Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Predicción del VIH-1 usos correceptor (tropismo) por análisis de secuencia utilizando un enfoque genotípica

doi: 10.3791/3264 Published: December 1, 2011

Summary

La predicción del uso del correceptor del VIH-1 es necesaria para la administración de una nueva clase de fármacos antirretrovirales, es decir, antagonistas de correceptores. Se puede realizar por análisis de la secuencia de la

Abstract

Maraviroc (MVC) es el primer fármaco antirretroviral con licencia de la clase de los antagonistas de correceptores. Se une a la acogida del correceptor CCR5, que es utilizado por la mayoría de las cepas de VIH con el fin de infectar a las células inmunes humanas (Fig. 1). Otros aislados de VIH utilizar un co-receptor diferente, el CXCR4. Receptor que se utiliza, se determina en el virus por la proteína Env (Fig. 2). Dependiendo del correceptor utilizado, los virus se clasifican como R5 o X4, respectivamente. MVC se une al receptor CCR5 inhibiendo la entrada de virus R5 en la célula diana. Durante el curso de la enfermedad, los virus X4 pueden surgir y superar los virus R5. Determinación del uso del correceptor (también llamado tropismo) es por tanto obligatoria antes de la administración de MVC, según lo exigido por EMA y FDA.

Los estudios de eficacia MVC MOTIVAR, MERIT y 1029 se han realizado con el ensayo Trofile de Monogram, San Francisco, EE.UU. Se trata de un ensayo de alta calidad basado en sophisticated pruebas recombinantes. La aceptación de esta prueba para la rutina diaria es bastante baja fuera de los EE.UU., ya que los médicos europeos que tienden a trabajar con laboratorios especializados descentralizados, que también proporcionan pruebas de resistencia concomitante. Estos laboratorios han sido objeto de varias evaluaciones de control de calidad, la última que se presenta en 2011 1.

Desde hace varios años, se han realizado determinaciones de tropismo sobre la base de análisis de secuencias del VIH env-V3 región del gen (V3) 2. Esta región lleva la información suficiente para realizar una predicción fiable. La determinación genotípica del uso del correceptor presenta ventajas tales como: tiempo de rotación corta (equivalente a las pruebas de resistencia), reducir los costos, la posibilidad de adaptar los resultados a las necesidades de los pacientes y la posibilidad de analizar muestras clínicas con carga viral muy baja o incluso indetectable (VL ), sobre todo porque el número de muestras analizadas con CV <1000 copias / laproximadamente aumentado en los últimos años (Fig. 3).

Los pasos principales para las pruebas de tropismo (Fig. 4) demuestra en este vídeo:

1. Recolección de una muestra de sangre
2. El aislamiento del ARN de VIH a partir del plasma y / o ADN proviral del VIH a partir de células mononucleares de sangre
3. La amplificación de la región env
4. La amplificación de la región V3
5. Secuencia de reacción de la amplificación V3
6. La purificación de las muestras de secuenciación
7. La secuenciación de las muestras purificadas
8. Secuencia de edición
9. Secuenciación interpretación de los datos y la predicción tropismo

Protocol

El protocolo se resume en la figura. 4.

1. Colección de muestras de sangre

  1. Recoge al menos 3 ml de sangre en tubos con EDTA en el centro clínico.
  2. Las muestras se pueden almacenar hasta por una semana a 4 ° C.
  3. Envíe las muestras de sangre con EDTA, lo antes posible al laboratorio por correo ordinario.

2. Aislamiento de ARN de VIH y / o ADN

  1. Obtener ARN viral y / o de ADN de 1000 l de sangre entera, suero o plasma, utilizando el MagNA Pure Aislamiento compacto Nucleic Acid I kit I y el MagNA Pure sistema compacto.
  2. Eluir el ganado ARN o ADN en 50 l de tampón TE. Alternativamente, otros procedimientos de purificación de ácidos nucleicos pueden ser utilizados.

3. La amplificación de la región env

Amplificar la región env (Figs. 2 y 4) o bien a partir de plasma de ARN o ADN proviral. A 1245 bp de largo producto, que comprende la mayoría de la proteína Env (nt 6556-7811 according a HXB2) se genera.

  1. RNA de muestras: RT-PCR
    1. Viral ARN presenta una estructura secundaria muy complejo (Fig. 4) que puede dificultar la reacción de RT. Para evitar este problema, incubar 10 ARN mu l a 65 ° C durante 10 minutos (ya en el tubo de PCR y PCR en la máquina) y luego reducir la temperatura a 50 ° C.
    2. Añadir 40 l de la mezcla maestra de PCR incluyendo los cebadores Env-F y R-Env.

      Master Mix para la RT-PCR In-House-System:
      <td> 2
      volumen / reacción (l) concentración final
      RNasa libre de H 2 O 14,4
      Tampón 5x (Qiagen OneStep RT-PCR Kit) 10 1x
      5x Q-Solution 10 1x
      dNTP Mix (10 mM cada uno) 400 mM de cada dNTP
      Enzym-Mix (Qiagen OneStep RT-PCR Kit) 2
      Primer Env-F (100 mM) 0,3 0,6 mM
      Primer Env-R (100 M) 0,3 0,6 mM
      Inhibidor de RNasa (RNasin) 1 5 unidades / reacción


      Env-F: 5'-3 '(CAAAGCCTAAAGCCATGTGTAAA nt 6556 → 6586 de acuerdo con HXB2)

      Env-R: 5'-3 '(AGTGCTTCCTGCTGCTCCTAAGAACCC nt 7785 ← 7811)
    3. Ejecutar la reacción RT a 50 º C durante 30 minutos.
    4. Ejecutar la primera PCR de la siguiente manera:

      95 ° C, 15min 1 x
      95 ° C, 30 seg
      50 ° C, 30 seg
      72 ° C, 2 min 1 x
      95 ° C, 30 seg
      56 ° C, 30 seg
      72 ° C, 2 min
      38 x
      72 ° C, 10 min
      4 ° C ∞
  2. Las muestras de ADN PCR: reacción

    Para muestras de ADN proviral, no inicial de reacción de RT se necesita, y la reacción de PCR puede iniciar directamente.
    1. Añadir 40 l de PCR Master Mix a 10 l de ADN Provial.


      Master Mix para PCR In-House-System:
      volumen / reacción (l) concentración final
      RNasa libre de H 2 O 15,4
      Tampón 5x (Polimerasa HotStarTaq ADN) 10 1x
      5x Q-Solution 10 1x
      dNTP Mix (10 mM cada uno) 2 400 mM de cada dNTP
      Enzym-Mix (Polymerase HotStarTaq ADN) 2
      Primer Env-F (100 mM) 0,3 0,6 mM
      Primer Env-R (100 M) 0,3 0,6 mM


      Env-F: 5'-3 '(CAAAGCCTAAAGCCATGTGTAAA nt 6556 → 6586)

      Env-R: 5'-3 '(AGTGCTTCCTGCTGCTCCTAAGAACCC nt 7785 ← 7811)
    2. Ejecutar las condiciones de PCR descritas anteriormente para las muestras de ARN (Paso 3.1.4).

4. La amplificación de la región V3: PCR anidada

  1. Para la PCR anidada, utilizar 5 l de la primera reacción de PCR (sin análisis previo en gel de agarosa) como plantilla y añadir 95 l de PCR MasMezclar ter.

    Master Mix para Nested-PCR In-House
    volumen / reacción (l) concentración final
    H 2 O 61,9
    10x tampón PCR 10 1x
    5x Q-Solution 20 1x
    dNTP Mix (10 mM cada uno) 2 200 mM de cada dNTP
    Primer Env-2F (100 mM) 0,3 0,6 mM
    Primer Env-2R (100 M) 0,3 0,6 mM
    ADN Polimerasa HotStarTaq 0,5 2,5 unidades / reacción


    Env-2F: 5'-3 '(GTCCAAAGGTATCCTTTGAGCCAATTC nt 6838 → 6864)

  2. Ejecutar la PCR de la siguiente manera:

    93 ° C, 15min
    1 x
    95 ° C, 30 seg
    50 ° C, 30 seg
    72 ° C, 90 seg
    1 x
    95 ° C, 30 seg
    56 ° C, 30 seg
    72 ° C, 90 seg
    43 x
    72 ° C, 10 min
    4 ° C ∞
  3. Analizar el producto de PCR en un gel de agarosa al 1% (Fig. 4). El producto esperado es 902 bp de largo.
  4. La purificación de las muestras de secuenciación.
    1. Se purifica el producto de PCR con el Qiagen PCR kit de purificación, utilizando el protocolo, soluciones y columnas micro-suministrado por el proveedor. Eluir en 30-100 l tampón PE, en función de la intensidad de la banda.
    2. Alternativamente, las muestras pueden purificarse usando ExonucleasaI y Fast AP (Thermo fosfatasa alcalina). Para este propósito, añadir 6 l Exo-AP Mix a 15 l de producto de PCR y se incuba 15 minutos a 37 ° C.
      580 l H 2 O
      66 l rápido AP
      13,4 l I Exo

5. Secuencia de reacción de la amplificación V3

  1. La secuencia de reacción consiste en una reacción de PCR usando sólo uno de los cebadores siguientes:

    Env-2: 5'-GTACAATGYACACATGGAATTAGGC -3 (nt 6959 → 6980)
    Env-5: 5'-AAAATTCCCCTCCACAATTA - 3 '(nt 7352 ← 7371)
    Env-6: 5'-GGCCAGTAGTATCAACTCAAC - 3 '(nt 6979 → 7000)
    Env-7: 5'-TGTCCACTGATGGGAGGGGC - 3 '(nt 7530 ← 7549)
    Env-10: 5 '- GCAGAATAAAACAAATTATAAACATGTGGC - 3' (nt 7478 ← 7507)
    Env-11: 5 '- TACATTGCTTTTCCTACTTTCTGCCAC - 3' (nt 7638 ← 7664)
    Cebadores de primera elección son: Env-2, Env-6 o 7-Env, Env-11
  2. Usar 1 l del amplicón V3 purificado como molde y añadir 9 l de mezcla maestra de PCR.

    Secuenciación Mix Master:
    4 mix secuencia l (VIH-Genotipado Kit)
    4 l H 2 O
    1 Primer l (100 pmol / l)
  3. Ejecutar la secuencia de reacción como sigue:
    96 ° C, 10 seg
    50 ° C, 10 seg 36 x
    60 ° C, 45 seg
    4 ° C ∞

6. La purificación de las muestras de secuenciación

Purificar secuencias using Sephadex G-50 superfino.

  1. Rellene el número adecuado de pozos en el "cargador columna" con Sephadex G-50 superfino. Transferir el Sephadex al MAHVN4510 placa de filtro, girando de nuevo.
  2. Añadir 300 l Milli-Q H 2 O a cada pocillo de la placa de filtro, y se incuba durante al menos 3 horas a 2-8 º C.
  3. Centrifugar las placas durante 5 min a 910Xg y 4-15 ° C. Desechar el flujo a través.
  4. Añadir 10 l de H 2 O para el producto secuencia y luego pipeta de la secuencia de la placa se hinchó Sephadex.
  5. Para obtener el producto purificado, se centrifuga la placa durante 5 min. a 910Xg y 4-15 ° C y se recoge el flujo a través.

7. La secuenciación de las muestras purificadas en el secuenciador ABI Prism 3130 XL

  1. Antes de cada ejecución, cambiar el tampón y comprobar el volumen del polímero (POP7). Si es necesario, reemplazar el matraz polímero viejo por uno nuevo.
  2. Utilice las condiciones de ejecución guardados, incluyendo un tiempo de inyección de 18 segundos.
  3. En esta máquina, la recopilación de los datos de la señal de un ensayo con 16 muestras de la secuencia tarda aproximadamente 60 min (36 cm capilar) o 150 min (50 cm capilar).

8. Secuencia de edición

  1. Utilice el programa Lasergene (ADN-Star) para alinear y editar las secuencias (Fig. 5). Otros programas de edición de secuencias puede ser utilizado. Use un "Consenso V3-B" y la secuencia de consenso env como referencias.
  2. Lasergene crea una secuencia de consenso de la muestra analizada utilizando todos los datos disponibles primas y almacenarlo como archivo FASTA. El archivo FASTA es un archivo de texto que incluye un encabezado con el nombre de la muestra y la secuencia de nucleótidos.

9. Secuenciación interpretación de los datos y la predicción tropismo

  1. Secuenciación interpretación de los datos se realiza por el sistema de interpretación basado en la web geno2pheno [correceptor] ( http://coreceptor.bioinf.mpi-inf.mpg.de/index.php). Para la predicción de tropismo, diferentes ajustes de IPA pueden ser seleccionados. La configuración por defecto es de acuerdo a las directrices de terapia alemana-austriaca. Para FPR ≥ 20%, el virus se clasifica como R5 cuando FPR ≥ 20% y X4 para FPR <12,5%.
  2. Cargue el archivo FASTA en el servidor. Este servidor traduce la secuencia de nucleótidos en aminoácidos, lo alinea con la secuencia consenso de V3-B y produce una clasificación subtipo. Además, se genera una predicción del uso del correceptor (Fig. 4) expresado como tasa de falsos positivos (FPR).

10. Los resultados representativos

El geno2pheno [correceptor] salida muestra una interpretación nivelada de la tropismo. En función de la probabilidad de que el uso del correceptor, el texto de la interpretación y el color de fondo varía de verde (FPR <20%), lo que sugiere una administración segura para MVC, al amarillo, lo que sugiere un posible riesgo, bajo y finalmente a rojo. El rojo es el color sugierenING no prescribir MVC. Además, el servidor genera un informe pdf que se puede imprimir, se rellenó con paciente y datos de la muestra, y se envía al médico. Ejemplos de geno2pheno salida [correceptor] se representan en la figura. 6.

Figura 1
Figura. 1. Esquema de la replicación del VIH. El virión debe de unirse a las células CD4 celulares como receptor, y bien en el CCR5 o CXCR4 como correceptor. El correceptor CCR5 puede bloquearse con antagonistas del CCR5 maraviroc (MVC como, Celsentri, Selzentry). Después de la fusión de las membranas viral y celular, la nucleocápside viral se libera en el citoplasma. La nucleocápside desmonta y el complejo ARN viral se libera en el citoplasma. La transcriptasa inversa viral (RT) transcribe el ARN genómico en ADN proviral, que después se transporta al núcleo y se integra en el genoma del huésped por la integrasa del VIH. RNA polimerasas celulares transcribe genómico viral y ARN mensajeros a partir del genoma proviral. Las proteínas virales se produce en el citoplasma y se transportan a la superficie celular. Las partículas de virus brote como inmaduras, no infecciosas viriones de las células. La proteasa del VIH escinde las proteínas productoras de partículas infecciosas. La inhibición de uno de los pasos conduce a una interrupción del ciclo de replicación.

Los medicamentos antirretrovirales y el paso que inhiben la replicación están marcados en rojo.

El ARN viral y el ADN proviral (material utilizado para el análisis de tropismo o resistencia) están marcadas en verde.

Figura 2
Figura 2. Genoma proviral del VIH. La partícula de VIH está construido con diferentes proteínas estructurales y casas de varias enzimas y de proteínas, tanto de origen viral y celular. El programa figuras la localización de los genes en el genoma viral. La superficie de las proteínas gp120 y gp41 constituyen los puntos en la superficie del virión y en contacto con la célula humana para llevar a cabo la fusión de la membrana. En la parte inferior de la figura, los productos de amplificación de PCR y los cebadores utilizados en el protocolo se muestran.

Figura 3
Figura 3. Proporción de pacientes con baja carga viral (CV) mediciones analizadas para resistencia a las drogas o la determinación de tropismo en el Instituto de Virología de la Universidad de Colonia (Alemania).

Figura 4
Figura 4. Esquema general del experimento .. Por favor haga clic aquí para ver una versión más grande de esta cifra.

Figura 5
Figura 5. Secuencia de edición con Lasergene. El amplicón V3 se secuencia con al menos un avance y un cebador inverso. Lasergene alignés los "abi". Archivos obtenidos desde el secuenciador con la referencia de secuencias "Consenso V3-B" y env. Lasergene crea una secuencia de consenso con todos los datos de fila disponibles. Las secuencias de referencia puede ser marcado (y luego se muestran en gris) a fin de que no contribuyen a la secuencia de consenso de la muestra.

La figura 6
Figura 6. Informes tropismo de predicción generados por el geno2pheno [correceptor] tool.The informes se generan en formato pdf que se pueden guardar y terminado en el ordenador. Datos adicionales de nombres tales paciente nos, la fecha de extracción de sangre, etc, pueden ser incluidos de forma manual utilizando un programa de grabación de pdf. Observaciones específicas pueden ser también añadido. These Los datos se encuentran exclusivamente en el ordenador del usuario y no en el servidor geno2pheno [correceptor]. Por favor haga clic aquí para ver una versión más grande de esta cifra.

Discussion

La secuencia V3 permite una predicción fiable tropismo viral, tal como se muestra en los estudios clínicos 3-9. De hecho, la determinación genotípica se contempla en las directrices actuales Europeas y el alemán austriaco-10.

En comparación con la prueba fenotípica, no sólo es el tiempo de rotación más corta (equivalente a la prueba de resistencia), pero también son los costes. Además, una ventaja importante de la prueba genotípica es que los resultados se clasifican como FPR y por lo tanto se puede adaptar a las necesidades de los pacientes. Resultados Trofile, por otro lado, son simplemente informes R5 o X4, y el acceso a los datos en bruto no se da.

En la actualidad, las directrices europeas sugieren un FPR de corte del 20 al 10%, mientras que las directrices austriaco-alemanas permiten la adaptación del FPR de corte específicamente a las necesidades de cada paciente 11. En esta línea, en pacientes con una amplia gama de opciones de medicamentos antirretrovirales, mayor FPR puntos de corte (> 20%) son recomterminado. A la inversa, para la reducción de pacientes tratados previamente con opciones terapéuticas limitadas, inferior FPR cut-off (> 5%) puede ser utilizado. Este tipo de orientación es la terapia actualmente en curso por el análisis de resistencia a los NRTI, NNRTI, IP, y INIS, donde los fármacos parcialmente activos pueden ser incluidos en el tratamiento de pacientes con reducción de las opciones terapéuticas. Además, con el creciente número de cambios de terapia genotípicamente guiadas, la clínica relevante FPR cortes son constantemente ajustados por un grupo de bioinformáticos, virólogos y médicos.

Otra ventaja importante de la prueba de tropismo genotípico es la posibilidad de analizar muestras clínicas con carga viral muy baja o incluso indetectable (VL). En estos casos, cuando el plasma de ARN no es amplificable, el ADN proviral puede ser secuenciado y utilizado para predicciones fiables 9,12. Es de destacar que el número de pacientes con carga viral baja o indetectable ha aumentado considerablemente en los últimos años. Hasta la fecha, el Terfil ensayo sólo permite el análisis de muestras de pacientes con CV <1000 copias / ml. Sin embargo, estudios preliminares han demostrado que el ADN proviral se puede también Adecuar a ser probado por Trofile 13.

Disclosures

Este artículo es patrocinado por vídeo ViiV Healthcare y GlaxoSmithKline.

Acknowledgments

Los autores se financian con el Corus, Inscripción MedSys celular, cadena y proyectos de Resina.

Materials

Name Company Catalog Number Comments
MagNA Pure Compact Nucleic Acid Isolation Kit I Roche Group 04 802 993 001
MagNA Pure Compact System Roche Group 03731146001
T3000 Thermocycler Biometra 050-723
One Step RT-PCR Kit Qiagen 210215
HotStarTaq Master Mix Kit Qiagen 203445
QIAquick PCR Purification Kit Qiagen 28106
Exonuclease I (Exo I) Fermentas EN0582
FastAP Thermosensitive Alkaline Phosphatase Fermentas EF0651
BigDye Terminator v3.1 Cycle Sequencing Kit Applied Biosystems 4337457
Sephadex G-50 Superfine GE Healthcare 17-0041-01
ABI Prism 3130 XL capillary sequencer Applied Biosystems 3130XL

DOWNLOAD MATERIALS LIST

References

  1. Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. European coreceptor proficiency panel test. 9th European Workshop on HIV & Hepatitis Treatment Strategies & Antiviral Drug Resistance, Paphos, Cyprus, (2011).
  2. Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. Bioinformatic prediction of HIV coreceptor usage. Nature Biotech. 25, (12), 1407-1410 (2007).
  3. McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial. 17th Conference on Retroviruses and Opportunistic Infections, San Francisco, USA, (2010).
  4. Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice. Eur. J. Med. Res. 15, (6), 231-237 (2010).
  5. Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study. Antimicrob. Agents. Chemother. 54, (8), 3335-3340 (2010).
  6. Swenson, L. C., Knapp, D., Harrigan, P. R. Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype. 10th International Congress on Drug Therapy in HIV Infection, Glasgow, UK, (2010).
  7. Macartney, M. J., Cameron, J., Strang, A., García, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice. 8th European HIV Drug Resistance Workshop, Sorrento, Italy, (2010).
  8. Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., Fätkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. Tropism determination and clinical outcome of 61 patients under MVC treatment. 8th European HIV Drug Resistance Workshop, Sorrento, Italy, (2010).
  9. Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., Köppe, S., üünsche, T., Berg, T., Baumgarten, A. Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort. 8th European HIV Drug Resistance Workshop, Sorrento, Italy, (2010).
  10. Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. European guidelines on the clinical management of HIV-1 tropism testing. Lancet Infect Dis. 11, (5), 394-407 (2011).
  11. Walter, H., Eberle, J., Möller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing). (2011).
  12. Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., Köppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort. Journal of the International AIDS Society. 13, Suppl . 4. 129-129 (2010).
  13. Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples. 18th Conference on Retroviruses and Opportunistic Infections, San Francisco, USA, (2010).
Predicción del VIH-1 usos correceptor (tropismo) por análisis de secuencia utilizando un enfoque genotípica
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sierra, S., Kaiser, R., Lübke, N., Thielen, A., Schuelter, E., Heger, E., Däumer, M., Reuter, S., Esser, S., Fätkenheuer, G., Pfister, H., Oette, M., Lengauer, T. Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach. J. Vis. Exp. (58), e3264, doi:10.3791/3264 (2011).More

Sierra, S., Kaiser, R., Lübke, N., Thielen, A., Schuelter, E., Heger, E., Däumer, M., Reuter, S., Esser, S., Fätkenheuer, G., Pfister, H., Oette, M., Lengauer, T. Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach. J. Vis. Exp. (58), e3264, doi:10.3791/3264 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter