Het doel van deze publicatie is om te visualiseren en te discussiëren over de operatieve stappen van een Enhanced Northern Blot protocol op RNA geëxtraheerd uit Drosophila melanogaster embryo's, cellen en weefsels. Dit protocol is bijzonder bruikbaar voor de efficiënte detectie van kleine RNA species.
De laatste decennia hebben de explosie van wetenschappelijke belangstelling rond genexpressie controlemechanismen op het RNA-niveau meegemaakt. Deze tak van de moleculaire biologie is sterk aangewakkerd door de ontdekking van niet-coderende RNA's als belangrijke spelers in het post-transcriptionele regulatie. Zo'n revolutionair perspectief is gepaard gegaan en veroorzaakt door de ontwikkeling van krachtige technologieën voor het profileren van korte RNA expressie, zowel op de high-throughput niveau (genoom-brede identificatie) of als single-kandidaat-analyse (steady state accumulatie van specifieke soorten). Hoewel verschillende state-of-art strategieën zijn momenteel beschikbaar voor het doseren of het visualiseren van een dergelijke vlucht voor moleculen, Northern Blot test blijft de in aanmerking komende aanpak in de moleculaire biologie voor de onmiddellijke en nauwkeurige evaluatie van RNA-expressie. Het is een eerste stap naar de toepassing van meer geavanceerde, dure technologieën en in veel gevallen blijft preferentiële werkwijze gemakkelijk inzichtenin RNA biologie. Hier het overzicht hebben we een efficiënt protocol (Enhanced Northern Blot) voor het detecteren zwak uitgedrukt microRNAs (of andere kleine regulerende RNA-soorten) van Drosophila melanogaster hele embryo's, handmatig ontleed larvale / volwassen weefsels of in vitro gekweekte cellen. Een zeer beperkte hoeveelheid RNA is vereist en het gebruik van materiaal van flowcytometrie-geïsoleerde cellen kunnen ook overwogen.
RNA biochemie heeft spectaculaire vooruitgang ervaren in de afgelopen jaren 1. Ons begrip van RNA potentieel in de controle van genexpressie werd barsten van het identificatienummer van krachtige noncoding ribo-regulatoren 2, door de ontdekking van nieuwe RNA gebaseerde regulerende mechanismen 3,4 en een diepere karakterisering van reeds bekende post-transcriptionele gebeurtenissen 5. Alles bij elkaar deze studies hebben toegestaan RNA biologie drastisch maken de scène, steeds in de huidige wetenschappelijke landschap een belangrijk onderwerp van onderzoek. Met name de laatste jaren krijgen we een gevoel van de doordringende invloed van de 'RNA-wereld "op moleculaire neurobiologie 6, een van de meest dynamische onderzoeksgebieden in de moderne life science. In het laatste decennium van de vorige eeuw, heeft de algemene wetenschappelijke scenario is een revolutie door de ontdekking van de RNA-interferentie 7,8 en van de kleine regulerende RNA's 9,10met bijzondere aandacht voor microRNAs 11, endogeen tot expressie kleine niet-coderende RNA's betrokken bij de controle van bijna alle cellulaire functies als pleiotropische en combinatorische regulatoren van genexpressie.
Bijna 10 jaar na miRNA eerste ontdekking in Caenorhabditis elegans door Ambros en Ruvkun's laboratoria, werd hernieuwd aandacht gericht op het veld bij hoge aantallen van miRNAs werden geïdentificeerd in Drosophila en in menselijke cellen en 12-15. Sindsdien, dankzij de veelzijdige transgene benaderingen, Drosophila melanogaster heeft opviel als een waardevolle biologische context te verdiepen in miRNA biosynthese en activiteit. Drosophila miRNAs hebben verschillende functies onthuld in insect-specifieke of evolutionair geconserveerd processen, variërend van veroudering om de stofwisseling, signaalwegen , gedrag en natuurlijk, neurogenese. Langs deze richting, hebben we onlangs een nieuwe koppeling 16 in de intrigerende co onthuldrrelation optreden tussen de master-gen GCM / glijden en de RNA-pad. De fly transcriptiefactor Gcm / Glide 17-19 vormt een uniek voorbeeld van lot van de cel determinant, die dicteert de gliale versus neuronale lot keuze in multipotente vliegen neurale voorlopers 20. Twintig jaar lang onderzoek naar dit onderwerp is duidelijk onderstreept het optreden van meerdere en overlappende ingangen van genexpressie regulatie convergerende dan GCM / glijden 21-28 aan de drempelwaarden die nodig zijn voor het balanceren van de delicate verhouding tussen neuronale en gliale tegenhangers tijdens neurale ontwikkeling vast te stellen.
We ontdekten dat regulering via DMEL-miR279 targeting is een verdere controle niveau bij te dragen tot post-transcriptionele fine-tuning van GCM / glijden meningsuiting 16. Wereldwijd zijn deze onderzoekslijnen vereist specifieke methodologische verbeteringen: langs jaren hebben verschillende technologieën oorspronkelijk ontwikkeld om trad analyserennele RNA's zijn omgebouwd voor het kwantificeren van kleine niet-coderende RNA's, zoals zoals RNAse bescherming assays, cDNA arrays 29-31, real-time PCR methoden 32-35 en sequentiebepaling van 36,37. Aan de andere kant, heeft herijking van technische benaderingen voortdurende vooruitgang bevorderd in het veld.
Northern Blot assay (NB, of RNA gel blotbepaling) vormt een representatief voorbeeld: het wordt grotendeels gebruikt om RNA accumulatie profileren, omdat zij garant staat voor expressie kwantificatie evenals grootte bepalen. De intrinsieke lage sensitiviteit van de werkwijze wordt beperkt wanneer het moet worden toegepast op lage overvloedige genexpressie fijnstemmers, zoals korte RNA's. Een nadelig gevolg is het vereiste van grote hoeveelheden totaal RNA, die moeilijk zijn toepassing op specifieke biologische monsters maakt. Om bovenstaande redenen is specifiek NB varianten voor kleine RNA-detectie zijn ontwikkeld 38-40: we hebben geprofiteerd van een verbeterde NB procedure 41 (ENB, Enhanced Northern Blot), terwijl het ophelderen van de bovengenoemde wisselwerking tussen DMEL-miR279 en GCM / glide.
Deze werkwijze berust op een chemische verknopende stap gebaseerd op de activiteit van een carbodiimide derivaat [1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, EDC] nucleïnezuur bevestigen op vaste dragers. Carbodiimide is een veelzijdige verknoper waarover de vorming van amidebindingen tussen geactiveerde carboxyl of fosfaatgroepen en aminegroepen 42 katalyseren. Deze eigenschap kan worden benut om covalent paar kleine RNAs via hun mono-gefosforyleerde 5'-hydroxylgroep aminogroepen aan het oppervlak van nylon membranen. De resulterende configuratie onderdeel vergroot de toegankelijkheid van het geïmmobiliseerde nucleïnezuur en op zijn beurt de efficiëntie van probe-doel hybridisatie, wat resulteert in opmerkelijke detectieverfijning 43.
De techniek gaat ervan bijzonder relevance in Drosophila moleculaire studies, waarbij het optreden van nieuwe en onderscheidende klassen van kleine niet-coderende RNA's is in opkomst 44. Hiervan rasiRNAs 45,46 vormen een specifiek subtype van piwi interactie RNAs (piRNAs 47) betrokken bij sequentie-specifieke gen-silencing. Operative details van deze werkwijze zijn volledig beschreven en gevisualiseerd hierna opzichte van de analyse van de microRNA DMEL-miR279 en DMEL-miR286 en, voor het eerst van een rasiRNA, rasi4. We geduwd deze werkwijze, die ons toegelaten onthullen slecht uitgedrukt doelen van minimale hoeveelheden RNA (minder dan 1 ug) uitersten.
Hoewel onze waardering voor de verfijnde verwevenheid waardoor RNA reguleert neurogenese neemt voortdurend toe, de mechanistische implicaties van RNA gebaseerde circuits beïnvloeden neurale stamcellen biologie, neuronale differentiatie / functionele integratie, ontwikkeling van neurale aandoeningen en kanker blijft onontgonnen. Het onderhoud van deze netwerken door koninkrijken maakt van de mogelijkheden van genetische systemen zoals Drosophila melanogaster instrumenteel om onontgonnen cellulaire routes, waarb…
The authors have nothing to disclose.
Dit werk werd ondersteund door het Institut National de la Sante et de la Recherche Medicale, giet het Centre National de la Recherche Scientifique, de Universite de Strasbourg, het Hôpital de Strasbourg, de Vereniging la Recherche sur le Cancer, het Institut National du Cancer, de Agence Nationale de la Recherche en de Elzas.
Pietro Laneve werd ondersteund door de Fondation pour la Recherche Medicale. Momenteel is hij een ontvanger van een Istituto Italiano Tecnologia (IIT) fellowship. Publicatiekosten worden ondersteund door de Neurex netwerk (TriNeuron – Programma Interreg IV Boven-Rijn)
FINAL COMPOSITION/NAME | COMPANY | CATALOGUE (Stock) | COMMENTS |
GENERAL REQUIREMENT | |||
Centrifuge, 5418 | Eppendorf | 5418 000.017 | |
Decontaminant, RNase Away | Sigma-Aldrich | 83931 | Apply on glass/plasticware, wipe and rinse |
RNase inhibitor, DEPC | Sigma-Aldrich | D5758 | Hazardous //// 1609-47-8 |
0.1 % DEPC suspension | Incubate 2 hr at 37 ˚C, then sterilize by autoclave | ||
SAMPLE PREPARATION | |||
Stereo Microscope, M60 | Leica | ||
1X PBS Buffer | |||
137 mM NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
2.7 mM KCl | Sigma-Aldrich | P9541 | 7447-40-7 |
10 mM Na2HPO4 | Sigma-Aldrich | S3264 | 7558-79-4 |
1.8 mM KH2PO4 | Sigma-Aldrich | P9791 | 7778-77-0 |
RNA EXTRACTION/ANALYSIS | |||
UV-Vis Spectrophotometer | Thermo Scientific | Nanodrop 2000 | |
Gel Imager, ChemiDoc XRS+ | Biorad | 170-8265 | |
Horizontal Electrophoresys, Mini-Sub Cell GT | BioRad | 170-4487EDU | |
RNA extraction reagent, TRIzol Reagent | Life Technologies | 15596026 | Hazardous |
PCA (25:24:1), 1:1 for extraction | Sigma-Aldrich | 77617 | 136112-00-0 |
Chlorophorm, 1:1 for extraction | Sigma-Aldrich | C2432 | 67-66-3 |
EtOH, 2.5 vol. for precipitation, 70% for washing | Sigma-Aldrich | 59844 | 64-17-5 |
Gene Ruler 1Kb DNA Ladder | Thermo Scientific | SM0311 | |
Stop Mix | |||
300 mM NaOAc, pH 5.5 | Sigma-Aldrich | S2889 | 127-09-3 |
1x RSB Solution | |||
2% sodium dodecyl sulfate (SDS) | Sigma-Aldrich | 71736 | Never cool down SDS to avoid precipitation //// 151-21-3 |
2 mg/ml Proteinase K | Roche Applied Science | 0-3115828001 | EC 3.4.21.64 9 |
10X Reticulocyte Standard Buffer (RSB) | |||
100 mM Tris-Cl, pH 7.4 | Sigma-Aldrich | T5941 | 1185-53-1 |
100 mM NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
30 mM MgCl2 | Sigma-Aldrich | M8266 | 7786-30-3 |
Denaturing Agarose Gel | |||
1.2% Agarose | Sigma-Aldrich | A9539 | Let the gel solidify for at least 1 hr //// 9012-36-2 |
1x MOPS Buffer | Add when T < 60 ˚C | ||
3% formaldehayde | Sigma-Aldrich | F8775 | Hazardous. Add when T < 60 ˚C //// 50-00-0 |
10X MOPS Buffer | |||
0.2 M MOPS sodium salt, pH 7 | Sigma-Aldrich | M9381 | Do not confuse MOPS sodium salt with MOPS //// 71119-22-7 |
Agarose Loading Dye | |||
1x MOPS Buffer | |||
3% formaldehyde | Sigma-Aldrich | F8775 | Hazardous //// 50-00-0 |
50% formamide | Sigma-Aldrich | 47670 | Hazardous //// 75-12-7 |
Ethidium bromide (EtBr) 30 μg/ml | Sigma-Aldrich | E1510 | Hazardous //// 1239-45-8 |
Bromophenol blue | Sigma-Aldrich | B0126 | 115-39-9 |
SMALL RNA FRACTIONATION | |||
Flat gel loading tips | Life Technologies | LC1002 | |
Savant SpeedVac Concentrator | Thermo Scientific | DNA120 | |
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell | Biorad | 165-8000 | |
Denaturing Acrilamide Gel | |||
10% acrylamide/bis-acrylamide (19:1) | Sigma-Aldrich | A3449 | Hazardous. Let the gel polymerizefor 45 min before use |
1x TBE Buffer (or 1x MOPS Buffer) | |||
7 M urea | Sigma-Aldrich | U6504 | 57-13-6 |
0.1% ammonium persulfate | Sigma-Aldrich | 215589 | 7727-54-0 |
0.1% TEMED | Sigma-Aldrich | T9281 | 110-18-9 |
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) | Thermo Scientific | SM1211 | Label 0.1 μg, as described in the "probe labeling" reaction |
Acrylamide Blue Dye | |||
50% formamide | Sigma-Aldrich | 47670 | Hazardous //// 75-12-7 |
Bromophenol blue | Sigma-Aldrich | B0126 | 115-39-9 |
Running Buffer (RB) | |||
1x MOPS Buffer | |||
Alternative RB: 1x TBE Buffer | |||
1x TBE Buffer | |||
5X TBE | |||
445 mM Tris-base | Sigma-Aldrich | T1503 | 77-86-1 |
445 mM boric acid | Sigma-Aldrich | B7901 | 10043-35-3 |
20 mM EDTA | Sigma-Aldrich | EDS | 60-00-4 |
Gel Staining Solution | |||
Ethidium bromide 0.5 μg/ml | Sigma-Aldrich | E1510 | Hazardous //// 1239-45-8 |
1x RB | Stain for 15 min with EtBr, destain for 15 min w/o EtBr | ||
BLOTTING | |||
3MM Whatman paper | Sigma-Aldrich | Z270849 | |
Neutral Nylon Membrane, Hybond NX | GE Healthcare Life Science | RPN203T | Photosensitive |
CROSSLINKING | |||
Crosslinking Solution (XLS) | |||
1% 1-methylimidazole (v/v) | Sigma-Aldrich | 336092 | Always prepare a fresh aliquot of XLS //// 616-47-7 |
12.5 mM HCl | Sigma-Aldrich | H1758 | Hazardous //// 7647-01-0 |
3.1% EDC (w/v) | Sigma-Aldrich | 3450 | 25952-53-8 |
(PRE)-HYBRIDIZATION | |||
Liquid Scintillation Counter | Beckmann | LS 6500 | |
Sheared Salmon Sperm, 0.1 mg/ml | Life Technologies | AM9680 | |
rasi4 antisense probe | 5' CGGUGUUCGACAGUUCCUCGGG -3' | ||
5s-rRNA antisense probe | 5'-CAACACGCGGTGTTCCCAAGCCG-3' | ||
Dmel-miR279 antisense probe | 5'-TTAATGAGTGTGGATCTAGTCA-3' | ||
Dmel-miR286 antisense probe | 5'-AGCACGAGTGTTCGGTCTAGTCA-3' | ||
Purification Kit, Illustra MicroSpin G-25 Columns | GE Healthcare Life Science | 27-5325-01 | |
(Pre)-Hybridization Solution (HS) | |||
6x SSPE | Pre-warm HS at 37 ˚C before use | ||
0.5% SDS | Sigma-Aldrich | 71736 | 151-21-3 |
5x Denhardt's Solution | |||
20X SSPE | |||
3.6 M NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
0.2 M sodium phosphate | Sigma-Aldrich | 342483 | 7601-54-9 |
20 mM EDTA (pH 8.0) | Sigma-Aldrich | EDS | 60-00-4 |
50x Denhardt's Solution | |||
1% Ficoll 400 (w/v) | Sigma-Aldrich | F2637 | 26873-85-8 |
1% Polyvinylpyrrolidone | Sigma-Aldrich | PVP40 | 9003-39-8 |
1% BSA | Sigma-Aldrich | A7906 | 9048-46-8 |
1X TEN Buffer | |||
10 mM Tris-Cl (pH 8.0) | Sigma-Aldrich | T1503 | 77-86-1 |
100 mM NaCl | Sigma-Aldrich | S3014 | 7647-14-5 |
1 mM EDTA (pH 8.0) | Sigma-Aldrich | EDS | 60-00-4 |
Probe Labelling | |||
0.4 μM oligonucleotide | |||
1.5 μl Ci/μl [γ-32P] ATP | Perkin Elmer | NEG002A | Hazardous //// 51963-61-2 |
1x T4 Polynucleotide Kinase Buffer | Biolabs | B0201 | |
T4 Polynucleotide Kinase 0.5 units/μl | Biolabs | M0201 | EC 2.7.1.78 |
30 min at 37 ˚C, stop by 20 mM EDTA | |||
WASHING | |||
Geiger Mueller Detectors | Canberra Industries | MCB2/CPS – EM77021 | |
Washing Buffer (WB), 2x SSPE | |||
Stringent Washing Buffers | |||
0.2x SSPE | |||
2x SSPE, 0.5% SDS | |||
0.2x SSPE, 0.5% SDS | |||
SIGNAL DETECTION | |||
PharosFX Plus System | Biorad | 170-9460 | |
Image J | Freely available | ||
Quantity One | Biorad | ||
X-ray films , BioMax XAR | Sigma-Aldrich | F5888 | Photosensitive |
Developer for X-ray films | Sigma-Aldrich | P7042 | |
Fixer for X-ray films | Sigma-Aldrich | P7167 | |
STRIPPING | |||
Stripping Solution | |||
10 mM Tris-HCl pH 8.8 | Sigma-Aldrich | T1503 | 77-86-1 |
5 mM EDTA | Sigma-Aldrich | EDS | 60-00-4 |
0.1% SDS | Sigma-Aldrich | 71736 | Add SDS after boiling to avoid foaming //// 151-21-3 |