Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

التنبؤ الإشتخدام HIV-1 Coreceptor (Tropism) من خلال تحليل تسلسل الوراثي باستخدام نهج

doi: 10.3791/3264 Published: December 1, 2011

Summary

مطلوب التنبؤ استخدام coreceptor HIV-1 من أجل إدارة فئة جديدة من العقاقير المضادة للفيروسات، أي الخصوم coreceptor. لا يمكن أن يؤديها من خلال تحليل تسلسل

Abstract

Maraviroc (MVC) هو أول من المخدرات المضادة للفيروسات القهقرية المرخصة من فئة مضادات coreceptor. أنه يربط إلى المضيف coreceptor CCR5، والذي يستخدم من قبل غالبية سلالات فيروس نقص المناعة البشرية من أجل تصيب خلايا المناعة البشري (الشكل 1). العزلات الأخرى فيروس نقص المناعة البشرية تستخدم coreceptor مختلفة، CXCR4. مستقبلات التي تستخدم، يتم تحديد في الفيروس عن طريق البروتين بيئية (الشكل 2). اعتمادا على coreceptor المستخدمة، وتصنف الفيروسات وR5 أو X4، على التوالي. MVC يربط لمستقبلات CCR5 منع دخول الفيروسات R5 في الخلية المستهدفة. أثناء المرض، قد الفيروسات X4 تظهر وتتفوق على الفيروسات R5. تحديد الاستخدام coreceptor (وتسمى أيضا tropism) وبالتالي إلزامية قبل إدارة MVC، كما طالب EMA وFDA.

وقد أجريت دراسات لتحفيز كفاءة MVC، MERIT و 1029 مع حرف واحد فقط من الفحص Trofile، سان فرانسيسكو، الولايات المتحدة الأمريكية هذا الفحص عالية الجودة على أساس sophiاختبارات المؤتلف sticated. قبول لهذا الاختبار للالروتين اليومي منخفضة بدلا من خارج الولايات المتحدة الأمريكية، منذ الأوروبية الأطباء يميلون بدلا المختبرات للعمل مع الخبراء اللامركزية، التي توفر أيضا ما يصاحب ذلك اختبار المقاومة. خضعت هذه المختبرات العديد من التقييمات ضمان الجودة، وكان آخرها عرض في 2011 1.

لعدة سنوات الآن، لقد أجرينا قرارات tropism على أساس تحليل تسلسل فيروس نقص المناعة البشرية من المنطقة الجينات الحياة الفطرية-V3 (V3) 2. هذه المنطقة يحمل ما يكفي من المعلومات لإجراء التنبؤ موثوق بها. تحديد النمط الجيني من استخدام coreceptor يقدم مزايا مثل: دوران وقت أقصر (أي ما يعادل اختبار المقاومة)، وتخفيض التكاليف، وإمكانية لتكييف النتائج مع احتياجات المرضى وإمكانية تحليل العينات السريرية مع الحمل الفيروسي منخفضة جدا لا يمكن الكشف عنها أو حتى (VL )، لاسيما وأن عدد العينات التي تم تحليلها مع VL <1000 نسخة / ميكرولترزيادة تقريبا في السنوات الأخيرة (الشكل 3).

أظهرت الخطوات الرئيسية لاختبار tropism (الشكل 4) في هذا الفيديو:

1. جمع عينة الدم
2. عزل RNA فيروس نقص المناعة البشرية من / فيروس نقص المناعة البشرية والبلازما أو DNA من خلايا الدم proviral حيدات النوى
3. التضخيم في المنطقة ENV
4. التضخيم في المنطقة V3
5. رد فعل تسلسل AMPLICON V3
6. تنقية العينات التسلسل
7. تسلسل العينات النقية
8. تسلسل التحرير
9. التسلسل تفسير البيانات والتنبؤ tropism

Protocol

وتتلخص البروتوكول في الشكل. 4.

1. جمع عينات الدم

  1. جمع لا يقل عن 3 ملليتر دم في أنابيب EDTA في موقع السريرية.
  2. ويمكن تخزين العينات تصل إلى أسبوع في C. ° 4
  3. إرسال عينات الدم EDTA في أقرب وقت ممكن إلى المختبر عن طريق البريد العادي.

2. عزل / فيروس نقص المناعة البشرية وRNA DNA أو

  1. الحصول على RNA الفيروسي و / أو DNA من الدم كله ميكرولتر 1000، المصل أو البلازما، وذلك باستخدام الصرفة الاتفاق ماجنا عزل الأحماض النووية I I عدة وماجنا نظام مدمج البحتة.
  2. أزل الحمض النووي الريبي DNA أو اكتسبت في 50 ميكرولتر العازلة TE. وبدلا من ذلك، يمكن استخدام الأحماض النووية الأخرى تنقية الإجراءات.

3. التضخيم في المنطقة ENV

تضخيم المنطقة الحياة الفطرية (الشكلان 2 و 4) من البلازما أو RNA DNA proviral. A 1245 BP-طويلة المنتج، وتضم أغلبية من البروتين بيئية (6556-7811 NT accordinيتم إنشاء لHXB2 ز).

  1. عينات الحمض النووي الريبي: RT-PCR تفاعل
    1. RNA الفيروسي ويعرض هيكل معقد جدا الثانوي (الشكل 4) التي قد تعوق التفاعل RT. لتجنب هذه المشكلة، احتضان 10 ميكرولتر الحمض النووي الريبي في C ° 65 لمدة 10 دقائق (بالفعل في أنبوب PCR في الجهاز وPCR) ومن ثم تقليل درجة الحرارة إلى 50 درجة مئوية.
    2. اضافة 40 ميكرولتر من مزيج ماجستير PCR بما في ذلك الاشعال بيئية و-F R-بيئية.

      ماجستير ميكس لRT-PCR وعلى النظم البيت:
      <TD> 2
      حجم / رد فعل (ميكرولتر) تركيز النهائي
      ريبونوكلياز خالية H 2 O 14،4
      5X العازلة (QIAGEN OneStep RT-PCR كيت) 10 1X
      Q-5X الحل 10 1X
      dNTP ميكس (10 ملم لكل منهما) 400 ميكرومتر كل dNTP
      انزيمات-ميكس (QIAGEN OneStep RT-PCR كيت) 2
      التمهيدي ENV-F (100 ميكرومتر) 0.3 0،6 ميكرومتر
      التمهيدي بيئية-R (100 ميكرومتر) 0.3 0،6 ميكرومتر
      ريبونوكلياز المانع (RNasin) 1 5 وحدات / رد فعل


      ENV-F: 5'-CAAAGCCTAAAGCCATGTGTAAA -3 "(NT 6556 → 6586 وفقا لHXB2)

      ENV-R: 5'-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 "(NT 7785 ← 7811)
    3. تشغيل في رد فعل RT C ° 50 لمدة 30 دقيقة.
    4. تشغيل PCR الأول على النحو التالي:

      95 ° C، 15min 1 ×
      95 ° C، 30 ثانية
      50 ° C، 30 ثانية
      72 ° C، 2 دقيقة 1 ×
      95 ° C، 30 ثانية
      56 ° C، 30 ثانية
      72 ° C، 2 دقيقة
      38 ×
      72 ° C، 10 دقيقة
      4 ° C ∞
  2. عينات من الحمض النووي: PCR تفاعل

    لعينات من الحمض النووي proviral، ليس هناك حاجة إلى رد فعل RT الأولية، وردود الفعل PCR يمكن أن تبدأ مباشرة.
    1. اضافة 40 ميكرولتر من مزيج ماجستير PCR إلى 10 ميكرولتر من الحمض النووي provial.


      ماجستير ميكس عن PCR داخل منظومة مجلس النواب:
      حجم / رد فعل (ميكرولتر) تركيز النهائي
      ريبونوكلياز خالية H 2 O 15،4
      5X العازلة (HotStarTaq البلمرة DNA) 10 1X
      Q-5X الحل 10 1X
      dNTP ميكس (10 ملم لكل منهما) 2 400 ميكرومتر كل dNTP
      انزيمات-ميكس (HotStarTaq البلمرة DNA) 2
      التمهيدي ENV-F (100 ميكرومتر) 0.3 0،6 ميكرومتر
      التمهيدي بيئية-R (100 ميكرومتر) 0.3 0،6 ميكرومتر


      ENV-F: 5'-CAAAGCCTAAAGCCATGTGTAAA -3 "(NT 6556 → 6586)

      ENV-R: 5'-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 "(NT 7785 ← 7811)
    2. تشغيل ظروف PCR كما هو موضح سابقا لعينات الحمض النووي الريبي (الخطوة 3.1.4).

4. التضخيم في المنطقة V3: PCR المتداخلة

  1. لPCR المتداخلة، استخدم 5 ميكرولتر من رد الفعل PCR الأولى (دون التحليل السابق في هلام الاغاروز) كقالب وإضافة 95 ميكرولتر من ماس PCRمزيج ثالثا.

    ميكس الرئيسية للمتداخلة-PCR في منزل
    حجم / رد فعل (ميكرولتر) تركيز النهائي
    H 2 O 61،9
    10X العازلة PCR 10 1X
    Q-5X الحل 20 1X
    dNTP ميكس (10 ملم لكل منهما) 2 200 ميكرومتر كل dNTP
    ENV-2F التمهيدي (100 ميكرومتر) 0.3 0،6 ميكرومتر
    التمهيدي ENV-2R (100 ميكرومتر) 0.3 0،6 ميكرومتر
    HotStarTaq DNA البلمرة 0.5 2،5 وحدة / رد فعل


    ENV-2F: 5'-GTCCAAAGGTATCCTTTGAGCCAATTC -3 "(NT 6838 → 6864)

  2. تشغيل PCR على النحو التالي:

    93 ° C، 15min
    1 ×
    95 ° C، 30 ثانية
    50 ° C، 30 ثانية
    72 ° C، 90 ثانية
    1 ×
    95 ° C، 30 ثانية
    56 ° C، 30 ثانية
    72 ° C، 90 ثانية
    43 ×
    72 ° C، 10 دقيقة
    4 ° C ∞
  3. تحليل المنتج PCR على هلام الاغاروز٪ 1 (الشكل 4). المنتج هو المتوقع BP-902 طويلة.
  4. تنقية العينات التسلسل.
    1. تنقية المنتج PCR PCR مع عدة لتنقية QIAGEN، وذلك باستخدام بروتوكول والحلول والأعمدة الصغيرة المقدمة من قبل المورد. أزل في 30-100 العازلة ميكرولتر PE، اعتمادا على شدة الفرقة.
    2. وبدلا من ذلك، يمكن تنقية العينات باستخدام نوكلياز خارجيةI وسريعة AP (القلوية الفوسفاتيز الحرارية). لهذا الغرض، إضافة 6 ميكرولتر إكسو-AP ميكس المنتج PCR إلى 15 ميكرولتر واحتضان 15 دقيقة عند 37 ° C.
      580 ميكرولتر H 2 O
      AP 66 ميكرولتر سريع
      13،4 إكسو ميكرولتر I

5. رد فعل تسلسل AMPLICON V3

  1. رد الفعل تسلسل يتكون من رد فعل PCR باستخدام واحد فقط من الاشعال التالية:

    ENV-2: 5'-GTACAATGYACACATGGAATTAGGC -3 (NT 6959 → 6980)
    ENV-5: 5'-AAAATTCCCCTCCACAATTA - 3 "(NT 7352 ← 7371)
    ENV-6: 5'-GGCCAGTAGTATCAACTCAAC - 3 "(NT 6979 → 7000)
    ENV-7: 5'-TGTCCACTGATGGGAGGGGC - 3 "(NT 7530 ← 7549)
    ENV-10: 5 '- GCAGAATAAAACAAATTATAAACATGTGGC - 3 "(NT 7478 ← 7507)
    الحياة الفطرية-11: 5 '- TACATTGCTTTTCCTACTTTCTGCCAC - 3 "(NT 7638 ← 7664)
    الاشعال الخيار الأول هي:-2 بيئية، بيئية أو بيئية-6-7، بيئية-11
  2. استخدم 1 ميكرولتر من AMPLICON V3 تنقية كقالب وأضف 9 ميكرولتر من PCR MASTER-المزيج.

    التسلسل ماجستير ميكس:
    4 ميكرولتر مزيج تسلسل (HIV-التنميط الجيني كيت)
    4 ميكرولتر H 2 O
    1 ميكرولتر التمهيدي (100 بمول / ميكرولتر)
  3. تشغيل تسلسل رد الفعل على النحو التالي:
    96 ° C، 10 ثانية
    50 ° C، 10 ثانية 36 ×
    60 ° C، و 45 ثانية
    4 ° C ∞

6. تنقية العينات التسلسل

تنقية تسلسل USIنانوغرام Sephadex G-50 رقيق.

  1. ملء العدد المناسب من الآبار في "محمل العمود" مع رقيق Sephadex G-50. نقل Sephadex إلى لوحة MAHVN4510 الفلترة من تسليم.
  2. إضافة 300 ميكرولتر الملة-Q H 2 O إلى كل بئر في لوحة التصفية، وذلك لاحتضان ما لا يقل عن 3H في 2-8 درجة C.
  3. أجهزة الطرد المركزي لوحات لمدة 5 دقائق في 910Xg و4-15 درجة مئوية. تجاهل التدفق من خلال.
  4. إضافة 10 ميكرولتر H 2 O على المنتج ومن ثم تسلسل تسلسل الماصة على لوحة Sephadex تضخم.
  5. للحصول على المنتج المنقى، لوحة أجهزة الطرد المركزي لمدة 5 دقائق. في 910Xg و4-15 ° C وجمع التدفق من خلال.

7. تسلسل العينات النقية على التسلسل ABI XL 3130 بريزم

  1. قبل كل تشغيل، تغيير المخزن المؤقت والتحقق من حجم البوليمر (POP7). إذا لزم الأمر، استبدال قارورة البوليمر القديمة بأخرى جديدة.
  2. استخدام ظروف التشغيل المحفوظة، بما في ذلك الوقت 18 ثانية من الحقن.
  3. في هذا الجهاز، وجمع البيانات إشارة واحدة المدى مع عينات تسلسل يستغرق حوالي 16 60 دقيقة (36 سم الشعرية) أو 150 دقيقة (50 سم الشعرية).

8. تسلسل التحرير

  1. استخدام برنامج Lasergene (DNA النجوم) لمواءمة وتعديل تسلسل (الشكل 5). ويمكن استخدام برامج أخرى تسلسل التحرير. استخدام "V3 توافق الآراء B" وتسلسل الآراء الحياة الفطرية والمراجع.
  2. Lasergene يخلق سلسلة من العينة توافق تحليلها باستخدام كافة البيانات الخام المتوفرة وتخزينها في ملف FASTA. الملف FASTA هو ملف نصي يتضمن رأس مع اسم العينة وتسلسل النوكليوتيدات.

9. التسلسل تفسير البيانات والتنبؤ tropism

  1. التسلسل تفسير البيانات يتم تنفيذها بواسطة نظام الترجمة الشفوية على شبكة الإنترنت geno2pheno [coreceptor] ( http://coreceptor.bioinf.mpi-inf.mpg.de/index.php). للتنبؤ tropism، يمكن تحديد إعدادات مختلفة FPR. الإعداد الافتراضي هو وفقا للمبادئ التوجيهية العلاج الألمانية النمساوية. ل٪ 20 ≥ FPR، وتصنف الفيروس كما R5 عندما FPR ≥ 20٪ وX4 ل٪ 12،5 FPR <.
  2. تحميل الملف FASTA إلى الملقم. هذا الخادم يترجم تسلسل النوكليوتيدات إلى أحماض أمينية، تؤيد ذلك مع تسلسل B V3 التشاور وتنتج تصنيف فرعي. وبالإضافة إلى ذلك، فإنه يولد التنبؤ استخدام coreceptor (الشكل 4) أعرب حيث بلغ معدل إيجابية كاذبة (FPR).

10. ممثل النتائج

وgeno2pheno [coreceptor] ناتج يظهر تفسير متدرج من tropism. اعتمادا على احتمال استخدام coreceptor، تفسير النص ولون الخلفية يختلف من الأخضر (<20٪ FPR)، مما يشير إلى إدارة آمنة للMVC، إلى الأصفر، مما يشير إلى ممكن، منخفضة المخاطر، وأخيرا إلى اللون الأحمر. الأحمر هو لون يوحيجي لا ان تفرض MVC. وبالإضافة إلى ذلك، يقوم الخادم بإنشاء تقرير PDF التي يمكن طباعتها، وشغل في مع المريض ونموذج البيانات، وإرسالها إلى الطبيب. وصفت أمثلة من الناتج geno2pheno [coreceptor] في الشكل. 6.

الشكل 1
الرقم. 1. النسخ المتماثل التخطيطي فيروس نقص المناعة البشرية. يجب أن الفيريون ربط مستقبلات CD4 الخليوي، وإما إلى CCR5 أو CXCR4 كما coreceptor. يمكن حظر CCR5 coreceptor مع الخصوم CCR5 مثل Maraviroc (MVC، Celsentri، Selzentry). بعد الانصهار في الأغشية الخلوية والفيروسية، يتم تحرير قفيصة منواة الفيروسية في السيتوبلازم. وقفيصة منواة يفكك ومجمع RNA الفيروسي يتحرر في السيتوبلازم. والناسخ العكسي الفيروسية (RT) المحاضر الحمض النووي الريبي DNA الجيني في proviral، أن يتم نقل بعد ذلك إلى نواة ودمجها في الجينوم المضيف من فيروس نقص المناعة البشرية integrase. بلمرة RNA الخلوية هيئة تنظيم الاتصالاتnscribe الجيني الفيروسي والرناوات رسول من الجينوم proviral. ويتم إنتاج البروتينات الفيروسية في السيتوبلازم ونقلها إلى سطح الخلية. مهدها جزيئات الفيروس غير ناضجة وغير المعدية virions، من الخلايا. الأنزيم البروتيني فيروس نقص المناعة البشرية البروتينات المنتجة يشق لجزيئات معدية. تثبيط واحدة من الخطوات يؤدي إلى انقطاع دورة النسخ المتماثل.

يتم وضع علامة على العقاقير المضادة للفيروسات والخطوة النسخ المتماثل التي تمنع أنهم باللون الأحمر.

يتم وضع علامة على RNA DNA الفيروسي وproviral (المواد المستخدمة لتحليل tropism أو المقاومة) باللون الأخضر.

الشكل 2
الشكل 2. فيروس نقص المناعة البشرية الجينوم proviral. تم بناء الجسيمات فيروس نقص المناعة البشرية مع البروتينات الهيكلية المختلفة والإنزيمات المختلفة والمنازل على حد سواء البروتينات الفيروسية من أصل والخلوية. عرض الرقمليالي الموقع من الجينات داخل الجينوم الفيروسي. بروتينات سطح gp120 وgp41 تشكل المسامير على سطح الفيريون والاتصال الخلية البشرية لأداء الانصهار الغشاء. في الجزء السفلي من الشكل، تظهر منتجات التضخيم PCR وبادئات المستخدمة في بروتوكول لدينا.

الشكل 3
الشكل 3. نسبة المرضى الذين يعانون من انخفاض الحمل الفيروسي (VL) القياسات تحليلها لمقاومة المخدرات أو قرار tropism في معهد علم الفيروسات في جامعة كولونيا (ألمانيا).

الشكل 4
الشكل 4. عموما مخطط التجربة .. يرجى النقر هنا لرؤية نسخة أكبر من هذا الرقم.

الشكل 5
الشكل 5. تسلسل التحرير مع Lasergene. والتسلسل وAMPLICON V3 مع واحد على الأقل واحدة إلى الأمام عكس التمهيدي. Lasergene alignes و". أبي" ملفات تم الحصول عليها من التسلسل مع الإشارة متواليات "B-V3 توافق" والحياة الفطرية. Lasergene يخلق تسلسل الآراء باستخدام كافة البيانات المتوفرة الصف. يمكن أن تكون علامة على تسلسل المرجعية (ثم يتم عرضها باللون الرمادي) بحيث لا تساهم في العينة تسلسل الآراء.

الشكل 6
الشكل 6. تقارير التنبؤ Tropism التي تم إنشاؤها بواسطة geno2pheno [coreceptor] يتم إنشاء تقارير tool.The على ملفات PDF التي يمكن حفظها ويتم الانتهاء منها في الكمبيوتر. يمكن بيانات إضافية مثل اسم المريض لنا، وتاريخ استخراج الدم، وما إلى ذلك، تضمنت يدويا باستخدام برنامج PDF الكاتب. ويمكن أيضا إضافة تعليقات محددة. تسابيانات ه هي حصرا على جهاز الكمبيوتر الخاص بالمستخدم وليس على الخادم geno2pheno [coreceptor]. يرجى النقر هنا لرؤية نسخة أكبر من هذا الرقم.

Discussion

تسلسل V3 يسمح موثوقة التنبؤ tropism الفيروسية، كما هو مبين في الدراسات السريرية 3-9. في الواقع، يتم التفكير في تحديد النمط الجيني في المبادئ التوجيهية الحالية الأوروبي والألماني النمساوي-10.

مقارنة اختبار المظهري، وليس فقط هي المرة دوران أقصر (أي ما يعادل اختبار المقاومة)، ولكن أيضا هي التكاليف. وبالإضافة إلى ذلك، والميزة الرئيسية لاختبار الوراثي هو أن يتم تصنيف النتائج على النحو FPR، وبالتالي يمكن أن تتكيف مع احتياجات المرضى. النتائج Trofile، من ناحية أخرى، هي ببساطة R5 X4 أو التقارير، والتي لا تعطى الوصول إلى البيانات الخام.

حاليا، فإن المبادئ التوجيهية الأوروبية تشير إلى FPR القطع من 20٪ 10، في حين أن المبادئ التوجيهية النمساوية الألمانية تسمح بتكييف FPR قطع خصيصا لاحتياجات كل مريض 11. في هذا الخط، للمرضى مع مجموعة واسعة من الخيارات العقاقير المضادة للفيروسات، وارتفاع FPR انقطاع (> 20٪) هي موصىانتهى. وعلى العكس، قد يكون استخداما لمرحلة ما قبل المعالجة المرضى الذين يعانون من الخيارات العلاجية محدودة، وانخفاض FPR انقطاع (> 5٪). هذا النوع من العلاج هو التوجيه المستمر حاليا من قبل المقاومة لاختبار NRTIs، NNRTIs، حزب القانون والعدالة، وINIS، حيث يمكن أن تدرج أدوية جزئيا الناشطة في علاج المرضى الذين يعانون من انخفاض الخيارات العلاجية. وبالإضافة إلى ذلك، مع تزايد أعداد التغييرات العلاج genotypically موجهة، وذات الصلة سريريا FPR باستمرار انقطاع يجري تعديل من قبل لجنة من الفيروسات، bioinformaticians والأطباء.

ميزة أخرى هامة من الاختبار الوراثي tropism هو إمكانية تحليل العينات السريرية مع الحمل الفيروسي منخفضة جدا لا يمكن الكشف عنها أو حتى (VL). في هذه الحالات، عندما البلازما RNA ليس amplifiable، يمكن التسلسل الحمض النووي proviral وتستخدم لتنبؤات موثوقة 9،12. من ملاحظة، زاد عدد المرضى الذين يعانون من الحمل الفيروسي منخفضة أو غير قابل للكشف بشكل حاد في السنوات الأخيرة. وحتى الآن، TROFILE مقايسة يسمح فقط تحليل عينات من المرضى الذين يعانون من VL <1000 نسخة / مل. ومع ذلك، فقد أظهرت الدراسات الأولية أن الحمض النووي يمكن proviral adecuate أيضا لفحصها من قبل Trofile 13.

Disclosures

ويرعى هذه المادة الفيديو عن طريق الرعاية الصحية وجلاكسو سميث كلاين فييف.

Acknowledgments

وتمول الكتاب من كورس، MedSys إدخال خلية، CHAIN ​​والمشاريع راتين.

Materials

Name Company Catalog Number Comments
MagNA Pure Compact Nucleic Acid Isolation Kit I Roche Group 04 802 993 001
MagNA Pure Compact System Roche Group 03731146001
T3000 Thermocycler Biometra 050-723
One Step RT-PCR Kit Qiagen 210215
HotStarTaq Master Mix Kit Qiagen 203445
QIAquick PCR Purification Kit Qiagen 28106
Exonuclease I (Exo I) Fermentas EN0582
FastAP Thermosensitive Alkaline Phosphatase Fermentas EF0651
BigDye Terminator v3.1 Cycle Sequencing Kit Applied Biosystems 4337457
Sephadex G-50 Superfine GE Healthcare 17-0041-01
ABI Prism 3130 XL capillary sequencer Applied Biosystems 3130XL

DOWNLOAD MATERIALS LIST

References

  1. Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. European coreceptor proficiency panel test. 9th European Workshop on HIV & Hepatitis Treatment Strategies & Antiviral Drug Resistance, Paphos, Cyprus, (2011).
  2. Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. Bioinformatic prediction of HIV coreceptor usage. Nature Biotech. 25, (12), 1407-1410 (2007).
  3. McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial. 17th Conference on Retroviruses and Opportunistic Infections, San Francisco, USA, (2010).
  4. Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice. Eur. J. Med. Res. 15, (6), 231-237 (2010).
  5. Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study. Antimicrob. Agents. Chemother. 54, (8), 3335-3340 (2010).
  6. Swenson, L. C., Knapp, D., Harrigan, P. R. Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype. 10th International Congress on Drug Therapy in HIV Infection, Glasgow, UK, (2010).
  7. Macartney, M. J., Cameron, J., Strang, A., García, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice. 8th European HIV Drug Resistance Workshop, Sorrento, Italy, (2010).
  8. Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., Fätkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. Tropism determination and clinical outcome of 61 patients under MVC treatment. 8th European HIV Drug Resistance Workshop, Sorrento, Italy, (2010).
  9. Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., Köppe, S., üünsche, T., Berg, T., Baumgarten, A. Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort. 8th European HIV Drug Resistance Workshop, Sorrento, Italy, (2010).
  10. Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. European guidelines on the clinical management of HIV-1 tropism testing. Lancet Infect Dis. 11, (5), 394-407 (2011).
  11. Walter, H., Eberle, J., Möller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing). (2011).
  12. Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., Köppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort. Journal of the International AIDS Society. 13, Suppl . 4. 129-129 (2010).
  13. Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples. 18th Conference on Retroviruses and Opportunistic Infections, San Francisco, USA, (2010).
التنبؤ الإشتخدام HIV-1 Coreceptor (Tropism) من خلال تحليل تسلسل الوراثي باستخدام نهج
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sierra, S., Kaiser, R., Lübke, N., Thielen, A., Schuelter, E., Heger, E., Däumer, M., Reuter, S., Esser, S., Fätkenheuer, G., Pfister, H., Oette, M., Lengauer, T. Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach. J. Vis. Exp. (58), e3264, doi:10.3791/3264 (2011).More

Sierra, S., Kaiser, R., Lübke, N., Thielen, A., Schuelter, E., Heger, E., Däumer, M., Reuter, S., Esser, S., Fätkenheuer, G., Pfister, H., Oette, M., Lengauer, T. Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach. J. Vis. Exp. (58), e3264, doi:10.3791/3264 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter