This protocol describes an experimental procedure for the rapid construction of artificial transcription factors (ATFs) with cognate GFP reporters and quantification of the ATFs ability to stimulate GFP expression via flow cytometry.
Method Article
* These authors contributed equally
This protocol describes an experimental procedure for the rapid construction of artificial transcription factors (ATFs) with cognate GFP reporters and quantification of the ATFs ability to stimulate GFP expression via flow cytometry.
Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the structure of native control circuits. In both cases, the ability to program gene expression in a rapid and tunable fashion, with no off-target effects, can be useful. We have constructed yeast strains containing the ACT1 promoter upstream of a URA3 cassette followed by the ligand-binding domain of the human estrogen receptor and VP16. By transforming this strain with a linear PCR product containing a DNA binding domain and selecting against the presence of URA3, a constitutively expressed artificial transcription factor (ATF) can be generated by homologous recombination. ATFs engineered in this fashion can activate a unique target gene in the presence of inducer, thereby eliminating both the off-target activation and nonphysiological growth conditions found with commonly used conditional gene expression systems. A simple method for the rapid construction of GFP reporter plasmids that respond specifically to a native or artificial transcription factor of interest is also provided.
Developing genetic switches in yeast is of great interest in both academic and industrial research. In the ideal case, genetic switches can be used to activate a particular gene (or set of genes) only when desired by the experimenter. A gene's coding sequence placed downstream of a synthetic promoter is not expressed in the absence of an inducing molecule: upon inducer addition the gene should be rapidly expressed. It has only recently been demonstrated that such a switch can be engineered in yeast, where in the absence of inducer, the strain displays a deletion phenotype, but in the presence of inducer, expression is activated in proportion to the level of inducer in all cells1,2. Historically, conditional expression systems in yeast have relied heavily upon nutrient-responsive DNA sequences, including the MET, PHO, and GAL promoters (whose activities are sensitive to extracellular levels of methionine, phosphate, and galactose, respectively). While conditional expression can be achieved, it comes at the cost of significant pleiotropic effects.
Hormone receptors such as the human estrogen receptors have proven to be effective switches in eukaryotes3,4. In the absence of hormone, a protein fused to a hormone receptor can be sequestered in the cytoplasm where it interacts with the Hsp90 chaperone complex. Upon binding the appropriate ligand, the receptor undergoes a conformational change, causing it to be released from the Hsp90 chaperone complex and revealing a nuclear localization signal. To observe the localization dynamics of a particular hormone receptor-containing protein, we created a C-terminal fusion of Gal4dbd.ER.VP16 (GEV, a synthetic transcription factor containing the Gal4p DNA binding domain, the ligand binding domain of the human estrogen receptor, and VP16) with GFP2. Nuclear localization was observed within 8 min following addition of saturating amounts of the inducer, ß-estradiol, to which wild type yeast is completely inert. By this time, the majority of cells have clearly visible active transcription sites for GEV target genes (assayed via fluorescence in situ hybridization) as well as fully mature mRNAs2,5. GEV target genes increased in expression >2-fold within 2.5 min2,6 (measured using microarrays), demonstrating that it takes <2.5 min for the chimeric activator to translocate to the nucleus, bind DNA, and activate transcription.
While several other on-switches have been applied in yeast that utilize various small molecules or drugs (including the classic doxycycline-based switches from Escherichia coli7,8 and an indigo-based switch9 from Arabidopsis thaliana), none have achieved the speed, specificity, or tightness of regulation exhibited by the hormone-based switches. It is worth mentioning that rapid off-switches have also been developed in yeast, and typically work by fusing a gene to a protease or ubiquitin ligase targeting sequence2,10,11,12. The ability to rapidly remove a target protein from the cell facilitates the study of essential genes as well as genes that are prone to genetic suppression when deleted10.
The methods described in this protocol are for building and characterizing synthetic on-switches in yeast. First, we show how to rapidly generate genomically-integrated fusion proteins consisting of a DNA binding domain of interest, the ligand binding domain of the human estrogen receptor, and VP16 (DBD-EV’s). Following our protocol, the fusion protein is expressed from an ACT1 promoter. We then show how to create a cognate reporter plasmid for the ATF and test its functionality using flow cytometry. Though we envision these reporter plasmids being used with new ATFs (Figure 1), they can be used as reporters for a native transcriptional activator as well. Finally, details for testing the effect of ATF activation on cell growth in 96-well plates and for engineering inducible genomic alleles are provided.
Figure 2 provides a schematic of protocol sections 1-3.
1. Creation of ATFs
2. Creation of ATF Plasmid Reporter
3. Quantify the Effect of ATF Induction on Gene Expression Using GFP Reporter
Preparing the samples:
4. Quantify the Effect of ATF Induction on Cell Growth
5. Create Inducible Genomic Alleles
Figure 5 shows induction of GFP by Z3EV, Z4EV, or GEV over time. Note the increase in GFP production in response to the ATFs containing nonyeast DNA binding domains. We recently speculated that this results from these factors achieving single-gene specificity in the yeast genome1. GEV induction alone leads to activation/repression of hundreds of genes, whereas Z3EV and Z4EV only activate expression of a target gene placed downstream of a synthetic promoter containing appropriate binding sites (5'-GCGTGGGCG-3' and 5'-GCGGCGGAGGAG-3', respectively)1. Figure 7 demonstrates the tight regulation of the system (no inducer results in no detectable GFP) and that all cells get induced in response to inducer The ability of Z3EV to induce GFP across a range of β-estradiol concentrations is shown in Figure 8.

Figure 1. Artificial transcription factors interact with Hsp90 in the absence of β-estradiol. When β-estradiol binds to the ATF, Hsp90 dissociates, allowing the ATF to enter the nucleus and activate expression from the plasmid reporter.

Figure 2. Schematic of protocol for engineering strains that contain artificial transcription factors and building/testing cognate GFP reporters.

Figure 3. The ACT1pr-URA3-EV sequence in the strain yMN15 at the LEU2 locus.

Figure 4. Design of PCR primers for amplifying a DNA binding domain of interest with additional sequence homology to generate a new fusion protein when successfully transformed into yMN15.

Figure 5. GFP induction by three different ATF-promoter pairs in response to 1 µM β-estradiol.

Figure 6. A MATLAB script for processing flow cytometry data. This script was adapted from http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data.

Figure 7. Induction of GFP by Z3EV in response to 0 µM β-estradiol and 1 µM β-estradiol following 18 hr of induction. Fluorescence was also measured from cells lacking GFP to illustrate the tight regulation of the Z3EV system. This figure was generated using the code in Figure 6.

Figure 8. The relationship between inducer concentration and expression output is graded with a Hill coefficient of ~1. (A) Distributions of GFP expression as a function of β-estradiol concentration. (B) The mean fluorescence of the distributions from (A). The data were fit to the function G(D) = Gmin + (Gmax−Gmin)Dn/(Kn+Dn) where D is the β-estradiol dose, Gmin and Gmax are the minimum and maximum GFP values, respectively, n is the Hill coefficient, and K is the β-estradiol dose that yields ½ (Gmax + Gmin).
| Oligonucleotide Sequence | Name |
| 5’-TTGAAACCA AACTCGCCTCT-3’ | DBD Check Forward |
| 5’-tccagagac ttcagggtgct-3’ | DBD Check Reverse |
Table 1. Primers for confirming correct fusion of DBD of interest to the Estrogen Receptor. The forward primer is homologous the ACT1 promoter and the reverse primer is homologous to the estrogen receptor. For Typical DBDs (~300 bp), the PCR product is <1.5 kb.
| Oligonucleotide Sequence | Name |
| 5'-ggccgc…DBD binging site... t-3' | Top oligo |
| 5’-ctaga…DNA binding site reverse…gc-3’ | Bottom oligo |
| 5'-gccgcGTGGGCGTGCGTGGGCGGG CGTGGGCGTGCGTGGGCGGGCGTG GGCGTGCGTGGGCGt-3' | Top oligo + 6x Zif268 Binding Sites |
| 5’-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3’ | Bottom oligo + 6x Zif268 Binding Sites |
Table 2. Structure of primers for creating dsDNA containing binding sites of interest. To create the Z3EV-responsive promoter, the oligonucleotides Top oligo + 6x Zif268 Binding Sites and Bottom oligo + 6x Zif268 Binding were used. Sequences for creating the correct DNA overhangs are in lowercase. The Zif268 consensus binding site, GCGTGGGCG, is underlined in the top oligo.
| Reagent | Amount |
| T4 Polynucleotide Kinase Buffer | 5 µl |
| T4 Polynucleotide Kinase (@10,000 units/ml) | 1 µl |
| Top oligo (100 µM) | 1.5 µl |
| Bottom oligo (100 µM) | 1.5 µl |
| Water | 41 µl |
Table 3. Phosphorylate and anneal primers in a thermocycler using 50 µl of reaction described above. There are two thermocycler steps. Step 1: 37 °C 30 min (Phosphorylate), and step 2: 95 °C 30 sec (step down 1 °C every 30 sec until at 4 °C; Anneal).
| Reagent | Amount |
| XbaI | 1 µl |
| NotI-HF | 1 µl |
| Plasmid DNA | 5 µl (1-2 µg) |
| 10x Cut Smart Buffer | 5 µl |
| Water | 38 µl |
Table 4. Restriction digest of plasmid pMN8 with XbaI and NotI.
| Reagent | Amount |
| T4 Ligase Buffer | 2 µl |
| T4 Ligase | 0.2 µl |
| Backbone @ 10 ng/µl | 1 µl |
| Binding Sequences@ 5x molar concentration/µl | 1 µl |
| Water | 15.8 µl |
Table 5. Ligate binding sites into plasmid DNA.
| Primer | Description |
| ~40 bp upstream of ATG + CGCACTTAACTTCGCATCTG-3’ | Forward primer for amplifying KanMX-Promoter |
| 5’- reverse complement(ATG + ~37bp) + TATAGTTTTTTCTCCTTGACG-3’ | Reverse primer for amplifying KanMX-Promoter |
| 5’-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3’ | Forward primer for making GCN4 promoter swap. |
| 5’-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3’ | Reverse primer for making GCN4 promoter swap. |
Table 6. PCR amplify KanMX-Promoter for making titratible allele.
The hormone-based switches described here have myriad applications, from studying native cell biology to testing the ability of a DNA binding domain of interest to target a DNA sequence in vivo. The system has many desirable features, including a graded response to inducer, fast action, and tight regulation (i.e. no measurable leakiness, see Figure 7). However, there is still room for improvement and expansion.
Recent work in synthetic biology has emphasized multiplexing synthetic systems and expanding the repertoire of well-characterized, programmable DNA parts16. Independent, conditional expression of distinct target genes requires both multiple inducers and DNA binding domains that lack overlapping specificity. The availability of engineered and naturally occurring receptors provides a large set of parts with which to develop new artificial transcription factors. Expanding the repertoire of mutually orthogonal switches has been greatly aided by directed evolution approaches17,18. Current efforts to reprogram the ligand-binding specificity of our artificial transcription factors will be presented in the future.
Previously, the phenotypic consequences of gene deletion/overexpression have been extensively studied in yeast19,20. However, it has not been straightforward to study the effect of expression on different phenotypes over a range of expression levels. A primary feature of the system presented herein is its graded nature (Figure 8). While often assumed, the relationship between gene expression and phenotypes of interest may not necessarily be monotonic. Artificial transcription factors such as Z3EV and Z4EV will make the task of assaying the phenotypic responses to changes in gene expression straightforward.
Finally, the protocols discussed in this manuscript are for engineering and characterizing artificial transcription factors that respond to β-estradiol; however, an important alternative to chemically responsive domains is the use of light-responsive domains (such as the PhyB/Pif3, LOV, and BLUF), whose activities are reversible without having to perturb the culture growth medium21-23. Light-based systems facilitate spatiotemporal control of gene expression, protein-protein interactions, ion transport, and enzymatic activity, which have already proven powerful21-26.
In conclusion, we have presented methods for the rapid construction of inducible, artificial transcription factors in yeast. This protocol provides a template for their construction in conjunction with cognate GFP reporters, as well as methods for analyzing the reporter data using flow cytometry and assaying the effect of ATF activation on growth.
McIsaac, Noyes, and Botstein (with others) have submitted part of this system as a Patent Disclosure.
R.S.M. acknowledges funding from the NSF Graduate Research Fellowship. M.B.N. acknowledges funding from a Lewis-Sigler Fellowship and the endowed gift of Peter Lewis. D.B. acknowledges funding from the NIH (GM046406) the National Institute of General Medical Sciences Center for Quantitative Biology (GM071508). We acknowledge Christina DeCoste for assistance with flow cytometry experiments.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Name of the Reagent | Company | Catalogue Number | Comments |
| Expand High Fidelity PCR System | Roche | 11 732 650 001 | |
| T4 DNA Ligase | NEB | M0202S | |
| Competent E. coli | Life Technologies | 18258-012 | |
| Estradiol | Tocris Biosciences | 2824 | |
| Ampicillin | Fisher Scientific | BP1760-5 | |
| T4 Polynucleotide Kinase | NEB | M0201 | |
| PBS | Life Technologies | 10010-23 | |
| Tween-20 | Sigma-Aldrich | 9005-64-5 | |
| clonNAT | Jena Bioscience | AB-102L | |
| XbaI | NEB | R0145S | |
| NotI-HF | NEB | R3189S | |
| CutSmart Buffer | NEB | B7204S | |
| Glucose | Fisher Scientific | D15-500 | |
| Bacto-Peptone | BD Biosciences | 211677 | |
| Yeast Extract | BD Biosciences | 210929 | |
| Agarose | BD Biosciences | 214010 | |
| 100% Ethanol | Decon Laboratories | 04-355-222 | |
| G418 | Life Technologies | 11811-031 | |
| QIAprep Spin Miniprep Kit | QIAGEN | 27104 | |
| Lithium acetate dihydrate | Sigma-Aldrich | L-6883 | |
| Salmon sperm DNA | Sigma-Aldrich | 93283 | |
| PEG 3350 | Sigma-Aldrich | P-3640 | |
| Plasmids pMN8 and pMN10; yeast strain yMN15 | Noyes or Botstein labs | ||
| Luria Broth | Sigma-Aldrich | L3397 | |
| EQUIPMENT: | |||
| LSRII Flow Cyometer | BD Biosciences | Various Models | |
| MATLAB or FlowJo | MATLAB or FlowJo | Software for analyzing .FCS files from flow cytometry experiments | |
| R | Open Source | For analyzing growth-rate data from plate reader. | |
| Falcon Tubes | BD Biosciences | 352052 | |
| 1.7 ml Eppendorf Tubes | GeneMate | C3262-1 | |
| 250 ml Shake Flasks | Corning | 4446-250 | |
| 96-well, flat-bottom plates | Costar | 3635 | |
| Plate Reader (Synergy H1 Multi-Mode Plate Reader) | BioTek | H1MG | |
| Breathe-Easy Membranes | Sigma-Aldrich | Z380059-1PAK | |
| Thermocycler | various companies | Various models | |
| SC-Ura powder | MP Biomedicals | 114410622 | |
| 5-FOA | Zymo Research | F9001-1 |
Request permission to reuse the text or figures of this JoVE article
Request Permission