Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Affinity-baserede Isolering af Tagged Kerner fra doi: 10.3791/51418 Published: March 25, 2014

Summary

Drosophila væv ofte indeholder en heterogen blanding af celletyper. For at undersøge genekspression i specifikke celletyper fra et bestemt væv, kan kerner genetisk mærkede og efterfølgende isoleret ved anvendelse af en affinitet tilgang. Isolerede kerner kan anvendes til efterfølgende anvendelser, såsom genekspression analyse og kromatin immunofældning.

Abstract

Drosophila melanogaster embryoner og larvernes væv indeholder ofte en stærkt heterogen blanding af celletyper, som kan komplicere analyse af gen-ekspression i disse væv. Således at analysere cellespecifikke genekspressionsprofiler fra Drosophila væv, kan det være nødvendigt at isolere specifikke celletyper med høj renhed og i tilstrækkelige udbytter for efterfølgende anvendelser såsom transkriptionelle profilering og kromatin immunofældning. Den uregelmæssige cellemorfologi i væv, såsom det centrale nervesystem, kombineret med den sjældne population af specifikke celletyper i disse væv, kan imidlertid være en udfordring for traditionelle celleisolering såsom laser mikrodissektion og fluorescens-aktiveret cellesortering (FACS) . Her er en alternativ metode til at karakterisere cellespecifikke genekspressionsprofiler hjælp affinitet baseret isolation af mærkede kerner snarere end hele celler, er beskrevet. Kerner i specifikke cell type interesse er genetisk mærket med en nuklear kuvert lokaliseret EGFP tag ved hjælp af Gal4/UAS binære udtryk system. Disse EGFP-mærkede kerner kan isoleres ved anvendelse af antistoffer mod GFP, der er koblet til magnetiske perler. Beskrevet i denne protokol fremgangsmåde giver ensartet isolering af kerner fra specifikke celletyper i Drosophila larvestadiet centralnervesystemet ved høj renhed og i tilstrækkelige niveauer til ekspression analyse, selv når disse celletyper omfatter mindre end 2% af den totale cellepopulation i væv. Denne fremgangsmåde kan anvendes til at isolere kerner fra en bred vifte af Drosophila embryo-og larvernes celletyper ved hjælp af særlige Gal4 drivere og kan være anvendelige til isolering af kerner fra celletyper, der ikke er egnet til FACS eller laser mikrodissektion.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila væv, såsom det centrale nervesystem indeholder en kompleks blanding af celletyper. Således at analysere cellespecifikke genekspressionsprofiler fra Drosophila væv, er det først nødvendigt at isolere en homogen population af specifikke celler i tilstrækkelige mængder til at muliggøre efterfølgende anvendelser. Metoder til at isolere celler fra intakte væv omfatter laser mikrodissektion og fluorescens-aktiveret cellesortering (FACS) af hele celler. Mens FACS er blevet anvendt til at isolere celler og kerner fra Drosophila embryoner og fra Caenorhabditis elegans til genekspression og kromatin profilering 1-3 kan FACS og laser mikrodissektion være vanskeligt at udføre med succes i væv, der indeholder stærkt blandede celletyper eller indeholder celler med uregelmæssig morfologi, såsom neuroner. For at overvinde denne vanskelighed kan kerner snarere end celler isoleres fra specifikke celletyper og anvendes til senere gene udtryk profilering. Vigtigere er det, microarray-baserede mRNA-ekspression analyse ved hjælp af stikprøver nukleare RNA generelt viser sammenlignelige resultater med at udføres ved hjælp af total RNA 4, 5. Desuden har genekspressionsanalyse ved hjælp af kerne-RNA med held blevet anvendt til at undersøge genekspression i flere organismer, herunder C. elegans, Arabidopsis thaliana, Drosophila, og mennesker 4, 5 2, 3.

Adskillige fremgangsmåder er for nylig blevet beskrevet til isolering af specifikke populationer af mærkede kerner fra Drosophila væv, der er egnet til genekspression analyse og / eller kromatin immunofældning. Det parti isolering af vævsspecifikke kromatin for immunudfældning (BITS-chip) metode udnytter FACS at isolere faste kerner på grundlag af celle-specifikke udtryk for nuklear-lokaliseret GFP 2. Denne fremgangsmåde har været successfully anvendt til at analysere fordelingen af histon modifikationer og transkriptionsfaktorer hjælp kromatin immunofældning af isolerede kerner fra mesoderm af Drosophila-embryoner 2. Dog kan FACS tilgange være mindre egnede til at isolere mærkede kerner, der kun udgør en lille del af en blandet population på grund af den øgede sortere nødvendige tid til at få passende tal for efterfølgende anvendelser. For at overvinde disse begrænsninger har flere grupper udnyttet affinitetsbaserede isoleringsmetoder at oprense kerner, der er mærket med en specifik epitop i en bestemt celletype. Isoleringen af kerner opmærket i specifikke celletyper (INTACT), der er udviklet til brug i Arabidopsis thaliana 6, 7 er for nylig blevet tilpasset til anvendelse i Drosophila 8. I denne metode, en fusion kernemembranen protein, der er et substrat for in vivo biotinylering er coexpressed med Escherichia coli biotin ligase BirA i bestemte celletyper. Biotin-mærkede kerner efterfølgende kan oprenses fra blandede populationer ved hjælp af streptavidin-baserede affinitet isolation. Med denne fremgangsmåde blev kerner held mærkes og isoleret fra mesoderm Drosophila embryoer, hvor en fusion kernemembranen protein blev udtrykt under kontrol af en mesoderm-specifik forstærker 8. Forfatterne genererede proteiner cellekernekappen fusionsproteiner, der kan udtrykkes i en hvilken som helst celletype under kontrol af Gal4 regulatorisk sekvens, UAS 9. Denne fremgangsmåde er i stand til hurtigt at isolere undergrupper af mærkede kerner fra blandede populationer, men kræver tre separate transgene konstruktioner og kan derfor være uegnet til bestemte genetiske anvendelser. For nylig er en tilgang blevet beskrevet, hvor SUN (S AD1 og FN C-84) domæne-holdige proteiner, der lokaliserer til den indre membran af det nukleare kuvert blev mærket medfluorescerende proteiner og udtrykkes under kontrol af Gal4/UAS systemet 10. Kerner blev isoleret i nærværelse af ikke-ionisk detergent for at fjerne den ydre membran af kernemembranen og affinitetsrenset under anvendelse af magnetiske perler koblet til anti-GFP-antistoffer. Denne fremgangsmåde blev anvendt med succes til at isolere små populationer af mærkede kerner fra specifikke neuronale undertyper inden den voksne hjerne Drosophila 10..

Her er en protokol til isolering af mærkede kerner fra en blandet population af celler fra Drosophila larve væv beskrevet. Denne metode blev udviklet uafhængigt, men svarer til den fremgangsmåde, der er beskrevet af Henry et al. 10. Først blev kerner mærket med en fluorescerende tag, der kun udtrykkes i specifikke celletyper i Drosophila melanogaster at lette den efterfølgende isolering af mærkede kerner fra blandede populationer ved hjælp af en affinitet tilgang. For at markere kerner,Den Kash (K larsicht / NC-1 / S yn h omology) Domænet blev udnyttet. Den Kash domæne er et transmembrandomæne som lokaliseres til den ydre membran af nukleare kuvert, dels gennem interaktioner med SUN domæne-holdige proteiner i den perinukleære rum 11.. Den C-terminale kash domæne af proteiner, såsom Drosophila Msp-300 og Klarsicht forankrer disse proteiner til den ydre kernemembranen, medens deres N-terminale domæner interagerer med cytoskeleton proteiner såsom actin eller mikrotubuli i cytoplasmaet 12-14. Konstruktioner blev genereret, hvor Kash domæne af Drosophila Msp-300 blev fusioneret til den C-terminale ende af EGFP under kontrol af Gal4 regulatorisk sekvens, UAS i pUAST-attB vektor 15, 16. Brug phiC31 stedspecifik integration, blev transgene fluer genereret hvori UAS-EGFP :: Msp-300 Kash transgen blev indsat i attP2 loci på kromosom3L 17.. UAS-EGFP :: Msp-300 Kash fluer kan krydses med fluer, der udtrykker Gal4 chauffør i en særlig celletype, hvilket resulterer i den målrettede ekspression af EGFP på den ydre kernemembranen i celletypen af interesse. Mærkede kerner kan derefter oprenses fra blandede cellepopulationer under anvendelse af antistoffer mod GFP koblet til magnetiske perler. I denne fremgangsmåde er anvendelsen af ​​ikke-ioniske detergent ikke påkrævet, fordi EGFP tag er lokaliseret til den cytoplasmatiske side af den ydre kernemembranen og er derfor tilgængelige for antistoffer.

Den nedenfor beskrevne protokol kan anvendes til at isolere / berige EGFP-mærkede kerner fra specifikke celletyper i Drosophila larve væv at kvantificere renhed og udbytte af isolerede kerner, og at udvinde nukleart RNA egnet til kvantitativ revers-transkription-polymerase-kædereaktion (QRT -PCR) genekspressionsanalyse. Isoleringen og affinitet-oprensning af kerner (undtagen tissue dissektion) kan udføres i mindre end en time. Resultaterne er vist viser, at glial kerner held kan isoleres fra larve optik lap og øjne imaginal disc, og anvendes til senere genekspressionsanalyse. Det forventes, at denne tilgang vil være nyttig for isolering / berigelse af mærkede kerner fra embryonale og larvernes væv, hvor målcellerne udgør mindre end 5% af den samlede befolkning. Alle Drosophila aktier og plasmider genereres i denne undersøgelse er tilgængelige fra forfatterne efter anmodning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1.. Generation og karakterisering af EGFP :: Kash Drosophila

  1. Cross Gal4 driver flyver til UAS-EGFP :: MSP-300 Kash fluer. Alternativt kan rekombinante fluer, der bærer både Gal4 føreren og UAS-EGFP :: MSP-300 Kash transgen genereres ved hjælp af standard genetiske teknikker. Denne anden fremgangsmåde er fordelagtigt, hvis et stort antal afkom er påkrævet.
  2. Karakterisere ekspression af EGFP :: Kash markør under anvendelse af standard mikroskopi teknikker. Bemærk: EGFP ekspression kan observeres ved standard mikroskopi teknikker i dissekerede faste Drosophila væv eller i hele larver, og ikke kræver anvendelsen af et antistof.
    1. Bestem ekspressionsmønster EGFP :: Kash markør i hele organismen under et fluorescens dissektionsmikroskop (se Materialer PDF). Bemærk: Mange Gal4 chauffører, herunder repo-GAL4 driver vist i figur 1, udviser nonspecific mønstre af ytringsfrihed i andre larvernes væv såsom spytkirtlerne (se resultater).
    2. Analyser EGFP :: Kash udtryk mønster i det dissekerede væv af interesse ved hjælp af konfokal mikroskopi.
      1. Lave vævet af interesse anvendelse af formaldehyd i en slutkoncentration på 4%, og pletten DNA under anvendelse af DAPI ved en slutkoncentration på 0,1 ug / ml til at visualisere lokalisering af EGFP :: Kash tag i forhold til DNA.
      2. Anskaf billeder ved hjælp af enten en 40X / 1,30 oliebestandighedsobjektet eller en 20X / 0,75 oliebestandighedsobjektet, afhængigt af størrelsen af ​​vævet af interesse. Følgende excitation / emission betingelser kan bruges til billedoptagelse: 408 nm/425-475 nm (DAPI), 488 nm / 525-550 nm (GFP).

2. Isoler Kerner fra Drosophila larve Væv

  1. Forbered udstyr til larvernes væv dissektion og efterfølgende kerner isolation. Bemærk, athele dechorionated embryoner kan også anvendes som om ønsket udgangsmateriale. Det anbefales at anvende delvist dissekerede larval væv snarere end hele larver, hvis celletypen af ​​interesse er til stede i et specifikt væv, såsom den imaginære disk. Dette reducerer ikke-specifik binding, og fjerner også problemer, der kan være forårsaget af ekspression af nogle Gal4 bilister i ikke-mål-celler.
    1. Forbered to par skarpe pincet (se Materialer PDF), en silikoniseret 9 brønde glasplade (se Materialer PDF) og PBT (1x PBS, pH 7,4,-20 Tween 0,1%).
    2. Prebind GFP antistof til de magnetiske perler. Dette trin skal startes, før du begynder dissektion. Der tilsættes 10 ul af de magnetiske perler (Invitrogen, se Materialer PDF) og 2 ug af GFP-antistof (Roche, se Materialer PDF) til 400 pi vaskepuffer (1x PBS, pH 7,4, 2,5 mM MgCl2) i et 1,5 ml rør . Mængden af ​​perler og antistof anvendes, kan optimeres, hvis nødvendigt baseret på mængden af ​​mål i samcappede og bindingsaffiniteten af ​​antistoffet til perlerne.
    3. Inkuber perler og antistof med rotation for mindst 30 minutter ved stuetemperatur.
    4. Anbring 1,5 ml rør indeholdende perler og antistof i magnetisk stativ (se Materialer PDF) og give perlerne at binde til magnetiske ca 1-2 minutter. Fjern supernatanten indeholdende det ubundne antistof og vaskebuffer anvendelse af en 1 ml pipette. Perlerne forbliver bundet til væggen af ​​1,5 ml rør på den side, der støder op til magneten.
    5. Skyl perlerne to gange med 1 ml vaskebuffer hver gang som beskrevet i afsnit 2.1.4. Fjern 1,5 ml røret fra magnetisk stativ og vend kortvarigt at blande perlerne og vaskebuffer i hvert vasketrin.
    6. Opbevar antistofbundne perler i vaskebuffer indtil den er klar til at fortsætte med trin 2.7. Perlerne bør ikke have lov til at tørre ud på ethvert tidspunkt i protokollen.
  2. Dissekere larve væv i PBT og overføre dissekerede væven brønd af 9-brønds skål. Typisk dissektion af den optiske lap og øjne imaginal disk fra 100 tredje stadie larver giver tilstrækkeligt materiale til downstream genekspressionsanalyse efter kerner isolation.
  3. Skyl det isolerede væv i nuklear ekstraktionspuffer (10 mM HEPES-KOH, pH 7,5, 2,5 mM MgCl2, 10 mM KCI) i et 1,5 ml rør. Overfør isolerede larve væv til en 1 ml Dounce Homogenizer (se Materialer PDF) på is, der indeholder 1 ml frisk nukleare udvinding buffer. Inkuberes på is i 5 min. Det er ikke nødvendigt at tilsætte proteaseinhibitorer hvis RNA skal ekstraheres efter kerner isolation.
  4. Forstyrre vævet ved 20 slag med løs pistil og derefter inkubere prøven på is i 10 min for at tillade cellerne at svulme. Uddrag kernerne fra cellerne under anvendelse af 15 slag med det stramme pistil. Antallet af slag med løse og stramme pestles skal optimeres for de forskellige væv og celletyper, overskydende homogenisering kan resultere iklippet kerner, mens utilstrækkelig homogenisering ikke vil udtrække alle kerner fra vævet.
  5. Foretage homogenatet, som indeholder de kerner og celleaffald gennem en 40 um porestørrelse filter (se Materialer PDF), der er blevet prerinsed nuklear homogeniseringsbuffer. Saml den filtrerede homogenat i et frisk rør.
  6. Saml præ-isolation prøver til senere analyse for at fastslå kerner udbytte, kerner integritet, og for at fastslå transcript niveauer af target gener før kerner isolation.
    1. Transfer 50 pi af det filtrerede homogenat til et frisk 1,5 ml rør ved hjælp af en pipette. Dette er den præ-isoleret prøve. Tilsæt 500 ul Trizol reagens (se Materialer PDF, PAS), vendes til at blande, og opbevares ved -20 ° C til efterfølgende RNA isolation (trin 3.1).
    2. Transfer 20 pi af det filtrerede homogenat til et frisk 1,5 ml rør.
      1. Tilføj DAPI til en slutkoncentration på 0,1 ug / ml, og der tagesubate prøve på is i 10 min.
      2. Overfør DAPI-farvede kerner til en poly-lysin belagt dækglas, og placere på et objektglas. Forsegl dækglasset hjælp klar neglelak.
      3. Kontroller kerner integritet, og tilstedeværelse af GFP-mærkede kerner af interesse ved hjælp af fluorescerende mikroskop. Bemærk: Det er ikke nødvendigt at fastsætte kerner, eller at pletten for GFP, hvis disse slides analyseres rimeligt hurtigt efter tilberedningen (indenfor 24 timer).
    3. Transfer 10 pi af det filtrerede homogenat til et frisk 1,5 ml rør, og der tilsættes 90 ul vaskepuffer (1x PBS, pH 7,4, 2,5 mM MgCl2). Tilføj DAPI til en slutkoncentration på 0,1 ug / ml, og inkuberes på is i 10 min. Bestem kerner udbytte på præ-isoleret prøve under anvendelse af et hæmocytometer at tælle DAPI-positive kerner ved hjælp af epifluorescens under en 10X luft mål.
  7. Anbring 1,5 ml rør, som indeholder de antistof-bundne kugler (udarbejdet i afsnit 2.1.6) i et magnetisk stativ,og tillade de magnetiske perler binder til magneten mindst 2 minutter som beskrevet i afsnit 2.1.4. Fjern vaskebufferen fra de antistof-bundne perler ved hjælp af en 1 ml pipette, og tilsæt den filtrerede homogenat fra trin 2,5 til 1,5 ml rør ved hjælp af en 1 ml pipette.
  8. Vend forsigtigt røret flere gange for at blande, og inkuberes ved 4 ° C i 30 min med ende-over-ende agitation. Undgå bobler i røret, hvis muligt, da disse kan resultere i sammenklumpning af kerner.
  9. Anbring 1,5 ml rør indeholdende antistof-bundne perler og homogenat i et magnetisk stativ og tillade de magnetiske perler binder til magneten mindst 2 minutter som beskrevet i afsnit 2.1.4. Fjern homogenatet indeholdende det ubundne kerner fraktion ved hjælp af en 1 ml pipette.
  10. Vask prøven 3x med 1 ml vaskebuffer hver gang. Tag 1,5 ml rør, der indeholder perler, bundet kerner og vaske buffer fra stativet og vend for at blande flere gange, og derefter placere røret i den magnetiske rack som beskreveti trin 2.9 og supernatanten fjernes ved hjælp af en 1 ml pipette.
  11. Tilføj 150 pi vaskebuffer til perlerne, som bør være bundet til målet kerner. Dette er den post-isolation prøve. Fremstille prøver til mikroskopi analyse og efterfølgende RNA-ekstraktion.
    1. Overfør 20 ul af post-isolation prøve til et frisk 1,5 ml rør og pletten med DAPI og analysere som beskrevet i afsnit 2.6.2. Tæl GFP + / DAPI + og GFP-/DAPI + kerner fanget af magnetiske perler til at bestemme renheden af det berigede GFP + kerner i post-isolation prøve.
    2. Der tilsættes 1 ml Trizol reagens til resten af post-isolation prøve, vendes til at blande, og opbevares ved -20 ° C til efterfølgende RNA isolation (trin 3.1). Bemærk: Prøver i Trizol kan opbevares i flere uger, hvis nødvendigt ved -20 ° C. Det er ikke nødvendigt at eluere kernerne fra de magnetiske perler før RNA-ekstraktion under anvendelse af Trizol-reagens because perlerne ikke interfererer med den efterfølgende RNA isolation.

3. Bestem Transcript Niveauer i kerner isoleret fra larve Væv

  1. Isoler RNA fra før-isolations-og post isolation prøver fremstillet i afsnit 2.6.1 og 2.11.2 brug af standardprotokol beskrevet for Trizol-baserede RNA ekstraktion (se Materialer PDF) med følgende modifikationer:
    1. Efter udfældning af RNA-pelleten tilsættes 19,2 pi RNase-frit vand og 0,8 pi RNASecure reagens (se Materialer PDF) til pelleten, og der inkuberes ved 60 ° C i 20 min for at inaktivere RNAser.
  2. Bestem RNA-koncentrationen med et fluorescerende-RNA-bindende farvestof, såsom Qubit RNA assay kit (se Materialer PDF) vha. QubitR 2,0 Fluorometer følge producentens protokol.
  3. Syntetisere cDNA under anvendelse af en amplifikation af revers transkriptase, såsom EpiScrIPT revers transkriptase-kit og oligodT primere efter fabrikantens anvisninger. Bemærk: Typisk 50 til 100 ng RNA genererer tilstrækkelig cDNA til at udføre flere genekspressionsanalyse. Ækvivalente mængder af præ-isolation og post-isolation RNA bør anvendes til at generere cDNA.
  4. Tilføj 180 pi nuklease-frit vand til 20 pi cDNA prøve at fortynde dette 10 gange, før real-time kvantitativ PCR (qPCR) analyse. Denne fortynding er et vigtigt skridt, fordi ufortyndede cDNA prøver kan hæmme qPCR.
  5. Forbered en qPCR stamblanding med polymerase og dNTP'er, 4 pmol af hver af forward og revers primer, der består med sterilt vand til den endelige reaktionsvolumen på 20 ul.
    1. Design qPCR primere til at målrette gener, der forventes at blive udtrykt i celletype af interesse, og på udviklingsstadiet, hvor væv indsamles. Design primere spænder over en intron, hvis muligt, så genomisk ogcDNA PCR-produkter kan skelnes. Bemærk: Hvis genekspressionsprofilen af målet celletype ikke er kendt, primere mod eGFP, som udtrykkes specifikt i den mærkede kerner befolkning, kan anvendes til at optimere protokol for en bestemt celletype og væv (tabel 1).
  6. Bestemme de relative transkriptniveauer af hvert gen af interesse i de præ-isolations-og post isolation prøver ved sammenligning med en fortyndingsrække af cDNA fremstillet ud fra hele væv. Transcript niveauer af target gener skal normaliseres til en reference gen såsom Rpl32 (eller helst flere reference gener).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Repo-GAL4 driver (Bloomington lager nummer 7415) er specifikt udtrykkes i gliaceller i Drosophila nervesystem på flere stadier af udvikling 18. Fluer blev genereret som stabilt udtrykker UAS-EGFP :: MSP-300 Kash under kontrol af repo-GAL4 driver ved hjælp af standard genetiske teknikker. For at karakterisere ekspressionsmønsteret EGFP :: Kash transgenet i disse fluer blev mønsteret af GFP-ekspression i dissekerede optik lap og øjne imaginære disk fra tredje stadie larver undersøgt under anvendelse af konfokal mikroskopi. Dissekerede væv blev modfarvet med DAPI at markere DNA og med α-chaoptin 19 at mærke photoreceptor axoner (mAb24B10, se Materialer PDF). Figur 1A viser, at repo-GAL4 drevet EGFP :: er Kash transgen udtrykt i glia i de optiske lapper og øjne imaginal skive i den forventede udtryk mønster. Under højere forstørrelse,Observeres EGFP ekspression i et cirkulært mønster omkring DAPI-positiv DNA i overensstemmelse med nuklear kuvert lokalisering af EGFP :: Kash tag (figur 1B). EGFP-ekspression kan påvises i både faste og ikke-fikserede væv uden behov for signalforstærkning ved hjælp af et antistof mod GFP; antistoffer mod GFP ikke blev anvendt til at visualisere EGFP :: Kash ekspression i de billeder, der er vist i figur 1 og 2. At afgøre, om EGFP :: Kash transgenet udtrykkes uspecifikt i andre væv i Drosophila larver blev GFP-ekspression undersøgt i hele tredje stadie larver ved hjælp af en fluorescens dissektionsmikroskop. Især uspecifik udtryk for EGFP :: Kash transgen blev observeret ved høje niveauer i spytkirtlerne i tredje stadie larver. Dette indikerer, at repo-GAL4 føreren har aktivitet i nogle andre end glia i larvestadiet af udviklingen celletyper. Således specifikt at isolere glial kerner blev optikken lap og øjne imaginal disk fra tredje stadie larver isoleret ved hjælp af dissektion før homogenisering og affinitet-isolation.

For at bekræfte, at denne protokol er egnet til ekstraktion af kerner fra Drosophila væv, og at estimere procentdelen af mærkede kerner til stede i et givet væv, før isolation prøve (afsnit 2.6.2) fra homogenater opnået fra optikken lap og øjne imaginære skive genkøbstypen GAL4 UAS-EGFP :: Msp-300 Kash tredje stadie larver blev undersøgt. Figur 2A viser et repræsentativt billede af præ-isoleret prøve opnået under anvendelse af konfokal mikroskopi. I dette billede, er tilstedeværelsen af ​​kerner angivet med DAPI-positive begivenheder. Er også observeret et mindre antal tyndt spredte GFP-positive, DAPI-positiv gliaceller kerner. Vi vurderer, at GFP-positive kerner udgør mindre end 2% af den samlede kerner befolkning i detteprøve (figur 2A). Det totale kerner udbytte fra optisk lap og øjne imaginal diske, der blev dissekeret fra 100 larver blev bestemt for præ-isolation prøve som beskrevet i afsnit 2.6.3 (tabel 2). En typisk præ-isoleret prøve fra 100 dissekeret optisk lobe og øjne imaginal discs indeholdt mellem 0,8 og 1,2 x 10 7 kerner, hvoraf ca 2% var GFP-positive. Figur 2B viser et repræsentativt billede af DAPI-positive kerner i et nærmere defineret område af hæmocytometer. Bemærk, at kernerne er intakte, og opretholde en ensartet cirkulær form under ekstraktionsbetingelserne anvendes i protokollen (figur 2A og 2B).

At afgøre, om denne protokol kan bruges til at isolere og / eller meget berige specifikke populationer af mærkede kerner fra væv, der indeholder blandet cellepopulationer, α-GFP-antistof-coatede magnetiske perler var brugd for at isolere mærkede kerner fra homogenater opnået fra optikken lap og øjne imaginal skive på 100 repo-GAL4, UAS-EGFP :: MSP-300 Kash tredje stadie larver. I figur 2C og 2D, kan det ses, at EGFP :: Kash tagged glial kerner binder sig til α-GFP belagte magnetiske kugler og er observeret i den post-isolation stikprøve (punkt 2.11.1) efter magnetisk separation. Selv om de magnetiske perler udviser nogle autofluorescens i GFP-kanal, kan disse let skelnes fra perle-bundne kerner ved deres mindre størrelse (2,8 um til de magnetiske perler versus cirka 5 um til kernerne) og manglende DAPI farvning. GFP + / DAPI + kerner tegner sig for mere end 95% af DAPI positive begivenheder i post-isolation prøve. Således målet mærkede kerner befolkning er stærkt beriget i den post-isolation prøve i forhold til præ-isolationprøve. De fleste af kernerne i post-isolation prøve show stærke kernekraft-kuvert lokaliseret GFP-fluorescens, og er som regel omgivet af perler. Det er imidlertid muligt, at et lille antal ukodede kerner også kan være til stede i denne prøve. Selv om resultaterne i figur 2C og i genekspressionsanalyse i figur 3 (se nedenfor) viser, at målet mærkede glial kerner befolkning er stærkt beriget den mulighed, at nogle kerner fra visse andre ikke-specifikke celletyper er også til stede i prøven kan ikke udelukkes. Det anbefales, at brugerne optimere denne protokol for deres særlige celletype og væv af interesse at maksimere berigelse af målet kerner befolkning, og for at fjerne uspecifikke kerner bindende. Især er forholdet mellem udgangsmateriale i forhold til antistof, og perlerne er tilbøjelige til at være vigtig for optimal berigelse af mål-kerner. Af denne grund intervallerne af den samledekerner numre til stede i vores typiske præ-isolation prøver er vist i tabel 2.. Baseret på den samlede kerner numre er til stede i den præ-isolation prøve og den skønnede andel af gliaceller i den blandede befolkning fra optikken lap og øjne imaginal skive blev den maksimale kerner udbytte i post-isolation prøve forventes at være mellem 1,6 x 10 5 og 2,4 x 10 5 kerner. Men ved hjælp af hæmocytometer at bestemme kerner udbytte som beskrevet i trin 2.6.3, den faktiske kerner opnåede udbytte i post-isolation prøve var mellem 1,3 x 10 4 og 2,7 x 10 4 kerner. Disse kerner udbytter udgør meget grove skøn, fordi perlerne er til stede i den post-isolation prøve at påvirke præcis belastning af hemocytometer. Nogle GFP-positive kerner er observeret i den ubundne homogenatet, hvilket indikerer, at ikke alle GFP-positive kerner i Srigelig binder til perlerne effektivt under de betingelser, der anvendes i denne protokol. Øget tidspunktet for bindende eller udføre sekventielle isoleringstrin potentielt kunne øge udbyttet, men dette kan komme på bekostning af både renhed og RNA integritet. Brug de betingelser, der er beskrevet i denne protokol, kan opnås tilstrækkelige mængder af RNA i post-isolation prøve til genekspressionsanalyse nedstrøms ved QRT-PCR (tabel 2). Således er denne protokol er i stand til hurtigt og stringent isolere target kerner fra, væv, der indeholder blandede populationer af celler. Desuden er det i stand til specifikt at isolere mål-kerner, der kun udgør en lille del, mindre end 5% af cellerne i en given population.

For yderligere at bekræfte, at den post-isolation prøve var højt beriget for vores mål glial kerner befolkning, niveauerne af udskrifter for 4 forskellige gener i den præ-isolation post-isolation prøver blev sammenlignet ved hjælp af RT-qPCR. Afskriften niveauer af elav, nrv2 og eGFP blev bestemt i de to prøver, og normaliseret til referencen genet, Rpl32, som udtrykkes på tilsvarende niveauer i gliaceller og i det omkringliggende centralnervesystemet (Figur 3). Folden forskel i post-isolation prøven vist i forhold til præ-isoleret prøve, som er sat til én. I figur 3, post-isolation prøve er betydeligt lavere transcript niveauer af neuronal-specifikt gen elav i forhold til præ-isoleret prøve. Dette indikerer, at kerner fra neuronale celler er underrepræsenteret i den post-isolation prøve. I modsætning hertil højere transcript niveauer af både glial beriget nrv2 gen 10 og eGFP er til stede i den post-isolaning prøve i forhold til præ-isoleret prøve. Dette resultat indikerer, at den post-isolation prøve er stærkt beriget for målet glial kerner befolkning. Det er vigtigt at bemærke, at afskriften niveauer, der måles i denne protokol udgør nukleare udskrifter, og er derfor tilbøjelige til at angive niveauet af aktiv transskription snarere end steady state-mRNA. Reproducerbar udtryk for repo blev ikke påvist i hverken vores pre-isolation eller post-isolation prøver tyder på, at Gal4 protein udtrykt af repo-GAL4 driver kan vedvare efter aktiv transskription af det endogene repo gen er ophørt. Dette er i overensstemmelse med resultater fra andre undersøgelser, hvor kerner mærket ved hjælp af twi promotor ikke viser berigede niveauer af immersionsprogrammerne udskrifter, måske på grund af forskelle i den udviklingsmæssige timingen af transkription versus proteinstabilitet 8. Taken sammen viser disse resultater, at den beskrevne protokol kan med held anvendes til højt berige target kerner fra væv, der indeholder blandede populationer af celler, og at de isolerede kerner er egnet til genekspression analyse.

Figur 1
Figur 1. Expression mønster af repo-GAL4, UAS-EGFP :: MSP-300 Kash fluelinen. (A) I tredje stadie larver, repo-GAL4 driver ekspression af UAS-EGFP :: MSP-300 Kash transgen i gliaceller i optikken lap, optisk stilk (OS) og øjne imaginal skive (ed). Det nukleare kuvert i gliaceller er mærket med EGFP :: Kash (grøn). R1 - R8 fotoreceptor celle axoner er mærket med α-chaoptin (mAB24B10, rød) til sammenligning, og DNA er stained med DAPI (lilla). GFP-mærkede glial kerner er synlige langs lamina (la) i optisk lap (markeret med pile). Scale bar, 50 um. (B) Højere forstørrelse billede af hinden ganglier optikken lap, der indeholder EGFP :: Kash mærket glial cellekerner. Scale bar, 50 um. Konfokal billeder blev erhvervet ved hjælp af enten en   40X / 1,30 olie eller en   20X / 0,75 oliebestandighedsobjektet, og ved hjælp excitation / emission bølgelængder på 408 nm/425-475 nm (DAPI), 488 nm/525-550 nm (GFP), 561 nm/595-620 nm (Alexa 5,6,8 ). Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Karakterisering af kerneri "pre-isolation" og "post-isolation" prøver. (A) Repræsentant billede fra en repo-GAL4, UAS-EGFP :: MSP-300 Kash præ-isolation prøve analyseres ved hjælp af en X 20 / 0,75 oliebestandighedsobjektet og standard konfokalt mikroskop. DNA farves med DAPI (blå), og EGFP :: Kash tagged gliøse kerner er vist med grønt (markeret med pile). Scale bar, 50 um. (B) Repræsentant billede af DAPI-farvede kerner fra en præ-isolation prøve på et hæmocytometer ved hjælp af en X 10 luft objektiv og standard epifluorescensmikroskop. Hemocytometer gitre er vist i lysegrå. Kun DAPI-positive kerner er vist i dette billede, som GFP-fluorescens ikke var synlige under denne målsætning på epifluorescensmikroskop. (C) Repræsentant billede fra en repo-GAL4, UAS-EGFP :: MSP-300 Kash post-isolation prøveanalyseret som beskrevet for panel A. Det isolerede EGFP :: Kash mærkede glial kerner (markeret med pile) pletten positivt for DAPI, og er omgivet af de perler, som autofluoresce ved lave niveauer i GFP-kanal. Scale bar, 50 um. (D) Højere forstørrelse billede af en typisk isoleret EGFP :: Kash mærkede glial kerner (markeret med pil) omgivet af perlerne. Målestokken, 5 um. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Repræsentative qRT-PCR data fra "pre-isolation" og "post-isolation" prøver. Transcript niveauer af målgener blev bestemt ved QRT-PCR af præ-isolation og post-isolation prøver fra repo-GAL4, UAS-EGFP :: MSP-300 Kash optiske lapper og øjne imaginal diske. Alle transkriptniveauer er normaliseret til Rpl32 transkriptniveauer, og præ-isolation stikprøve for hvert gen mål er sat til én. Repræsentative resultater fra et biologisk eksperiment er vist for følgende gener: elav, nrv2 og eGFP.

Gene Primer-sekvensen (5'-3 ') Størrelse PCR-produktet (bp)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabel 1. Primere anvendt til QRT-PCR-analyse.

Samlet antal kerner i præ-isolation prøve Anslået samlet antal kerner i post-isolation prøve RNA udbytte fra post-isolation prøve (ng)
0,8-1,2 x 10 7 1,3-2,7 x 10 4 160-220 ng

Tabel 2. Repræsentative kerner og RNA udbytter.Typiske intervaller for kerner og RNA udbytter fra præ-isolations-og post isolation prøver fra 100 dissekeret optisk lap og øjne imaginal diske fra repo-GAL4, UAS-EGFP :: MSP-300 Kash genotype, hvor gliaceller er mærket med EGFP :: Kash. Kerner blev kvantificeret som beskrevet i 2.6.3 og RNA blev kvantificeret som beskrevet i 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokol kan bruges til at isolere eller meget berige specifikt mærkede kerner fra blandede cellepopulationer i Drosophila embryonale eller larvernes væv. Ved hjælp af denne protokol, kan kerner isoleres fra dissekerede væv i cirka 1 time. Renheden og udbyttet af de isolerede kerner skal bestemmes eksperimentelt for hver celletype. Det kan være svært at kvantificere perle-bundne kerner på post-isolation etape af protokollen ved hjælp af en hemocytometer grund af perlerne er til stede i prøven. Således, hvis nøjagtige antal kerner er nødvendige for en nedstrøms anvendelse, vil det være nødvendigt at estimere kerner udbytte baseret på en alternativ fremgangsmåde, såsom DNA-indhold. Nøjagtige beregninger af kerner udbytte er ikke nødvendige for genekspression analyse, hvis RNA held kan isoleres og kvantificeres. Det anbefales at bruge en fluorescens-metode til kvantificering af RNA-udbytte, som vi har fundet, at spektrofotometrisk bestemmelse af RNA-koncentrationeni disse lave koncentration prøver er meget varierende.

Der er to vigtige aspekter ved protokollen, som vil påvirke dens succes: valget af magnetiske perler og antistof. Magnetiske perler, der er koblet til GFP eller protein G er kommercielt tilgængelige fra flere forskellige kilder. Det anbefales imidlertid kraftigt at bruge protein G magnetiske perler til rådighed fra Invitrogen til proceduren beskrevet i denne protokol for to væsentlige grunde. Først størrelse Invitrogen perler på 2,8 um er lidt mindre end den gennemsnitlige størrelse af kernerne i de celletyper, vi har undersøgt, hvilket er cirka 5 um (figur 2D). Magnetiske perler, der er mindre (fx 50 nm, μMACS α-GFP, Miltenyi Biotech) ikke binder hurtigt til batch-vask stil magneter, og søjlerne, der er fastsat for disse perler kan tilstoppe med larve vævsekstrakter. Større magnetiske perler (f.eks 10 um, PureProteome protein G magnetisk bEADS, Millipore) ikke binder godt til kerner i vores indledende tests, og disse udviser også en stærk autofluorescens i de samme kanaler som både DAPI og GFP, hvilket gør det vanskeligt at identificere kerner i perle-bundne prøve ved standard-mikroskopi teknikker. Ud over valget af magnetiske perler, er det vigtigt at anvende en GFP-antistof, der fungerer godt for immunopræcipitation, men som ikke har høj-specifik baggrund. Til hjælp i reproducerbarhed denne protokol, har vi brugt et monoklonalt muse-antistof mod GFP. Polyklonale kanin antistoffer mod GFP blev også med held trialed i vores indledende undersøgelser, men disse tendens til at have højere uspecifik baggrund. Andre monoklonale antistoffer blev også testet (f.eks Developmental Studies Hybridoma Bank), med varierende grad af succes. Således antistof valg er en vigtig faktor for vellykket isolering af mærkede kerner.

Selv i denne protokol beskriver vi metoder til Dethermelin gentranskript niveauer i isolerede kerner, forventes det, at den fremgangsmåde, der er beskrevet i trin 2,1-2,11 også vil være egnede til at isolere kerner, der kan bruges til efterfølgende kromatin immunpræcipitationsanalyse. Hvis vævet er fikseret i 1% formaldehyd før homogenisering (trin 2.3), så kan dissekerede væv indsamlet over flere dage og tilstrækkeligt materiale isoleret til at udføre kromatin immunpræcipitationsanalyse. Baseret på tællinger opnået under anvendelse af hæmocytometer, som giver kun grove skøn som beskrevet ovenfor, vi opnås typisk 1,3 x 10 4 og 2,7 x 10 4 glial kerner fra øjet imaginal disc og optisk lap 100 larver (tabel 2). Således ved hjælp af vores fremgangsmåde, bør det være muligt at opnå tilstrækkeligt materiale til at udføre kromatin immunpræcipitationsanalyse, afhængigt af overflod af den målrettede celletype, og epitopen af ​​interesse.

Et nyttigt genetisk anvendelse af denne tekniskque er, at det kan anvendes til positivt at mærke kernerne i specifikke celletyper i embryoner eller larver, der er homozygote for en recessiv letal mutant allel. For at opnå dette, skal to separate flyve lagre genereres i hvilken mutant allel af interesse rekombineres med en specifik Gal4 driver eller med UAS-EGFP :: Msp-300 Kash transgen på tredjedagen kromosom. Hvis fluer bærer mutantallelen og Gal4 driver krydses fluer bærer de muterede alleler og UAS-EGFP :: Msp-300 Kash transgen kun afkom, der har begge kopier af mutantallelen vil blive mærket med GFP i det væv, hvori Gal4 driver udtrykkes. Således kan cellespecifikke virkninger af recessive letale alleler blive gennemgået i de embryonale eller larvestadier, før den fase af dødelighed. Denne genetiske teknik har tidligere været anvendt til positivt at mærke celler i embryonale muskel, der var homozygote for mutationer i SAGA underenheden sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at afsløre.

Acknowledgments

Vi takker Janice Fischer for at levere UAS-EGFP :: MSP-300 Kash plasmid. Den mAB24B10 antistof blev opnået fra Developmental Studies Hybridoma Bank udviklet i regi af NICHD og vedligeholdes af University of Iowa, Biologisk Institut. Repo-GAL4 lager (BL7415) blev opnået fra Bloomington Stock Center på Indiana University. Støtte fra American Cancer Society Institutional Research Grant (IRG # 58-006-53) til Purdue University Center for Cancer Research er taknemmeligt anerkendt. Jingqun Ma er understøttet af en Agricultural Research ved Purdue undervisningsopholdet i Fødevarer og Landbrug fra Purdue University.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Affinity-baserede Isolering af Tagged Kerner fra<em&gt; Drosophila</em&gt; væv til genekspressionsanalyse
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter