Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Pairwise croissance de la concurrence analyse pour déterminer la condition physique réplication du virus de l'immunodéficience humaines

doi: 10.3791/52610 Published: May 4, 2015

Introduction

La réplication virale remise en forme est définie comme la capacité d'un virus à produire une descendance infectieuse dans un environnement donné 1 et est un facteur important dans la détermination de la prévalence d'une variante du virus au niveau de la population au fil du temps 2. Comme les études in vivo de remise en forme ne sont pas réalisables avec des virus pathogènes humains, telles que le VIH-1, divers in vitro et ex vivo tests de conditionnement physique de réplication ont été développés pour étudier les effets sur la condition physique découlant de la résistance aux médicaments et des mutations d'échappement immunitaire, épistasie et de l'évolution des populations virales 3-6. Parmi les différents tests de conditionnement physique, des essais de compétition de croissance sont reconnus pour obtenir des mesures plus sensibles et valides de différences de forme physique, comme deux ou plusieurs variantes virales en compétition pour la même population cellulaire exactement dans les mêmes conditions environnementales, comme cela se produit in vivo 1,7,8. Avant de commencer des expériences de compétition de croissance, plusieurs variables besoin d'être déterminée, y compris l'utilisation de différentes multiplicités d'infection (MOI), le ratio d'entrée virale, et le calendrier de l'échantillonnage pour analyse. Nous avons étudié les effets de ces paramètres sur la cinétique de croissance virales et sur ​​les résultats des expériences de compétition, et nous avons identifié des facteurs clés nécessaires pour les mesures robustes de VIH-1 de remise en forme dans la culture de cellules 9.

En plus des variables d'analyse, il existe une variété de méthodes pour la quantification de variants viraux dans des expériences de compétition de croissance. Bulk 10,11 ou 12,13 clonale séquençage a été utilisé pour déterminer le rapport des virus concurrentes sur la base des fréquences de nucleotides au niveau du site (s) d'intérêt. Remise en forme relative est dérivé de variations de ce ratio au fil du temps. Cette méthode est pratique que des services de séquençage d'ADN sont largement disponibles. Le séquençage spécifique d'allèle parallèle méthode (PASS) permet le séquençage à des sites multiples et la détection de recombinants 14 15 ou synonymes mutations 4,16-18 que des étiquettes pour distinguer les virus concurrents par séquençage, tests de suivi hétéroduplex (ETS) 4,7,17,19 ou inverser PCR quantitative transcription quantitative (RT-qPCR) 15,16,18,20, qui peuvent tous être rendue applicable à étudier souches concurrence indépendamment de similarité de séquence. Une étape supplémentaire est nécessaire pour introduire les mots-clés dans les génomes viraux et le dosage par RT-PCR quantitative nécessite également des réactifs et des instruments spécifiques. Nous avons constaté que vrac séquençage Sanger donne des résultats comparables 9.

Suite à la concurrence de la croissance, la réplication virale remise en forme est présentée comme remise en forme relative, ou un rapport de remise en forme entre two variants viraux. L'aptitude relative d'un virus peut être défini comme la proportion finale d'une variante virale normalisée par sa proportion dans l'inoculum initial ou à la différence nette du taux de croissance entre les deux virus concurrentes. Nous avons constaté que cette dernière méthode, en utilisant les points de données longitudinales que dans la phase exponentielle de croissance, a donné les résultats les plus robustes 9,20.

Les essais in vitro de remise en forme sont utilisés principalement pour étudier clones biologiques 6-8 et clones moléculaires infectieux du VIH-1. Ce dernier, se prêter à la manipulation génétique, sont souvent employés pour étudier l'effet sur ​​l'aptitude de certaines mutations ou des séquences spécifiques d'intérêt 3-5,21,22. Les protocoles suivants décrivent un flux de travail du point de construire de nouvelles pleine longueur infectieuses VIH-1 clones moléculaires du VIH-1 en utilisant des vecteurs contenant un marqueur de séquence, l'introduction de mutations d'intérêt, faisant stocks viraux et d'établir la cinétique de croissance virales, De réaliser le dosage de la concurrence de la croissance et de calcul physique relative (Figure 1).

Grâce à nos procédures optimisées, nous avons créé trois mutants recombinants du VIH-1 et déterminé leur aptitude de réplication. Le clone moléculaire recombinant a été construit en remplaçant la région des gènes du VIH-1 gag-p24 de pNL4-3, un plasmide contenant une longueur génome complet infectieuse du VIH-1 souche de laboratoire NL4-3, avec un COTB synthétique (Centre-of Arbre, sous-type B) séquence gag-p24 23 pour créer la souche prototype. Acides changements simples (T186M, T242N et I256V) ont ensuite été introduits pour créer trois clones mutants. Chaque mutant a été disputé contre le virus prototype d'observer l'impact de fitness de chaque mutation dans le fond génétique donné. Les trois mutants ont démontré des niveaux de réplication fsitness variant de légère à significativement plus faible que le virus prototype. La mutation a été précédemment rapporté T242N d'avoir un Fitne modéréess coûte 24 à 26, similaire au résultat montré dans cette étude. Le coût de la remise en forme des deux autres mutations avait pas été signalé précédemment.

Protocol

REMARQUE: Le protocole, tel que décrit ci-dessous, ne comprend aucune information identifiable patient et est donc pas considéré comme des sujets humains de la recherche par l'Université de Washington institutionnelle Conseil d'examen ou la Division des sujets humains.

1. Construction d'chimérique VIH-1 NL4-3 clones moléculaires

1.1) Amplify Insérer fragment d'ADN

  1. Concevoir des amorces chimériques. Moitiés 5 'des deux amorces sens et antisens contiennent une séquence de vecteur VIH-1, au cours de laquelle le fragment sera inséré. La moitié 3 'des amorces doivent contenir la fin de la séquence d'insertion (figure 2). Assurez-vous que la séquence de l'amorce chimère conserve les cadres ouverts de lecture originales.
    1. Utilisation des amorces d'au moins 20 bases de longueur, avec une température de fusion supérieure ou égale à 60 ° C, ~ 50% de teneur en GC, et une faible tendance à former des dimères d'amorces, des hétérodimères et / ou des structures en épingle à cheveux. Évaluer ces propriétésl'aide de l'outil Web OligoAnalyzer ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. Utilisation PCR et les 27 amorces chimères pour amplifier l'ADN d'insertion (figure 2). Pour chaque réaction PCR, utiliser 1X tampon de haute fidélité, 0,2 mM de dNTP, 1 U de la haute fidélité de l'ADN polymérase, 0,5 M de amorce chimère avant, 0,5 M de amorce chimère inverse, et 1 PG0 ng d'échantillon d'ADN portant région d'insertion. Ajouter dH 2 O pour obtenir un volume final de 50 ul.
  3. Réglez étapes thermiques de cyclisme comme suit: Effectuez une étape initiale de dénaturation à l'ADN 98 ° C pendant 10 sec. Amplifier par 30 cycles de dénaturation d'ADN à 98 ° C pendant 10 s et hybridation à l'ADN de 3 ° C au-dessus de la plus basse température de fusion des deux amorces pendant 20 s. Effectuez une extension finale à 72 ° C pendant 10 min. Boutique produits de PCR à 4 ° C.
  4. Prendre 5 pi des produits de PCR à partir de laétape précédente et exécuter gel d'agarose électrophorèse 28.
    1. Utilisez un gel à 0,7% d'agarose, un tampon TAE 1X (40 mM Tris-acétate, 1 mM d'EDTA), 0,5 pg / ml de bromure d'éthidium (EtBr) et une concentration finale de 1 kb ladder comme marqueur de taille d'ADN. Ensemble tension de source d'alimentation à 5 V / cm de distance entre les électrodes. Arrêter l'électrophorèse lorsque le colorant de charge migre par environ 2/3 de la longueur du gel. Visualisez du gel en utilisant un système de documentation de gel 28.
      NOTE: EtBr est soupçonné d'être cancérigène et doit être correctement éliminés, conformément aux règlements de l'institution. Les gants doivent toujours être portés lors de la manipulation des gels contenant EtBr. Changez de nouveaux gants après EtBr de manutention de matériaux contenant de finition et avant de manipuler d'autres matériaux ou d'équipements pour prévenir la contamination croisée.
  5. Si une seule bande d'ADN correspondant à la taille du produit de PCR souhaité est détecté, le reste de purifier le produit de PCR en utilisant un kit commercial tel que le QIAquick PCR Purification Kit accordment aux protocoles du fabricant.
    1. Si d'autres bandes non spécifiques sont également présents, utiliser le reste du produit de PCR afin de fonctionner électrophorèse sur gel préparatif. Utilisez les mêmes paramètres et les conditions spécifiées à l'étape 1.1.4. Assurez-vous que le puits de gel est suffisamment grande pour charger ~ 45 pi de produits de PCR. Découper la bande d'intérêt et extraire l'ADN à partir du gel en utilisant le kit d'extraction QIAquick gel selon les protocoles du fabricant.

1.2) Introduire le fragment d'insertion en pleine longueur infectieuses VIH-1 sous-type B Vector (pNL4-3)

  1. Utilisation des produits de PCR purifiés de l'étape 1.1.5 en tant qu'amorces de PCR. Utilisez pNL4-3VifA 20 comme matrice d'ADN dans une réaction PCR et utiliser pNL4-3VifB 20 comme matrice dans l'autre réaction (Figure 2). Pour chaque réaction PCR, en utilisant un tampon de haute fidélité 1x, 0,2 mM de dNTP, 2 U d'ADN polymerase haute fidélité, 500 ng d'amorce d'ADN et 50 ng d'ADN matrice dans un volume finaleume de 50 pi. Régler les paramètres de cyclage thermique à 98 ° C pendant 30 sec, 35 cycles à 98 ° C pendant 10 sec, 48 ° C pendant 1 min et 72 ° C pendant 10 min, suivi par 72 ° C pendant 10 min.
  2. Ajouter 10 U de Dpn I à 50 ul de la réaction de PCR et incuber à 37 ° C pendant 1 heure pour digérer l'ADN de matrice. Assurez-vous que l'ADN plasmidique est isolé à partir d'une méthylation de la souche bactérienne compétente, par exemple., Escherichia coli TOP10 chimiquement compétentes.
  3. Utiliser Dpn I digéré produit à transformer des cellules bactériennes compétentes. Utilisez transformation de choc thermique avec TOP10 chimiquement compétentes E. coli, selon le protocole du fabricant. Pour sélectionner les cellules bactériennes contenant le plasmide recombinant, utilisez du bouillon de Luria (LB) des plaques de culture contenant 100 mg / l de carbénicilline.
    1. Choix ~ 10 colonies bien séparées et cultiver séparément chacun dans 3 ml de milieu liquide LB contenant 100 mg / l de carbénicilline et incuber à 30 ° C dans unshaker O / N.
    2. Utilisation QIAprep Spin Miniprep Kit pour isoler l'ADN plasmidique à partir de la culture bactérienne liquide, selon le protocole du fabricant.
  4. Utiliser le double digestion de restriction 29 pour déterminer si l'ADN plasmidique contient l'insert correct. Assurez-vous que l'un des sites de restriction existe uniquement dans la région de l'insert et l'autre site de restriction existe une seule fois dans le vecteur du VIH-1, à l'extérieur de la région d'insertion.
    1. Digest au moins 300 ng d'ADN de plasmide dans un volume réactionnel final de 10 ul. Sélectionner les tampons de restriction, la température d'incubation et le temps d'incubation selon le protocole du fabricant des enzymes de restriction choisies. Prenez 9 pi de la électrophorèse de l'ADN et le gel de l'exécution digéré comme décrit à l'étape 1.1.4. Sélectionner les plasmides recombinants qui ont des bandes d'ADN de la taille prédite.
  5. Confirmer l'intégrité de la séquence des plasmides recombinants par séquençage de Sanger. Bien que rare, non désirésmutation (s) peut être introduit au cours des réactions PCR.
    1. Séquence les deux brins de l'ADN plasmidique. Suivez les instructions à l'étape 1.1.1.1 pour concevoir des amorces de séquençage. En outre, en sorte que la marche avant et arrière des amorces de séquençage recuit d'au moins 50 pb en amont et en aval de la région d'insertion dans le plasmide recombinant, respectivement.
    2. Soumettre un ADN plasmidique et des amorces de séquençage à un fournisseur de services de séquençage d'ADN du commerce. Préparer l'échantillon d'ADN et d'amorces tel que spécifié par le fournisseur de services.
  6. Faire une image libre endotoxine de l'ADN du plasmide muté en utilisant un kit d'ADN plasmidique sans endotoxine selon le protocole du fabricant. Préparer au moins 1 ug d'ADN de plasmide exempt d'endotoxine pour la transfection dans l'étape suivante.

1.3) Présentez à petite échelle mutations Via mutagenèse dirigée

  1. Concevoir des amorces mutagènes qui se chevauchent amorces sens et antisens contenant l'mutat souhaitéeion (s). Positionner la base (s) d'être substitués, insérés ou supprimés dans le milieu des amorces, flanqué de 10 à 15 bases homologues. Suivez les instructions à l'étape 1.1.1.1.
  2. Utilisation PCR pour synthétiser des plasmides mutants. Pour chaque réaction PCR, en utilisant un tampon de haute fidélité 1x, 10 mM des dNTP, 2 U d'ADN polymerase haute fidélité, 0,5 uM de l'amorce mutagene directe, 0,5 uM de l'amorce mutagene inverse et 50 ng de pNL4-3VifB chimérique, provenant de l'étape 1.2.6 , dans un volume final de 50 ul. Régler les paramètres de cyclage thermique à 98 ° C pendant 30 sec, 25 cycles à 98 ° C pendant 10 sec, 48 ° C pendant 1 min et 72 ° C pendant 10 min, suivi par 72 ° C pendant 10 min.
  3. Répétez l'étape 1.2.2 à 1.2.6.

2. Génération de Viral Stock Utilisation transfection

  1. Calculez le montant des virale stock souhaité et le plasmide ADN requis. Avec un titre viral de 10 4 UI / ml ou plus, 1,8 ml de stock virale est suffisante pour deux séries de compétition de croissance assays, y compris monoinfections, fait chacun en trois exemplaires. Pour une transfection fait dans une plaque à 6 puits, environ 1,8 ml surnageant est récolté par puits. Un pg d'ADN de plasmide est nécessaire pour chaque transfection effectuée dans une plaque à 6 puits.
  2. Pour chaque puits d'une plaque à 6 puits, 100 ul de la préparation du mélange de transfection, par exemple., Consistant en une pi X-9 tremeGENE réactif de transfection (ou un produit comparable), 1 pg d'ADN de plasmide et du DMEM exempt de sérum.
    1. Déterminer le volume de l'ADN plasmidique nécessaire, en utilisant 1 pg d'ADN plasmidique par puits. Assurez-vous que la concentration finale de l'ADN de plasmide est d'au moins 50 ng / ul.
    2. Déterminer la quantité de milieu exempt de sérum (DMEM) est nécessaire par puits en utilisant la formule: Volume total de DMEM dans 100 ul ul = - volume de l'ADN dans ul.
  3. Ajouter 10 6 HEK 293T-17 (ATCC) cellules / puits dans 2 ml de milieu de propagation (DMEM + 10% de sérum bovin fœtal (FBS)) dans une plaque à 6 puits. Incuber pendant 1 heure à 37 ° C dans unAtmosphère de 5% de CO 2. Ensemencer autant de puits nécessaire (déterminées à l'étape 2.1).
  4. Pour préparer le mélange de transfection, aliquoter le volume approprié de DMEM sans sérum, tel que calculé ci-dessus, dans un tube à centrifuger de 1,8 ml de polypropylène, puis ajouter le réactif de transfection.
    1. réactif pipette directement dans la solution des médias, ne pas ajouter à la surface plastique du microtube. Ajouter ADN plasmidique dernière. Pipet et doucement pour mélanger la solution. Incuber pendant 15 min à température ambiante (15 ° C à 25 ° C) pour permettre la formation de complexes de transfection.
    2. Ajouter le mélange d'une manière goutte à goutte à des cellules ensemencées dans la plaque à 6 puits. Secouer ou agiter les puits pour assurer une distribution uniforme des complexes de transfection doucement.
    3. plaques d'étanchéité avec une pellicule de plastique.
  5. Incuber les cultures à 37 ° C dans une atmosphère de CO2 à 5% pendant 48 heures.
  6. Utiliser une pipette pour recueillir et transférer le surnageant dans un tube de 15 ml soigneusement through un sommet de 0,22 um filtre.
  7. Utiliser une pipette pour transférer 250 pi ou plus du surnageant filtré à 1,8 ml des tubes de microcentrifugation de joints en caoutchouc dans les couvercles.
  8. Magasin filtré les surnageants à -80 ° C jusqu'à utilisation.

3. Déterminer infectieuses Titer des stocks viraux sur des cellules mononucléaires du sang périphérique (CMSP)

  1. Stimuler CMSP avec phytohémagglutinine (PHA). Par un stock virale, graine 2 x 10 6 CMSP en milieu de Dulbecco modifié complet d'Iscove (cIMDM; IMDM supplémenté avec 20 U / ml d'interleukine 2 humaine (hIL-2), 10% de sérum fœtal bovin et 1% de pénicilline / streptomycine) complétée avec de la PHA (1,5 pg / ml). CMSP de semences à 2 x 10 6 cellules / ml. Incuber PBMC à 37 ° C dans une atmosphère de CO2 à 5% pendant 72 heures.
  2. Récolte PHA CMSP stimulées. Transfert non adhérente PHA-PBMC dans un tube conique de 50 ml. Spin le tube à 228 g pendant 10 min. Retirez délicatement le surnageant sans disrupting le culot cellulaire. Remettre en suspension le culot de cellules à une concentration finale de 2 x 10 5 / ml dans du PBMC cIMDM.
  3. Seed 2 x 10 4 PHA CMSP stimulées / puits dans 100 pl / puits cIMDM dans un plat rond de 96 puits à fond.
  4. Faire une dilution 1:10 du stock viral. Puis, à partir du premier stock dilué, faire douze dilutions en série de 3 fois dans une plaque de maître de 96 puits. Ce schéma de dilution est recommandé pour détecter les titres viraux dans la plage de 4 oct-6 oct unité infectieuse (UI) par ml.
    1. Par exemple, ajouter 20 pi de stock de virus à 180 pi médias dans le tube de 1,5 ml. Mélanger la dilution en pipetant soigneusement. Puis transférer 90 ul du stock dilué dans 180 médias ul du premier puits et bien mélanger par pipetage.
    2. Continuer la série de dilution en transférant 90 ul du puits actuel à 180 pi médias dans le prochain puits onze fois plus. Augmenter ou diminuer la dilution initiale si des titres plus élevés de 10 6 UI / mlou inférieure à 10 4 UI / ml sont prévus, respectivement.
  5. Ajouter 40 ul du stock viral dilué en série à partir de la plaque maître de dilution à la plaque CMSP tête de série (de l'étape 3.3) en quadruple. Incuber les plaques à 37 ° C dans une atmosphère de CO2 à 5% pendant 16 à 24 heures.
  6. Retirez délicatement 100 pi de surnageant de chaque puits, et les remplacer par 160 pi de cIMDM frais pour un volume total de 200 pl / puits. Incuber les plaques à 37 ° C avec 5% de CO2 atmosphère (jour 1).
  7. Les jours 4, 7, 10 et 13 transfert 100 pi de surnageant de chaque puits à 100 tampon de rupture pi (2% de Triton-100 dans du PBS), et les remplacer par 100 pi de cIMDM frais. Rangez les surnageants à -20 ° C.
    1. Gardez l'échantillonnage et en ajoutant cIMDM frais tous les trois jours jusqu'à ce que le titre se stabilise.
  8. Déterminer la dose de 50% de la culture de tissus infectieux (DICT 50) du stock viral p24 par ELISA en utilisant le jour 7 et 13 échantillons comme décrit dans l'étape 4.
    1. Si le DICT 50 obtenue à partir de 13 jours est nettement plus élevé que le titre du jour 7, le stock de virus peut avoir besoin de plus de temps pour se développer. Répétez le p24 ELISA utilisant des échantillons plus tard jusqu'à ce que les titres infectieux de deux points dans le temps échantillonnage deviennent stables (ou diminution). Sélectionnez les stocks à partir d'échantillons avec les titres les plus élevés.

4. ELISA (Enzyme-linked immunoabsorbant Assay) de détection du VIH-1 pour la détermination de p24 virale infectieuse Titer

REMARQUE: Le protocole suivant a été développé en utilisant des plaques de capture de l'antigène p24 préparés dans notre laboratoire 30. Commercial VIH-1 p24 plaque ELISA / kits peuvent également être utilisés, en suivant le protocole du fabricant.

  1. Avant de travailler avec des échantillons, préparer des stocks de travail de l'anticorps primaire (de lapin anti-VIH-1 p24 antisérum SF2).
    1. Thaw antisérum p24 à TA.
    2. Mélanger 2,5 ml de glycerol à 2 ml de 10% de FBS dans phosphate saline de tampon (PBS).
    3. Ajouter 0,5 ml de sérum et mélanger.
    4. Magasin 1 ml d'aliquotes à -20 ° C.
  2. Décongeler les échantillons de l'étape 3.7 dans un incubateur à 37 ° C.
  3. Laver la plaque de capture p24 5 fois avec un tampon de lavage (1x PBS avec 0,05% de Tween-20).
  4. Ajouter 50 ul / puits de tampon pour échantillon (1% d'albumine de sérum bovin (BSA), 0,2% de Tween-20 dans du RPMI-1640), puis ajouter 50 ul d'échantillon dans les puits appropriés. Inclure au moins trois puits avec le diluant pour échantillons seulement comme des contrôles simulés / négatifs. Incuber pendant 2 heures à 37 ° C ou O / N à 4 ° C.
  5. Préparer la solution d'anticorps primaire frais avant utilisation. Ajouter un 1: 2000 dilution de l'anticorps primaire stock de travail en utilisant le diluant d'anticorps primaire (12% de FBS dans du RPMI-1640). Assurez-vous de préparer suffisamment pour l'utilisation de la solution de 100 pi par chaque échantillon / contrôle d'un puits dans une plaque de 96 puits.
    1. Par exemple, pour faire suffisamment de solution pour une plaque de 96 puits, ajouter 5 pl de la worki d'anticorps primaireng actions au diluant d'anticorps primaire à un volume final de 10 ml.
  6. Laver la plaque de capture 5 fois avec un tampon de lavage.
  7. Ajouter 100 ul de la solution d'anticorps primaire à chaque puits. Incuber pendant 1 heure à 37 ° C dans une atmosphère de CO2 à 5%.
  8. Préparer la solution d'anticorps secondaire frais avant utilisation. Ajouter un 1: 14 400 fois la dilution de l'anticorps secondaire (1 mg / ml de chèvre anti-lapin HRP) à l'aide du diluant d'anticorps secondaire (7% de FBS, 0,01% de Tween-20 dans du RPMI-1640). Pour réduire les erreurs de pipetage, effectuer une dilution en série en deux étapes. Assurez-vous de préparer suffisamment pour l'utilisation de la solution de 100 pi par chaque échantillon / contrôle d'un puits dans une plaque de 96 puits.
    1. Par exemple, pour faire suffisamment de solution pour une plaque de 96 puits, d'abord ajouter 1 pl de l'anticorps secondaire 99 pi du diluant d'anticorps secondaire. Ensuite, ajouter 70 pi de dilution de la première diluant d'anticorps secondaire pour un volume final de 10 ml.
  9. Laver la plaque de capture 5 times avec le tampon de lavage.
  10. Ajouter 100 ul de la solution d'anticorps secondaire dans chaque puits. Incuber pendant 1 heure à 37 ° C dans une atmosphère de CO2 à 5%.
  11. Laver la plaque 5 fois avec le tampon de lavage.
  12. Ajouter 100 pi de substrat TMB RT. Incuber 30 minutes à température ambiante dans un récipient fermé à l'abri de la lumière.
  13. Ajouter 100 ul de solution d'arrêt RT (1 NH 2 SO 4).
  14. Lire l'absorbance à 450-650 nm dans chaque puits en utilisant un lecteur de microplaques. Utilisez la valeur d'absorbance de marquer ainsi que chaque infecté ou non infecté. Envisager un puits pour contenir le virus infectieux si la valeur d'absorbance est au moins trois fois plus élevé que la valeur lue dans simulacres / négative puits de contrôle. Calculer DICT 50 du stock viral en utilisant la méthode de Reed-Meunch 31.

5. Mettre en place la cinétique de croissance virale

5.1) mono-infection

  1. Seed 3 x 10 5 PHA stimulée PBMC / puits dans 48 puits plaques dans un volume total de 500 pl / puits. Gardez les plaques de culture à 37 ° C dans une atmosphère de CO 2 de 5% jusqu'à ce que l'inoculation.
  2. Pour chaque virus, préparer un inoculum contenant 6000 UI dans 2 ml de cIMDM.
  3. Inoculer des puits en triple exemplaire, en ajoutant 500 pi de l'inoculum (1500 UI) pour les cellules ensemencées. Le volume final de la culture cellulaire infectée est de 1 ml / puits et le MOI est de 0,005.
  4. Aliquote de 200 pi de l'inoculum restant à chacune des deux plaques à 96 puits pour l'isolement de l'ARN, dont l'un est enregistré comme une sauvegarde.
  5. Incuber les cultures à 37 ° C dans une atmosphère de CO2 à 5% pendant 16 à 24 heures.
  6. Laver les cultures 16-24 h après l'inoculation.
    1. Retirez et jetez 750 pi de surnageant de culture.
    2. Ajouter 750 pi de cIMDM frais. Enveloppez plaques dans une pellicule de plastique et de spin pendant 10 minutes à 300 x g. Retirez et jetez 750 surnageant ul.
    3. Ajouter 750 pi de cIMDM frais. Incuber à 37 ° C avec 5% de CO2 àmosphere (jour 1).
  7. Cultures exemples quotidiens du jour 2 au jour 7.
    1. Transférer 500 ul de surnageant de culture dans un tube de 1,8 ml de la centrifugeuse. Spin pendant 1 min à 3000 x g.
    2. Transfert 200 pi du surnageant acellulaire aux deux plaques d'échantillons à 96 puits pour l'isolement de l'ARN, sauvant à nouveau une plaque de sauvegarde. Les surnageants de conserver à -80 ° C jusqu'à l'isolement de l'ARN.
    3. Ajouter cIMDM 500 pi frais à chaque culture. Incuber à 37 ° C dans une atmosphère de CO2 à 5%.
    4. Jeter les cultures dans Wescodyne à la fin de l'expérience.
    5. Isoler l'ARN à partir de 200 pi de surnageant (utilisation de kits commerciaux tels que QIAamp Viral RNA Mini Kit) suivantes protocole standard du fabricant. Pour un grand nombre d'échantillons, utilisez le Qiagen QIAxtractor.
    6. Des échantillons d'ARN de conserver à -80 ° C jusqu'à ce que la synthèse d'ADNc.

5.2) Synthèse d'ADNc (Reverse Transcription)

  1. Pour chaque ARN deexemple, ajouter 1,2 nmoles de dNTP et 1,2 pmol d'amorce la synthèse d'ADNc, (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', HXB2 nucleotides 7968 à 7995) à 10 ul de l'ARN viral. Ajouter de l'eau jusqu'à un volume final de 14 ul. Flick le tube pour mélanger et centrifuger brièvement pour recueillir liquide au fond du tube.
  2. Incuber le mélange pendant 5 min à 65 ° C, puis maintenez à 4 ° C jusqu'à ce que le mélange maître est préparé.
  3. Préparer master mix en utilisant 5x premier brin tampon (250 mM Tris-HCl, pH 8,3, 375 mM de KCl, 15 mM MgCl 2), 5 mM de DTT, 120 U de SuperScriptIII et 240 U de RNase Inhibitor. Ajouter de l'eau à un volume final de 10 ul.
  4. Ajouter 10 pi de mélange maître au mélange d'ARN, film de mélanger et tourner à collecter.
  5. Incuber le mélange pendant 90 min à 50 ° C pour permettre la synthèse de l'ADNc. Incuber pendant 15 min à 70 ° C pour inactiver la transcriptase inverse. Maintenir à 4 ° C si nécessaire.
  6. Ajouter 2 U de RNase H, film pour mélanger, puis tourner à collecter.
  7. Incuber 20 minà 37 ° C. ADNc de magasin à -20 ° C.

5.3) ADNc quantification au moyen du Système qPCR

  1. Préparer une série de dilution standard. Faites 10 fois dilution en série, à partir de 3 x 10 6 copies / ul jusqu'à 30 copies / ul, de pNL4-3VifA. Utilisez de l'eau distillée pour les dilutions. Préparer la série de dilution standard frais avant utilisation ou préparer des petits lots et de garder à -20 ° C. Ne pas congeler-décongeler les normes plus de trois fois.
  2. Mettre en place un qPCR plaque de réaction de 96 puits. Assurez-vous que chaque plaque comporte au moins un puits de témoins négatifs, un trois exemplaires de la série de dilutions standard, et au moins un double de chaque échantillon d'ADNc.
  3. Pour chaque réaction qPCR, utiliser 12,5 pi de qPCR Master Mix, 0,2 uM sonde, 0,8 pm chacune des amorces avant et arrière et 1 pi de l'ADNc ou de la série de dilution standard ou eau / tampon (pour le contrôle négatif bien). Ajouter de l'eau jusqu'à un volume final de 25 ul. La sonde qPCR est la lumière sensibles. Gardez-le dans un récipient fermé.
    1. Pour détecter l'ADNc dérivé du clone moléculaire basée pNL4-3VifA, utilisez le VIFA sonde-amorce: VifAB amorce avant (GGTCTGCATACAGGAGAAAGAGACT), VIFA amorce inverse (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') et la sonde VifAB (6FAM-5'-CTCCATTCTATGGAGACTC-3 '-MGBNFQ). Pour ADNc dérivé de clone basé pNL4-3VifB, utilisez le VifB sonde-amorce: VifAB amorce avant, sonde VifAB et VifB amorce inverse (5'-CACCTGCGTGCTATACCTTTTCT-3 ').
  4. Définir les paramètres de cyclage de PCR à 50 ° C pendant 2 min, 95 ° C pendant 10 min, et 40 cycles de 95 ° C pendant 15 sec et 60 ° C pendant 1 min. Consultez le document de support du constructeur pour le fonctionnement de la machine qPCR.
  5. Calculer une courbe standard en utilisant les données de la série de dilution standard triple. Comparer les données d'amplification de l'échantillon d'ADNc de la courbe d'étalonnage pour déterminer le nombre de copies. Consultez le document d'assistance du fabricant de datraitement ta.

5.4) Déterminer virale croissance exponentielle Phase

  1. Tracer la cinétique de croissance virales avec le jour d'échantillonnage le long de l'axe X et le nombre de copies d'ADNc le long de l'axe Y et identifier la phase exponentielle de croissance virale, à savoir., Lorsque le nombre de copies d'ADNc viraux une augmentation de la progression exponentielle.
  2. Utilisez l'outil de Web GRC ( http://indra.mullins.microbiol.washington.edu/grc/ ) pour calculer le taux de croissance virale (g). Dans cette application, l'outil GRC accepte nombre de copies d'ADNc à partir d'au moins deux points dans le temps en entrée, et délivre en sortie le taux de croissance virale (g). Utilisez uniquement des données de point de temps dans la phase de croissance exponentielle (voir étape 5.4.1 ci-dessus) pour obtenir des taux de croissance précis. Pour une description détaillée du modèle mathématique utilisé dans l'outil Web GRC, voir 20.

6. Croissance Test de compétition

  1. Graine 3 x 10 5 </ Sup> PBMC stimulés par PHA (ou 1 x 10 5 CEMx174 cellules) dans 500 pi volume total par puits dans une plaque à fond plat 48.
  2. Gardez plaque dans 37 ° C dans une atmosphère de CO 2 de 5% jusqu'à ce que l'inoculation.
  3. Pour chaque virus, préparer 3 ml d'inoculum contenant 6000 UI.
  4. Transférer 1,5 ml de chaque inoculum viral dans un tube stérile pour créer la double infection inoculum. Ajouter 500 pi de la double inoculum (1500 UI) de 3 x 10 5 cellules dans une plaque de 48 puits. Le volume de culture final est de 1 ml / puits. Aliquoter 200 ul de l'inoculum à deux plaques à 96 puits pour l'isolement de l'ARN; enregistrer une plaque comme un retour.
  5. Incuber les cellules inoculées à 37 ° C avec une atmosphère de CO2 à 5% pendant 16 à 24 heures.
  6. Laver les cultures 16-24 h après l'inoculation.
    1. Retirez et jetez 750 pi de surnageant de culture.
    2. Ajouter 750 pi de cIMDM frais. Enveloppez plaques dans une pellicule de plastique et de spin pendant 10 min à 300 x g. Retirez et jetez 75081; l surnageant.
    3. Ajouter 750 pi de cIMDM frais. Incuber à 37 ° C avec une atmosphère de CO2 à 5% (jour 1).
  7. Sélectionnez périodes d'échantillonnage à inclure au moins 3 points de temps dans la phase de croissance exponentielle observée à l'étape 5.4.1.
    1. Pour chaque prélèvement, suivez l'étape 5.1.7.
  8. Effectuer la synthèse d'ADNc, comme décrit dans la section 5.2.
  9. Déterminer le rapport de variante viral en utilisant qPCR.
    1. Préparer une série de dilutions série standard en trois exemplaires, en diluant 10 fois dans chaque étape de 3 x 10 6 copies / ul à 30 ul de copies / pNL4-3VifA.
    2. Mettre en place un qPCR plaque de réaction de 96 puits. Veiller à ce que chaque plaque contient au moins un contrôle négatif, la série de dilution standard en trois exemplaires, et des doubles de chaque échantillon d'ADNc.
    3. Pour chaque réaction qPCR, utiliser 12,5 pi de qPCR Master Mix, 0,2 uM sonde, 0,8 pm chacune des amorces sens et antisens et 1 pi de l'ADNc ou le standard d Série ilution ou eau / tampon (pour les puits témoins négatifs). Ajouter de l'eau jusqu'à un volume final de 25 ul. La sonde qPCR est sensible à la lumière, le garder dans un récipient fermé.
      1. Utilisez la sonde-amorce VIFA pour détecter des signaux dans les contrôles négatifs et la série de dilution standard et avec un duplicata de l'échantillon d'ADNc. Utilisez la sonde-amorce VifB avec l'autre exemplaire de l'échantillon d'ADNc.
    4. Définir les paramètres de cyclage de PCR à 50 ° C pendant 2 min, puis 95 ° C pendant 10 min, puis 40 cycles de 95 ° C pendant 15 s et 60 ° C pendant 1 min. Consultez le document de support du constructeur pour le fonctionnement de la machine qPCR.
    5. Calculer la courbe d'étalonnage en utilisant des données d'amplification à partir de la série de dilutions standard. Comparer les données d'amplification des échantillons d'ADNc à la courbe standard pour déterminer le nombre de copies. Consultez le document de support du constructeur pour le traitement des données.
    6. Utilisez l'outil de Web GRC (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/) pour calculer le fitness viral relative (d).
      REMARQUE: L'outil GRC accepte ADNc nombre de copies ou hauteurs chromatogramme de pointe à partir d'au moins deux points de temps que l'entrée, et délivre la différence de taux de croissance nette (d) entre les deux virus. Bien que l'outil peut calculer le taux de croissance nette de deux données de point de temps, il est fortement recommandé de données d'entrée à partir de trois points ou plus de temps. Utilisez uniquement des données obtenues à partir des points de temps dans la phase de croissance exponentielle (voir l'étape 5.4) pour obtenir des taux de croissance précis. Pour une description détaillée du modèle mathématique utilisé dans l'outil Web GRC, voir 20.
  10. Déterminer les rapports viraux utilisant chromatogram pointe-Heights
    1. Amplifier par PCR du VIH-1 Vif fragments contenant la séquence tag VifAB utilisant VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 '; HXB2 positionne 5266-5291) et VifRev amorces (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; HXB2 positions 5579 à 5553).
      1. Pour chaque réaction PCR, en utilisant 1 ul de l'ADNc, 1 x tampon de NH 4, 1,5 mM de MgCl2, 0,2 mM de dNTP, 2,5 U de Taq polymerase et 0,45 uM de chaque amorce. Ajouter de l'eau jusqu'à un volume final de 50 ul.
      2. Définir les paramètres de cyclage de PCR de trois cycles à 94 ° C pendant 1 min, 55 ° C pendant 1 min, et 70 ° C pendant 1 min, suivie de 34 cycles à 94 ° C pendant 15 s, 58 ° C pendant 30 sec, et 70 ° C pendant 1 min, puis maintenez à 4 ° C.
    2. On purifie les produits de PCR en utilisant le kit de purification QIAquick PCR selon le protocole du fabricant.
    3. Soumettre les produits de PCR purifiés à un fournisseur de services séquençage de l'ADN pour le séquençage de Sanger.
    4. Vérifiez le niveau de qualité de lecture moyenne, qui doit être fournie par le service de séquençage. Si la précision moyenne d'appel de base est inférieure à 85%, refaire l'étape 6.10.1 à 6.10.3
    5. Utilisez l'outil de web ChromatQuan (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) pour calculer le ratio virale à chaque point de temps. L'outil nécessite le fichier de trace de séquence (* de .ab1) et la séquence 5 'du site de nucléotides d'intérêt. L'outil mesure l'intensité de pointe sur le site indiqué. Le rapport de l'intensité de pic correspond à la ration des deux virus (figure 4B).
    6. Utilisez l'outil GRC web ( http://indra.mullins.microbiol.washington.edu/grc/ ) et les intensités maximales enregistrées comme entrée pour calculer remise en forme par rapport virale (d). Voir l'étape 6.10.6. 20

Representative Results

Pour étudier l'impact de remise en forme des changements d'acides aminés uniques dans le VIH-1 Gag p24, nous avons utilisé oligonucléotide mutagenèse dirigée pour introduire des mutations dans un plasmide contenant pNL4-3 du VIH-1 COTB-p24 gène 23,32,33. Les stocks viraux ont été générés par transfection de cellules 293T et récoltées après 48 heures. Nous avons estimé la dose de 50% de la culture de tissus infectieux (DICT 50) de chaque stock virale par la méthode de Reed-Muench 31. La TCID50 du virus mutants prototype et variaient entre 10 avril à 10 mai UI / ml (Figure 3A).

La cinétique de virus recombinants de croissance ont été établis dans les CMSP à partir d'un seul donneur à une MOI de 0,005. RT-qPCR a été utilisé pour mesurer virale nombre de copies d'ADNc par jour pendant six jours. Tous les virus mutants et prototypes ont augmenté de façon exponentielle entre le jour 2 et le jour 4, après quoi a ralenti la croissance virale, comme indiqué par une diminution de la pente de l'augmentation du nombre de copies virales d'ARN (<strong> figure 3B). La diminution du nombre de copies d'ADNc entre le jour 0 (correspondant à l'inoculum) et jour 2 est due à l'absorption du virus à des cellules et l'élimination des virions non liés par lavage le jour 1 (étape 5.1.6). Dans la phase de croissance exponentielle, les trois mutants ont un taux de croissance plus lent (g) que le virus prototype (figure 3C).

Tous les trois mutants ont été en compétition contre le virus prototype dans des tests de compétition de croissance à un total de 0,005 MOI. La cinétique de la croissance virale dans des cultures doublement infectées étaient similaires à celle de la mono-infection; la phase exponentielle de croissance virale était entre les jours 2 et 4, et de la croissance virale a atteint un plateau autour de cinq jours (figure 4A).

Les différences de taux de croissance virales ont été obtenues à partir de la variation du rapport viral dans le temps. Le rapport viral a été calculé sur la base du nombre de copies d'ADNc de la référence et les virus mutants à l'aide de RT-qPCR, et en comparant les hauteurs de picchromatogrammes en séquence au niveau de sites de nucleotides qui distinguent les deux virus (figure 4B). Les différences de taux de croissance déterminées en utilisant le pic-hauteur et copie de l'ARN viraux méthodes numériques ont donné des résultats similaires (figure 4C). Tous les trois mutants avaient inférieure remise en forme de réplication que les virus des prototypes avec le I256V mutant ayant l'aptitude la plus faible (figure 4C).

Figure 1
Figure 1: Schéma de principe des protocoles présentés dans le présent document Le Virus protocoles de préparation concernent la construction du VIH-1 clones recombinants et la génération de stocks viraux.. Les protocoles de remise en forme dosages sont pour établir la cinétique de croissance virales et déterminer l'aptitude virale relative. Les lignes pointillées représentent les flux alternatifs pour les protocoles. Par exemple, une mutation peut être introduite directement dans le VIH-1 NL4-3clone moléculaire sans générer un clone recombinant.

Figure 2
Figure 2:. Construction du VIH-1 NL4-3 COTB Gag p24-clones moléculaires recombinantes en utilisant l'extension de PCR de chevauchement (A) Concevoir les amorces chimériques. La 5 'moitiés des amorces contiennent la séquence du vecteur NL4-3 et 3' contiennent des moitiés des extrémités de la séquence de l'insert. (B) amorces chimériques sont utilisés pour amplifier le fragment d'insertion, COTB Gag p24. (C) Les fragments d'insertion sont utilisés comme amorces pour une seconde PCR pour générer un nouveau plasmide recombinant.

Figure 3
Figure 3:. Caractéristiques de croissance virale dans les CMSP (A) Connexion 10 DICT 50 (B) de la cinétique de la croissance virale dans monoinfections commencé à un MOI = 0,005. (c) Les taux de croissance virale de plus de six jours, y compris la phase exponentielle de croissance (jours 2-4) dérivé de panneau (B). Les valeurs indiquées représentent la moyenne de trois répétitions d'une expérience. Les barres d'erreur représentent les intervalles de 95% de confiance.

Figure 4
Figure 4: croissance virale et de conditionnement physique par rapport déterminations (A) de la croissance virale dans les cultures de CMSP doublement infectés.. (B) Les ratios de virus T242N et prototypes déterminés par RT-qPCR ou la méthode de séquençage de pointe hauteur. (C) des différences nettes virales du taux de croissance (d) entre le mutant et les virus dans des cultures de prototypes doublement infectées, comme représenté en (A). d valeurs ont été calculées fROM Le viraux données de rapport indiqués dans (B). Les valeurs indiquées représentent la moyenne de trois répétitions d'une expérience. Les barres d'erreur représentent les intervalles de 95% de confiance.

Discussion

Les protocoles présentés se composait de deux parties principales: la construction du VIH-1 clones moléculaires recombinantes et des essais de compétition de croissance. Afin de distinguer les deux virus dans une culture de cellules doublement infectées, il est important que les clones moléculaires concurrentes contiennent des marqueurs de séquences, qui peuvent être détectés par un dosage amorce-sonde RT-qPCR ou par séquençage de Sanger. Ce protocole utilise les Vifa et VifB étiquettes, qui occupent la même région de HIV-1 NL4-3 vif et codent pour la séquence d'acides aminés identique, mais diffèrent par six mutations synonymes. Ces mutations ont été présentés pour ne pas affecter la réplication virale remise en forme 20. La méthode de clonage par PCR utilisée dans ce protocole prévoit une plus grande flexibilité dans le choix des sites de clonage, par rapport à des sites de restriction clonage basé. Cependant, l'efficacité de clonage PCR diminue à mesure que la taille augmente insert. La limite de courant de la taille de l'insert est 34 ~ 5 kb. Pour le clonage basé sur la PCR et du site dirigé mutagenesis, l'utilisation d'une ADN polymerase haute fidélité est essentiel de réduire la probabilité de mutations supplémentaires. L'utilisation du nombre minimal de cycles PCR nécessaires pour obtenir des quantités suffisantes de produits est également recommandé. Dans notre expérience, nous ne détectons aucune mutation supplémentaire après le clonage et dirigée vers le site étapes de mutagenèse basées sur la PCR décrites ici. Néanmoins, les produits de PCR doivent être séquencés pour vérifier toutes les mutations indésirables. Idéalement, la région codante entière du VIH doit être reséquencé.

Au moins trois points de temps échantillonnage doivent être examinées dans la phase de croissance exponentielle 9. La cinétique de croissance virales doivent d'abord être établies en utilisant échantillonnage quotidien pour déterminer la période de culture et de temps d'échantillonnage des points appropriés pour la compétition de croissance. Un facteur qui affecte la cinétique de croissance virale est la multiplicité d'infection (MOI). Ce protocole utilise un total de 0,005 MOI pour les mono-infection et de la concurrence de la croissance, comme il a été montré pour donner plus de roRésultats buste que IAM inférieur 9. Néanmoins, IAM inférieures peuvent être utilisées pour obtenir une phase de croissance exponentielle plus si nécessaire, mais au détriment de la cohérence résultat. Ce protocole indique un rapport de 50:50 de l'infection initiale, en supposant que la différence de forme physique des virus sont généralement inconnue à l'avance. Cependant, l'utilisation de ratios d'entrée inégales sont appropriées quand il ya des données préliminaires suggérant des différences significatives dans la cinétique de la réplication virale. Dans ces cas, un rapport d'infection de 70:30 est recommandé afin de permettre la détection d'une grande différence de remise en forme où le virus moins en forme est mis en excès neuf.

Le protocole pour déterminer la DICT 50, la cinétique de croissance virales, et pour effectuer la croissance des essais de compétition ont été optimisés en utilisant le VIH-1 sous-type B, NL4-3 COTB-p24, et PBMC provenant d'un seul donneur dont CMSP ont démontré la sensibilité cohérente pour le VIH une infection in vitro. La période de cultureet les points de temps d'échantillonnage présentés dans ce protocole sont susceptibles d'être adapté à l'étude des virus VIH-1 groupe M dans les CMSP humaines. Utilisation CMSP d'une source unique est fortement recommandé d'obtenir des résultats cohérents que la réplication virale peut varier dans différentes cellules du donneur 35. Bien que moins souhaitable, des PBMC mises en commun provenant de plusieurs donneurs peuvent être utilisés comme une substitution à condition que le même pool est utilisé dans toutes les expériences. Une autre alternative est l'utilisation de lignées cellulaires. Le protocole présenté ici a été utilisé avec succès par la lignée de cellules T CEMx174 23,36. Cependant, il est important que le nombre de cellules ensemencées sont ré-optimisées pour atteindre une croissance cellulaire cohérente. La cinétique de croissance virales doivent être rétablis, car il est susceptible de varier dans différentes lignées cellulaires, afin de déterminer les points de temps d'échantillonnage appropriés dans les étapes de compétition de croissance.

Deux méthodes différentes pour déterminer le rapport virale pour le calcul de remise en forme sont inclus dans le protocol. La première utilise RT-qPCR pour mesurer virale nombre de copies d'ADNc à chaque point de temps d'échantillonnage. La réplication virale remise en forme a ensuite été calculée à partir du rapport virale, sur la base de l'ADNc nombre de copies. En variante, le rapport viral peut être déterminée sur la base du rapport de la hauteur de pic de chromatogramme sur les sites d'étiquette VifAB. Les deux méthodes ont donné des résultats comparables (Figure 4). Le procédé de la hauteur de pic chromatogramme peut être appliquée à d'autres souches du VIH-1 sans un marqueur de séquence d'ingénierie. Pour RT-qPCR, l'utilisation des amorces ou des sondes pour distinguer les variants viraux doit d'abord être évaluée avec soin (voir 20). Néanmoins, RT-qPCR fournit une meilleure sensibilité pour des échantillons contenant une petite quantité de l'ARN viral, telles que celles du premier point de temps à l'intérieur de la phase de croissance exponentielle. La mesure directe des ADNc viral permet également de détecter les problèmes techniques qui peuvent survenir de l'extraction de l'ARN et la synthèse d'ADNc. Utilisation de clones moléculaires avec des étiquettes de séquence fournit une solution rentable to les méthodes de RT-qPCR, car seuls deux couples d'amorces et sondes sont nécessaires pour étudier les virus multiples. Cette stratégie évite également le problème de la variation en hauteur de pic séquence chromatogrammes en raison de bases voisines 37, comme le séquençage est réalisé sur le même site à travers tous les virus dans l'étude. Les produits de PCR obtenus pour la RT-PCR quantitative et séquençage de Sanger peut également être utilisé avec d'autres méthodes pour déterminer le rapport viral tel que le séquençage des clones individuels en vrac de 12,13, 4,7,17,19 HTA, ou le dosage de ligation d'oligonucléotides (OLA) 38 .

Disclosures

Les auteurs déclarent qu'ils ont aucun intérêt financier concurrentes. Les opinions exprimées sont celles des auteurs et ne doivent pas être interprétées comme officiel ou représentant les opinions du ministère américain de la Défense ou du ministère de l'Armée.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Pairwise croissance de la concurrence analyse pour déterminer la condition physique réplication du virus de l&#39;immunodéficience humaines
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter