocyte responses. We recommend using a control group (adjuvant control) composed of only adjuvant to eliminate any background signals. This setup can also be used to measure the effect of different adjuvants that can amplify lymphocyte responses toward a low-immunogenic antigen, which is crucial for protection during in vivo studies.

There are some limitations in this study that we want to highlight. The experimental data for each assay were derived from a single animal with six technical replicates. Having a larger number of biological replicates would be beneficial to minimize errors and provide enhanced statistical reliability and results with higher accuracy. Nevertheless, in a previous publication¹¹, this assay was also tested and validated using a diptheria toxoid (Supplementary Figure S2A,B) and a commercial vaccine against Bluetongue virus serotype 4 (Supplementary Figure S2C,D) with three and two biological animals, respectively. Furthermore, comparing the results obtained from this in vitro study with an in vivo study would help to additionally validate the authenticity of this immune assay, which, in turn, would accelerate the process of implementation of this in vitro MoDC assay as a routine test in vaccine production and quality control. Lastly, the expression of CD14 in MoDCs was not investigated, as the literature is inconsistent regarding this aspect, especially when comparing MoDCs from different animal species.

In conclusion, we report an in vitro bovine MoDC assay that can be used to measure vaccine-induced immunogenicity. This MoDC assay can also be evaluated using various methods, including flow cytometry, ELISA, and qPCR. Having multiple methods for evaluating activation markers is crucial in areas with limited resources where a flow cytometer may not be readily available. This assay can be included as a quality control step by national veterinary laboratories that produce large batches of bovine vaccines. In addition, it can be used to identify potential vaccine antigens during the development of new bovine vaccines and even to select which adjuvant to use before an animal trial. All these factors will contribute toward a more ethical and affordable approach to developing and using bovine vaccines.

Materials

Name	Company	Catalog Number	Comments
ACK Lysing Buffer	Gibco, Thermo Fisher	A1049201	Ammonium-Chloride-Potassium buffer for lysis of residual RBCs in harvested PBMC Fraction
BD Vacutainer Heparin Tubes	Becton, Dickinson (BD) and Company	366480	10 mL, additive sodium heparin 158 USP units, glass tube, 16 x 100 mm size
Bovine Dendritic Cell Growth Kit	Bio-Rad, UK	PBP015KZZ	Cytokine cocktail composed of recombinant bovine IL-4 and GM-CSF
Bovine IFN-γ ELISA Kit	Bio-Rad	MCA5638KZZ	Kit use for measuring IFN-γ expression in culture supernatant
CD14 Antibody	Bio-Rad	MCA2678F	Mouse anti-bovine CD14 monoclonal antibody, clone CC-G33, isotype IgG1
CD25 Antibody	Bio-Rad	MCA2430PE	Mouse anti bovine CD25 monoclonal antibody, clone IL-A11, isotype IgG1
CD4 Antibody	Bio-Rad	MCA1653A647	Mouse anti bovine CD4 monoclonal antibody, clone CC8, isotype IgG2a
CD40 Antibody	Bio-Rad	MCA2431F	Mouse anti-bovine CD40 monoclonal antibody, clone IL-A156, isotype IgG1
CD8 Antibody	Bio-Rad	MCA837F	Mouse anti bovine CD8 monoclonal antibody, clone CC63, isotype IgG2a
CD86 Antibody	Bio-Rad	MCA2437PE	Mouse anti-bovine CD86 monoclonal antibody, clone IL-A190, isotype IgG1
CFX96 Touch Real-Time PCR Detection System	Bio-Rad	-	Thermal cycler PCR machine
Corning Centrifuge Tube	Falcon Corning	352096 & 352070	15 mL and 50 mL, high-clarity poypropylene conical bottom, graduated, sterial, seal screw cap, falcon tube
Cytofix/Cytoperm Plus	BD Bio Sciences	555028	Fixation/permeabilization kit with BD golgiPlug, use for flow cytometer cell staining
Ethanol	Sigma Aldrich	1009832500	Absolute for analysis EMSURE ACS,ISO, Reag. Ph Eur
Fetal Bovine Serum (FBS)	Gibco, Thermo Fisher	10500064	Qualified, heat inactivated
Ficoll Plaque PLUS	GE Health care Life Sciences, USA	341691	Lymphocyte-isolation medium
FlowClean Cleaning Agent	Beckman Coulter, Life Sciences	A64669	500 mL
FlowJo	FlowJo, Becton, Dickinson (BD) and Company, LLC, USA	-	Flow cytometer Histogram software
FlowTubes/ FACS  (Fluorescence-activated single-cell sorting) Tube	Falcon Corning	352235	5 mL, sterial, round bottom polystyrene test tube with cell strainer snap cap, use in flow cytometry analysis
Fluoresceinisothiocynat-Dextran	Sigma Aldrich, Germany	60842-46-8	FITC-dextran MW
Gallios Flow Cytometer	Beckman Coulter	-	Flow cytometer machine
Hard-Shell 96-Well PCR Plates	Bio-Rad	HSP9601	96 well, low profile, thin wall, skirted, white/clear
Human CD14 MicroBeads	Miltenyi Bioteck, Germany	130-050-201	2 mL microbeads conjugated to monoclonal anti-human CD14 antibody isotype IgG2a, used for selection of bovine monocytes from PBMCs
Kaluza	Beckman Coulter, Germany	-	Flow cytometer multicolor data analysis software
MACS Column	Miltenyi Bioteck, Germany	130-042-401	Magnetic activated cell sorting or immune magentic cell separation colum for separation of various CD14 cell population based on cell surface antigens
MHC Class II DQ DR Polymorphic Antibody	Bio-Rad	MCA2228F	Mouse anti-sheep MHC Class II DQ DR Polymorphic:FITC, clone 49.1, isotype IgG2a, cross reactive with bovine
Microcentrifuge Tube	Sigma Aldrich	HS4325	1.5 mL, conical bottom, graduated, sterial tube
Microsoft Power Point	Microsoft	-	The graphical illustrations of experimental design
Mouse IgG1 Negative Control:FITC for CD14, CD40 Antibody	Bio-Rad	MCA928F	Isotype control CD14 and CD40 monoclonal antibody
Mouse IgG1 Negative Control:PE for CD86 Antibody	Bio-Rad	MCA928PE	Isotype control CD86 monoclonal antibody
Mouse IgG1 Negative Control:RPE for CD25 Antibody	Bio-Rad	MCA928PE	Isotype control CD25 monoclonal antibody
Mouse IgG2a Negative Control:FITC for MHC Class II Antibody	Bio-Rad	MCA929F	Isotype control for MHC class II monoclonal antibody
Nobivac Rabies	MSD Animal Health, UK	-	1 µL/mL of cell cultured inactivated vaccine containing > 2 I.U./mL Rabies virus strain
Optical seals	Bi0-Rad	TCS0803	0.2 mL flat PCR tube 8-cap strips, optical, ultraclear, compatible for qPCR machine
Penicillin-Streptomycin	Gibco, Thermo Fisher	15140122	100 mL
Phosphate Buffer Saline (PBS)	Gibco, Thermo Fisher	10010023	pH 7.4, 1x concentration
Prism - GraphPad 5 Software	Dotmatics	-	Statistical software
Purified Anti-human Ki-67 antibody	Biolegend, USA	350501	Monoclonal antibody, cross reactive with cow, clone ki-67
Purified Mouse IgG1 k Isotype Ctrl Antibody	Biolegend	400101	Isotype control for Ki-67 monoclonal antibody
READIDROP Propidium Iodide	BD Bio Sciences	1351101	Live/dead cell marker used for flow cytometry, amine reactive dye
Recombinant Human IL-2 Protein	R&D System, USA	202-IL-010/CF	Interleukin-2, 20 ng/ml
RNeasy Mini Kit	Qiagen	74106	Kit use for extraction of total RNA; RLT buffer = lysis buffer; RW1 buffer = stringent guanidine-containing washing buffer; RDD buffer = DNase buffer; RPE buffer = mild wash buffer; RNaseOUT = RNase inhibitor.
RPMI 1640 Medium	Sigma Aldrich	R8758	Cell culture media with L-glutamine and sodium bicarbonate
SMART-servier medical art	Les Laboratories Servier	-	Licensed under a creative commons attribution 3.0 unported license
SsoAdvanced Universal SYBR Green Supermix	Bio-Rad	172-5270	2x qPCR mix conatins dNTPs, Ss07d fusion polymerase, MgCl2, SYBR Green I supermix = supermix, ROX normalization dyes.
SuperScript III First-Strand Synthesis System	Invitrogen, Thermo Fisher	18080051	Kit for cDNA synthsis
Tissue Culture Test plate 24	TPP, Switzerland	92024	24 well plate, sterilized by radiation , growth enhanced treated, volume 3.18 mL
Trypan Blue Solution	Gibco, Thermo Fisher	15250061	0.4%, 100 mL, dye to assess cell viability
UltraPure DNase/RNase-Free Distilled Water	Invitrogen, Thermo Fisher	10977023	0.1 µm membrane filtered distilled water
VACUETTE Heparin Blood Collection Tubes	Thermo Fisher Scientific	15206067	VACUETTE Heparin Blood Collection Tubes have a green top and contain spray-dried lithium, sodium or ammonium heparin on the inner walls and are usedin clinical chemistry, immunology and serology. The anticoagulant heparin activates antithrombin, which blocks the clotting cascade and thus produces a whole blood/plasma sample.
Water	Sigma Aldrich	W3500-1L	Sterile-filtered, bioReagent suitable for cell culture