Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Parvise Vekst Konkurranse analyse for Bestemme Replication Fitness av humant immunsviktvirus

doi: 10.3791/52610 Published: May 4, 2015

Introduction

Virusreplikasjon fitness er definert som kapasiteten på et virus å produsere smittsomme avkom i et gitt miljø 1 og er en viktig medvirkende faktor i å bestemme utbredelsen av et virus variant på befolkningsnivå over tid 2. Som in vivo fitness studier er ikke gjennomførbart med sykdomsfremkallende menneskelige virus, for eksempel HIV-1, ulike in vitro og ex vivo replikering fitness-analyser har blitt utviklet for å studere effekter på fitness som følge av legemiddelresistens og immunrømnings mutasjoner, epistasis og utviklingen av viruspopulasjoner 3-6. Blant ulike trenings analyser, er veksten konkurranseanalyser anerkjent for å gi mer sensitive og gyldige mål for fitness forskjeller, som to eller flere virusvarianter konkurrerer om den samme cellen befolkningen under nøyaktig de samme miljøforhold, som oppstår in vivo 1,7,8. Før du starter vekstkonkurranse eksperimenter, flere variables må bestemmes, herunder bruk av forskjellige multiplisiteter av infeksjon (MOI), viral valgt forhold, og tidspunkt for prøvetaking for analyse. Vi har studert effekten av disse parametrene på virusvekstkinetikk og på utfallet av konkurranse eksperimenter, og har identifisert viktige faktorene som er nødvendige for robuste målinger av HIV-1 trenings i cellekultur 9.

I tillegg til analyse variabler, er det en rekke metoder for kvantifisering av virusvarianter i vekst konkurrerende eksperimenter. Bulk 10,11 eller klonal sekvense 12,13 har blitt brukt for å bestemme forholdet mellom de konkurrerende virus basert på nukleotid-frekvenser ved stedet (r) av interesse. Relativ kondisjon er utledet fra endring i dette forhold over tid. Denne metoden er praktisk som DNA-sekvense tjenester er allment tilgjengelig. Parallell allel-spesifikk sekvensering (PASS) metoden gjør sekvense på flere steder og påvisning av rekombinanter 14 15 eller synonyme mutasjoner 4,16-18 som koder for å skille de konkurrerende virus ved sekvensering, heterodupleks sporing analyser (HTA) 4,7,17,19 eller revers transkripsjon-kvantitativ real-time polymerase chain reaction (RT-qPCR) 15,16,18,20, som alle kan gjøres gjeldende for å studere konkurrerende stammer uavhengig av sekvenslikhet. Et ytterligere trinn er nødvendig for å innføre taggene i virale genomer og RT-qPCR-analyse krever også spesielle reagenser og instrumentering. Vi har funnet ut at bulk Sanger-sekvensering gir sammenlignbare resultater 9.

Etter vekst konkurranse, virusreplikasjon treningspresentert som relativ fitness eller treningsforhold mellom two virusvarianter. Den relative egnethet av et virus kan defineres som den avsluttende del av en viral variant normalisert ved sin utgangs andel i inokulum eller som netto vekst forskjellen mellom de to konkurrerende virus. Vi har funnet at den sistnevnte metode, ved hjelp av langsgående datapunkter bare i den eksponentielle vekstfasen, produserte de mest robuste resultatene 9,20.

In vitro assays trenings brukes først og fremst til å studere biologiske klonene 6-8 og infeksjons molekylære kloner av HIV-1. Den sistnevnte, som er mottagelig for genetisk manipulasjon, blir ofte anvendt for å studere virkningen på trenings fra spesielle mutasjoner eller spesifikke sekvenser av interesse 3-5,21,22. Følgende protokoller beskriver en arbeidsflyt fra det punktet av å bygge ny helaftens smittsomme HIV-1 molekylære kloner bruker HIV-1 vektorer som inneholder en sekvens tag, innføre mutasjoner av interesse, noe som gjør virus aksjer og etablering av virusvekstkinetikkÅ utføre veksten konkurranseanalyse og beregning av relativ fitness (figur 1).

Ved hjelp av våre optimaliserte prosedyrer, vi laget tre rekombinante HIV-1 mutanter og bestemt deres replikering fitness. Det rekombinante molekylære klon ble først konstruert ved å erstatte HIV-1 gag-genet p24 regionen pNL4-3, et plasmid som inneholder en full lengde smittende genomet til HIV-1 lab-stamme NL4-3, med en syntetisk COTB (senter-of- treet, subtype B) gag-p24 sekvens 23 for å lage prototypen belastning. Enkelt aminosyrer endringer (T186M, T242N, og I256V) ble deretter innført for å skape tre muterte kloner. Hver mutant ble konkurrert mot prototype virus å observere trenings virkningen av hver mutasjon i den gitte genetisk bakgrunn. De tre mutanter demonstrert varierende grad av replikasjon fsitness fra svak til betydelig lavere enn prototypen viruset. Den T242N mutasjonen ble tidligere rapportert å ha en moderat treningsstudio og steamss koste 24-26, tilsvarende det resultatet som er vist i denne studien. Trenings kostnaden for de to andre mutasjoner ikke var blitt rapportert tidligere.

Protocol

MERK: Protokollen, som beskrevet nedenfor, omfatter ikke pasientopplysninger og er således ikke anses mennesker forskning ved University of Washington Institutional Review Board eller bilder av mennesker Division.

1. Bygging av Chimerisk HIV-1 NL4-3 Molekylære Clones

1.1) Forsterke Sett DNA fragment

  1. Designe kimære primere. Den 5 'halvdelene av både forover og bakover primere inneholder en HIV-1 vektor sekvens, der fragmentet vil bli satt inn. 3'-halvparten av primerne må inneholde den ende av innsatsen sekvensen (figur 2). Sørg for at det kimære primersekvensen beholder de opprinnelige åpne leserammer.
    1. Bruke primere minst 20 baser i lengde, med en smeltetemperatur som er større enn eller lik 60 ° C, ~ 50% GC-innhold, og en lav tendens til å danne primer-dimerer, heterodimerer og / eller hårnålstrukturer. Vurdere disse egenskapenebruker OligoAnalyzer web-verktøy ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. Bruk PCR 27 og de ​​kimære primere for å amplifisere innskudd-DNA (figur 2). For hver PCR reaksjon, bruke 1X high fidelity buffer, 0,2 mm dNTPs, en U av high fidelity DNA polymerase, 0,5 mikrometer av fremover kimerisk primer, 0,5 mikrometer omvendt kimerisk primer, og en pg0 ng av DNA-prøve frakte innsats regionen. Legg dH 2 O til et sluttvolum på 50 pl.
  3. Sett termiske sykluser trinn som følger: utføre et første DNA denatureringstrinn ved 98 ° C i 10 sek. Forsterker med 30 sykluser av DNA denaturering ved 98 ° C i 10 sek, og DNA hybridisering ved 3 ° C over den laveste smeltetemperatur av de to primere for 20 sek. Utfør en endelig forlengelse ved 72 ° C i 10 min. Oppbevar PCR produktene ved 4 ° C.
  4. Ta 5 ul av PCR-produktene fra denforegående trinn og kjøre agarosegelelektroforese 28.
    1. Bruke en 0,7% agarose-gel, 1 x TAE-buffer (40 mM Tris-acetat, 1 mM EDTA), 0,5 ug / ml etidiumbromid (EtBr) og en sluttkonsentrasjon kb stige som den DNA-størrelsesmarkør. Set strømkilde spenning til 5 V / cm avstand mellom elektrodene. Stopp elektroforese når lasting fargestoff migrerer gjennom om lag 2/3 av gelen lengde. Visual gelen ved hjelp av en gel dokumentasjonssystem 28.
      MERK: EtBr er en mistenkt kreftfremkallende, og må plasseres forsvarlig, per institusjon forskrifter. Hansker skal alltid brukes ved håndtering gels som inneholder EtBr. Bytt til nye hansker etter ferdig behandling EtBr holdig materiale og før håndtering andre materialer eller utstyr for å hindre smitteoverføring.
  5. Hvis bare én DNA-bånd med en størrelse som tilsvarer den ønskede PCR-produkt blir detektert, rense resten av PCR-produktet ved bruk av et kommersielt sett, for eksempel QIAquick PCR Purification Kit samsvaring til produsentens protokoller.
    1. Ved andre, ikke-spesifikke bånd er også til stede, bruker resten av PCR-produktet for å kjøre preparativ gelelektroforese. Bruk de samme parametrene og vilkårene som er angitt i trinn 1.1.4. Sikre at gelen også er stor nok til å laste ~ 45 pl av PCR-produktene. Skjær ut band av interesse og trekke ut DNA fra gelen ved hjelp QIAquick gel utvinning kit i henhold til produsentens protokoller.

1.2) Introduser Sett Fragment til Hellang Infeksiøs HIV-1 Undergruppe B Vector (pNL4-3)

  1. Bruk rensede PCR-produkter fra trinn 1.1.5 som PCR primere. Bruk pNL4-3VifA 20 som templat-DNA i en PCR-reaksjon, og bruk pNL4-3VifB 20 som templat i den andre reaksjonen (Figur 2). For hver PCR-reaksjon ved å bruke 1x high fidelity buffer, 0,2 mM dNTPs, 2 U of high fidelity DNA polymerase, 500 ng av DNA-primer og 50 ng templat-DNA i et endelig volUme av 50 pl. Still termisk sykling parametere: 98 ° C i 30 sek, 35 sykluser ved 98 ° C i 10 sek, 48 ° C i 1 minutt og 72 ° C i 10 minutter, etterfulgt av 72 ° C i 10 min.
  2. Tilsett 10 U av DPN I til 50 ul av PCR-reaksjonen og inkuber ved 37 ° C i 1 time for å fordøye templat DNA. Kontroller at plasmid-DNA isoleres fra en metylering kompetent bakteriestamme, f.eks., TOP10 kjemisk kompetent E. coli.
  3. Bruk DPN jeg fordøyd produkt å transformere kompetente bakterieceller. Bruk varmesjokk transformasjon med TOP10 kjemisk kompetente E. coli, i henhold til produsentens protokoll. Hvis du vil velge for bakterieceller som inneholder rekombinant plasmid, bruker Luria Broth (LB) kultur plater som inneholder 100 mg / L carbenicillin.
    1. Pick ~ 10 godt separerte kolonier og vokser hver for seg i 3 ml LB-væskemedium inneholdende 100 mg / l karbenicillin og inkuber ved 30 ° C i enshaker O / N.
    2. Bruk QIAprep Spin Miniprep kit for å isolere plasmid-DNA fra det bakterielle flytende kultur, i henhold til produsentens protokoll.
  4. Bruke dobbel restriksjonsspalting 29 for å bestemme hvorvidt plasmid-DNA inneholder den riktige innsatsen. Sørge for at en av de restriksjonsseter eksisterer bare i innsatsen regionen og den andre restriksjonssetet finnes bare én gang i HIV-1 vektor, utenfor innsatsen regionen.
    1. Digest minst 300 ng av plasmid-DNA i et 10 ul sluttreaksjonsvolum. Velg restriksjons buffere, inkubasjonstemperatur og inkubasjonstid i henhold til produsentens protokoll for den valgte restriksjonsenzymer. Ta 9 pl av det spaltede DNA og løpe gel-elektroforese som beskrevet i trinn 1.1.4. Velg rekombinante plasmider som har DNA-band av den anslåtte størrelser.
  5. Bekrefte sekvensen integriteten av de rekombinante plasmider ved Sanger-sekvensering. Mens sjeldne, uønsketmutasjonen (e) kan bli innført i løpet av PCR-reaksjoner.
    1. Sekvens begge tråder av plasmid DNA. Følg instruksjonene i trinn 1.1.1.1 å utforme sekvenseringsprimere. I tillegg sørge for at den forover og bakover sekvenseringsprimere anneal minst 50 bp oppstrøms og nedstrøms av innsatsen region i det rekombinante plasmid, respektivt.
    2. Send plasmid DNA og sekvenseringsprimere til en kommersiell DNA-sekvense tjenesteleverandøren. Forbered DNA-prøve og primere som angitt av tjenesteleverandøren.
  6. Gjør et endotoksin-free stock av mutert plasmid DNA ved hjelp av en Endotoksin gratis plasmid DNA kit i henhold til produsentens protokoll. Tilberede minst ett ug endotoksin-fri plasmid-DNA for transfeksjon i det følgende trinn.

1.3) Innføre Småskala Mutasjoner Via seterettet mutagenese

  1. Designe mutagene primere med overlappende forover og bakover primere som inneholder den ønskede mutation (er). Plasser base (e) som skal erstattes, settes inn eller slettet i midten av primerne, flankert av homologe 10-15 baser. Følg instruksjonene i trinn 1.1.1.1.
  2. Bruk PCR å syntetisere mutante plasmider. For hver PCR-reaksjon, bruker 1x high fidelity buffer, 10 mM dNTPs, 2 U high fidelity DNA polymerase, 0,5 mikrometer av fremover mutagene primer, 0,5 mikrometer omvendt mutagene primer og 50 ng kimerisk pNL4-3VifB, fra trinn 1.2.6 , i et sluttvolum på 50 pl. Still termisk sykling parametere: 98 ° C i 30 sek, 25 sykluser ved 98 ° C i 10 sek, 48 ° C i 1 minutt og 72 ° C i 10 minutter, etterfulgt av 72 ° C i 10 min.
  3. Gjenta trinn 1.2.2 til 1.2.6.

2. Generering av Viral Stock Bruke Transfeksjon

  1. Beregne mengden av viral lager ønsket og plasmid DNA nødvendig. Med en viral titer fra 10 4 IU / ml eller høyere, 1,8 ml av viral lager er tilstrekkelig for to sett av vekst konkurranse ASSAys, inkludert monoinfections, hvert foretatt in triplo. For en transfeksjon utført i en 6-brønns plate, er omtrent 1,8 ml supernatant høstet per brønn. Ett pg av plasmid-DNA som er nødvendig for hver transfeksjon utført i en 6-brønns plate.
  2. For hver brønn i en 6-brønns plate, forberede 100 ul transfeksjon blandingen, f.eks., Som består av en pl X-tremeGENE 9 transfeksjon reagens (eller tilsvarende produkt), 1 ug av plasmid-DNA og serumfritt DMEM.
    1. Bestemme volumet av plasmid-DNA er nødvendig, ved bruk av 1 ug plasmid DNA per brønn. Sørge for at den endelige konsentrasjon av plasmid DNA er minst 50 ng / mL.
    2. Bestemme hvor mye serumfritt medium (DMEM) som er nødvendig per brønn ved å benytte formelen: Totalt volum av DMEM i ul = 100 ul - DNA volum i ul.
  3. Tilsett 10 6 HEK-293T-17 (ATCC) celler / brønn i 2 ml forplantningsmedium (DMEM + 10% føtalt bovint serum (FBS)) i en 6-brønns plate. Inkuber i 1 time ved 37 ° C i en5% CO 2 atmosfæren. Seed så mange brønner som nødvendig (bestemt i trinn 2.1).
  4. For å forberede transfeksjon blandingen, delmengde riktig volum av serum-free DMEM, som beregnet ovenfor, i en 1,8 ml polypropylen mikrosentrifugerør, og deretter legge til transfeksjon reagens.
    1. Pipette reagent direkte inn i media løsning, ikke legg det til plast overflaten av mikrorøret. Legg plasmid DNA sist. Pipet opp og ned forsiktig for å blande løsningen. Inkuber i 15 minutter ved romtemperatur (15 ° C til 25 ° C) for å tillate dannelse av kompleksene transfeksjonsteknikker.
    2. Tilsett blandingen på en dråpevis måte til cellene sådd i 6-brønns plate. Rist eller virvel brønnene for å sikre jevn fordeling av transfeksjonsteknikker komplekser.
    3. Seal plater med plastfolie.
  5. Inkuber kulturer ved 37 ° C i en 5% CO2 atmosfære i 48 timer.
  6. Bruk en pipette til å nøye samle og overføre supernatanten til en 15 ml tube igjennomgh et 0,22 mikrometer filter toppen.
  7. Bruk pipette til å overføre 250 ul eller mer av det filtrerte supernatanten til 1,8 ml mikrofugerør med gummipakninger i lokkene.
  8. Lagres filtrert supernatanter ved -80 ° C inntil bruk.

3. Bestem Infeksiøs Titer av Viral Aksjer på perifere mononukleære blodceller (PBMC)

  1. Stimulere PBMC med phytohemagglutinin (PHA). Per en viral lager, frø 2 x 10 6 PBMC i fullstendig Iscoves modifiserte Dulbeccos medium (cIMDM, IMDM supplert med 20 U / ml humant interleukin 2 (hIL-2), 10% føtalt bovint serum og 1% penicillin / streptomycin) supplert med PHA (1,5 ug / ml). Seed PBMC på 2 x 10 6 celler / ml. Inkuber PBMC ved 37 ° C i en 5% CO2 atmosfære i 72 timer.
  2. Innhøsting PHA stimulert PBMC. Overfør ikke-klebende PHA-PBMC i et 50 ml konisk rør. Spinne rør ved 228 xg i 10 min. Fjern forsiktig supernatanten uten disrupting cellepelleten. Re-suspen cellepelleten til en sluttkonsentrasjon på 2 x 10 5 PBMC / ml i cIMDM.
  3. Seed 2 x 10 4 PHA stimulert PBMC / brønn i 100 ul / brønn cIMDM i en rundbunnet 96-brønns plate.
  4. Lag en 1:10 fortynning av viral lager. Deretter, fra det første fortynnede masse, gjør tolv 3-gangers seriefortynninger på en 96-brønns master plate. Denne fortynningen regime som for deteksjon av virale titere i området fra 10 april-10 juni infeksiøs enhet (IU) pr ml.
    1. For eksempel legge 20 mL av virus lager til 180 mL medier i 1,5 ml tube. Bland fortynning ved å pipettere forsiktig. Deretter overfører 90 pl av den fortynnede masse i 180 ul media av den første brønnen og bland godt ved pipettering.
    2. Fortsett fortynningsserier ved å overføre 90 mL fra dagens vel til 180 mL medier i den neste brønnen elleve ganger. Øke eller redusere innledende utvanning dersom titers høyere enn 10 6 IU / mleller lavere enn 10 4 IU / ml ventes, respektivt.
  5. Legg 40 mL av seriefortynnes viral lager fra master fortynning platen til seeded PBMC plate (fra trinn 3.3) i fire eksemplarer. Inkuber platene ved 37 ° C i en 5% CO2 atmosfære i 16-24 timer.
  6. Fjern forsiktig 100 ul av supernatanten fra hver brønn, og erstatt med 160 ul friskt cIMDM til et totalt volum på 200 ul / brønn. Inkuber platene ved 37 ° C med 5% CO2 atmosfære (dag 1).
  7. På dager 4, 7, 10 og 13 overføre 100 mL av supernatant fra hver brønn til 100 ul avbrudd buffer (2% TritonX-100 i PBS), og erstatte med 100 ul frisk cIMDM. Oppbevar Supernatantene ved -20 ° C.
    1. Hold prøvetaking og legge nytt cIMDM hver tredje dag inntil titer stabiliseres.
  8. Bestem 50% infeksiøs dose vevskultur (TCID 50) av viral p24 ELISA lager ved hjelp av dag 7 og en3 prøver som beskrevet i trinn 4.
    1. Dersom TCID 50 oppnådd fra dag 13 er klart større enn titer fra dag 7, kan viruset lager trenger en lengre tid for å ekspandere. Gjenta p24 ELISA hjelp senere prøver inntil smittsomme titers fra to prøvetakings tidspunkter bli stabil (eller reduksjon). Velg aksjer fra prøvene med høyest titer.

4. ELISA (Enzyme-linked Immunoabsorbant Assay) Deteksjon av HIV-1 p24 for bestemmelse Viral Infeksiøs Titer

MERK: Følgende protokoll ble utviklet ved hjelp av p24 antigen fangst platene utarbeidet i vårt laboratorium 30. Commercial HIV-1 p24 ELISA plate / kits kan også brukes etter produsentens protokoll.

  1. Før arbeid med prøver, forberede arbeids bestander av primær antistoff (kanin anti-HIV-1 SF2 p24 antiserum).
    1. Tine p24 antiserum ved RT.
    2. Bland 2,5 ml glyserol med 2 ml 10% FBS i phosphate buffersaltløsning (PBS).
    3. Tilsett 0,5 ml antiserum og bland.
    4. Vogn 1 ml alikvoter ved -20 ° C.
  2. Tine-prøver fra trinn 3,7 i en 37 ° C inkubator.
  3. Vask p24 capture plate fem ganger med vaskebuffer (1 x PBS med 0,05% Tween-20).
  4. Tilsett 50 ul / brønn av prøve fortynning (1% bovint serum albumin (BSA), 0,2% Tween-20 i RPMI-1640), og deretter legge 50 ul prøve til hensiktsmessige brønner. Omfatte minst tre brønner med prøve fortynning bare som mock / negative kontroller. Inkuber i 2 timer ved 37 ° C eller O / N ved 4 ° C.
  5. Klargjør primære antistoffet løsningen frisk før bruk. Foreta en 1: 2000 gangers fortynning av det primære antistoff arbeids bestander og med det primære antistoff-fortynningsmiddel (12% FBS i RPMI-1640). Sørge for å fremstille nok for bruk av 100 ul løsning som for hver prøve / kontroll brønn i en 96-brønns plate.
    1. For eksempel, for å gjøre nok oppløsning til en 96-brønns plate tilsettes 5 mL av det primære antistoff working aksjer til det primære antistoff-fortynningsmiddel for et sluttvolum på 10 ml.
  6. Vask capture plate 5 ganger med vaskebuffer.
  7. Tilsett 100 ul av primær antistoffløsning til hver brønn. Inkuber i 1 time ved 37 ° C i en 5% CO2 atmosfære.
  8. Forberede sekundært antistoff løsning frisk før bruk. Foreta en 1: 14400 gangers fortynning av det sekundære antistoff (1 mg / ml geit-anti-kanin HRP) ved hjelp av sekundære antistoff fortynningsmiddel (7% FBS, 0,01% Tween-20 i RPMI-1640). For å redusere pipettering feil, utføre en to-trinns serie fortynning. Sørge for å fremstille nok for bruk av 100 ul løsning som for hver prøve / kontroll brønn i en 96-brønns plate.
    1. For eksempel, for å gjøre nok oppløsning til en 96-brønns plate, først å tilsette en ul av sekundært antistoff til 99 pl av det sekundære antistoff fortynningsmiddel. Deretter legger 70 pl av første fortynning til det sekundære antistoff fortynningsmiddel for et sluttvolum på 10 ml.
  9. Vask fangst plate 5 times med vaskebuffer.
  10. Tilsett 100 ul av det sekundære antistoffløsning til hver brønn. Inkuber i 1 time ved 37 ° C i en 5% CO2 atmosfære.
  11. Platen vaskes fem ganger med vaskebuffer.
  12. Legg 100 ul RT TMB-substrat. Inkuber 30 min ved RT i en lukket beholder for å beskytte mot lys.
  13. Legg 100 mL av RT stopp løsning (1 NH 2 SO 4).
  14. Les absorbansen ved 450 til 650 nm i hver brønn ved anvendelse av en mikroplateleser. Bruk absorbansverdien å score hver brønn som smittet eller infisert. Betrakt en brønn for å inneholde infeksiøse virus hvis absorbansverdien er minst tre ganger høyere enn verdien lest fra mock / negative kontrollbrønner. Beregn TCID 50 av viral lager ved hjelp av Reed-Meunch metode 31.

5. Etablere viral vekst Kinetics

5.1) Monoinfection

  1. Seed 3 x 10 5 PHA-stimulert PBMC / brønn i 48-brønns plates i et totalt volum på 500 ul / brønn. Hold kulturplater ved 37 ° C i en 5% CO2 atmosfære før inokulering.
  2. For hvert virus, utarbeide en inoculum inneholder 6000 IU i 2 ml cIMDM.
  3. Inokuler brønner in triplo ved å tilsette 500 ul av podestoff (1500 IU) for å seeded cellene. Det endelige volum av den infiserte cellekultur er 1 ml / brønn og MOI er 0.005.
  4. Alikvoter 200 ul av den gjenværende inokulum til hver av to 96-brønners plater for RNA isolering, hvorav den ene er lagret som reserve.
  5. Inkuber kulturer ved 37 ° C i en 5% CO2 atmosfære i 16-24 timer.
  6. Vask kulturer 16-24 timer etter vaksinasjonen.
    1. Fjern og kast 750 mL av kultursupernatant.
    2. Legg 750 mL av fersk cIMDM. Pakk plater i plastfolie og spinn i 10 minutter ved 300 x g. Fjern og kast 750 mL supernatant.
    3. Legg 750 mL av fersk cIMDM. Inkuber ved 37 ° C med en 5% CO 2mosphere (dag 1).
  7. Eksempel kulturer daglig fra dag 2 til dag syv.
    1. Overfør 500 ul av kultursupernatanten til en 1,8 ml sentrifugerør. Spinn i 1 min ved 3000 x g.
    2. Overfør 200 ul av den cellefrie supernatant til de to 96-brønners prøveplater for RNA isolering, igjen sparer en plate som sikkerhetskopi. Oppbevar supernatanter ved -80 ° C inntil RNA isolering.
    3. Legg til 500 mL frisk cIMDM til hver kultur. Inkuber ved 37 ° C i en 5% CO2 atmosfære.
    4. Kast kulturer i Wescodyne ved slutten av forsøket.
    5. Isolere RNA fra 200 ul supernatant (bruk kommersielle kits som QIAamp Viral RNA Mini Kit) etter produsentens standardprotokollen. For et stort antall prøver, bruker Qiagen QIAxtractor.
    6. Butikk RNA prøvene ved -80 ° C inntil cDNA-syntese.

5.2) cDNA Synthesis (Reverse Transcription)

  1. For hver RNA srikelig, tilsett 1,2 nmol av dNTP og 1,2 pmol av cDNA-syntese primer (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', HXB2 nukleotid 7968 til 7995) til 10 ul av viralt RNA. Tilsett vann til et sluttvolum på 14 ul. Flick røret for å blande og spinne lett for å samle væske i bunnen av røret.
  2. Inkuberes blandingen i 5 minutter ved 65 ° C, så hold ved 4 ° C inntil master mix er forberedt.
  3. Forbered konsentrat-blanding ved hjelp av 5x første-tråd buffer (250 mM Tris-HCl, pH 8,3, 375 mM KCl, 15 mM MgCl2), 5 mM DTT, 120 U av SuperScriptIII og 240 U RNase inhibitor. Tilsett vann til sluttvolum på 10 pl.
  4. Legg 10 mL av mester mix å RNA blanding, flick å mikse og spinne å samle inn.
  5. Blandingen inkuberes i 90 min ved 50 ° C for å tillate syntese av cDNA. Inkuber i 15 minutter ved 70 ° C for å inaktivere revers transkriptase. Hold ved 4 ° C etter behov.
  6. Tilsett 2 U RNase H, flick å blande, og deretter spinne å samle inn.
  7. Inkuber 20 minved 37 ° C. Oppbevares cDNA ved -20 ° C.

5.3) cDNA Kvantitering Bruke qPCR System

  1. Utarbeide en standard fortynningsserie. Har 10 ganger seriell fortynning, fra 3 x 10 6 kopier / mikroliter ned til 30 kopier / ul, av pNL4-3VifA. Bruk destillert vann for fortynninger. Forbered standard fortynningsseriene frisk før bruk eller forberede små grupper og holde ved -20 ° C. Ikke fryse-tine standarder mer enn tre ganger.
  2. Sett opp en 96-brønns qPCR reaksjon plate. Sikre at hver plate inneholder minst én brønn av negative kontroller, en tre eksemplarer av standard fortynning serie, og i det minste en kopi av hver cDNA-prøve.
  3. For hver qPCR reaksjon ved å bruke 12,5 ul qPCR konsentrat-blanding, 0,2 uM probe, 0,8 M av hver av forover- og reversprimerne og 1 pl av cDNA eller standard fortynning serie eller vann / buffer (for negativ kontroll i tillegg). Tilsett vann til et sluttvolum på 25 pl. QPCR probe er lys senmerksomme. Hold det i lukket beholder.
    1. For å detektere cDNA avledet fra pNL4-3VifA basert molekylær klon ved å bruke VIFA primer-probe: VifAB forover primer (GGTCTGCATACAGGAGAAAGAGACT), VIFA revers primer (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') og VifAB probe (6FAM-5'-CTCCATTCTATGGAGACTC-3 '-MGBNFQ). For cDNA avledet fra pNL4-3VifB basert klone, bruker VifB primer-probe: VifAB frem primer, VifAB probe og VifB revers primer (5'-CACCTGCGTGCTATACCTTTTCT-3).
  4. Sett PCR Syklusparametrene til 50 ° C i 2 minutter, 95 ° C i 10 min, og 40 sykluser av 95 ° C i 15 sekunder og 60 ° C i 1 min. Kontakte produsenten støtte dokument for drift av qPCR maskinen.
  5. Beregn en standardkurve ved bruk av data fra tre eksemplarer standard fortynning serie. Sammenlign forsterknings data av cDNA prøven til standardkurven for å bestemme kopitallet. Går du til produsentens støttedokument for data behandling.

5.4) Bestem Viral eksponentiell vekstfase

  1. Plott virale vekstkinetikk med samplings dag langs X-aksen og cDNA-kopi antall langs Y-aksen og identifisere virale eksponensielle vekstfase, det vil si., Når virale cDNA kopitall økning i en eksponensiell progresjon.
  2. Bruk GRC web-verktøy ( http://indra.mullins.microbiol.washington.edu/grc/ ) for å beregne viral vekstrate (g). I denne søknaden, GRC verktøyet aksepterer cDNA kopier tall fra minst to tidspunkter som input, og sender ut viral vekst (g). Bruk bare tid punktdata innen den eksponentielle vekstfasen (se trinn 5.4.1 ovenfor) for å oppnå nøyaktige vekstrater. For en detaljert beskrivelse av den matematiske modellen som brukes i GRC web-verktøy, se 20.

6. Vekst konkurranseanalyse

  1. Seed 3 x 10 5 </ Sup> PHA-stimulerte PBMC (eller 1 x 10 5 CEMx174 celler) i 500 ul totalvolum per brønn i en 48 brønners flatbunnet plate.
  2. Hold platen i 37 ° C i en 5% CO 2 atmosfæren før vaksinasjon.
  3. For hvert virus, forberede 3 ml inoculum inneholder 6000 IU.
  4. Overfør 1,5 ml av hver viruspodestoff til et sterilt rør for å skape dobbel infeksjon inokulum. Legg 500 mL av den doble inokulum (1500 IU) til 3 x 10 5 celler i en 48-brønns plate. Det endelige kulturvolumet er 1 ml / brønn. Alikvoter 200 ul av podestoff til to 96-brønners plater for RNA isolering; redde en plate som en back up.
  5. Inkuber inokulerte cellene ved 37 ° C med en 5% CO2 atmosfære i 16-24 timer.
  6. Vask kulturer 16-24 timer etter vaksinasjonen.
    1. Fjern og kast 750 mL av kultursupernatant.
    2. Legg 750 mL av fersk cIMDM. Pakk plater i plastfolie og spinn i 10 min ved 300 x g. Fjern og kast 75081; l supernatant.
    3. Legg 750 mL av fersk cIMDM. Inkuber ved 37 ° C med en 5% CO2 atmosfære (dag 1).
  7. Velg prøvetaking ganger for å inkludere minst tre tidspunkter innenfor eksponentiell vekstfase observert i trinn 5.4.1.
    1. For hver prøvetaking, følg trinn 5.1.7.
  8. Utfør cDNA syntese som beskrevet i kapittel 5.2.
  9. Bestem viral variant forholdet med qPCR.
    1. Utarbeide en standard serie fortynningsserie i tre eksemplarer, fortynne 10 ganger i hvert trinn fra 3 x 10 6 kopier / mL 30 kopier / ul pNL4-3VifA.
    2. Sett opp en 96-brønns qPCR reaksjon plate. Sikre at hver plate inneholder minst en negativ kontroll, standard fortynningsseriene i tre eksemplarer, og duplikater av hver cDNA-prøve.
    3. For hver qPCR reaksjon, bruker 12,5 mL av qPCR Master Mix, 0,2 mikrometer sonde, 0,8 um hver av de framover og bakover primere og en fil av cDNA eller standard d ilution serie eller vann / buffer (for de negative kontrollbrønner). Tilsett vann til et sluttvolum på 25 pl. QPCR probe er lysfølsom, holde den i lukket beholder.
      1. Bruk VIFA primer-probe for å detektere signaler i de negative kontrollene og standard fortynning serie og med en duplikat av cDNA-prøven. Bruk VifB primer-proben med den andre kopi av cDNA-prøven.
    4. Sett PCR Syklusparametrene til 50 ° C i 2 min, deretter 95 ° C i 10 minutter, og deretter 40 sykluser med 95 ° C i 15 sekunder og 60 ° C i 1 min. Kontakte produsenten støtte dokument for drift av qPCR maskinen.
    5. Beregn standardkurve ved bruk av forsterknings data fra standard fortynning serien. Sammenlign forsterknings data av cDNA prøvene til standardkurven for å bestemme kopiantall. Kontakte produsenten støtte dokument for databehandling.
    6. Bruk GRC web-verktøyet (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/) for å beregne relativ viral fitness (d).
      MERK: GRC verktøy aksepterer cDNA kopiere numre eller kromatogram topphøyder fra minst to tidspunkter som input, og utganger netto vekst forskjell (d) mellom de to virusene. Mens verktøyet kan beregne netto vekst fra to tidspunktdata, er det sterkt anbefalt å legge inn data fra tre eller flere tidspunkter. Bruk kun data fra tidspunkter innenfor eksponentiell vekstfase (se trinn 5.4) for å oppnå nøyaktige vekstrater. For en detaljert beskrivelse av den matematiske modellen som brukes i GRC web-verktøy, se 20.
  10. Bestem virus forholdstall hjelp kromatogram peak-høyder
    1. PCR amplifisere HIV-1 VIF fragmenter inneholdende den VifAB sekvenskoden ved hjelp VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 ', HXB2 posisjonene 5266-5291) og VifRev primere (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; HXB2 stillinger 5579-5553).
      1. For hver PCR-reaksjon ved å bruke 1 pl av cDNA, 1x NH 4-buffer, 1,5 mM MgCl2, 0,2 mM dNTP, 2,5 U av Taq-polymerase, og 0,45 pM av hver primer. Tilsett vann til et sluttvolum på 50 pl.
      2. Sett PCR Syklusparametrene til 3 sykluser ved 94 ° C i 1 minutt, 55 ° C i 1 min, og 70 ° C i 1 minutt, etterfulgt av 34 sykluser ved 94 ° C i 15 sek, 58 ° C i 30 sekunder, og 70 ° C i 1 min, og hold deretter ved 4 ° C.
    2. Rens PCR-produkter ved hjelp av QIAquick PCR-rensesett ifølge fabrikantens protokoll.
    3. Send rensede PCR-produkter til en DNA-sekvense tjenesteleverandør for Sanger-sekvensering.
    4. Sjekk den gjennomsnittlige lesekvalitetspoeng, som skal gis av sekvense service. Hvis den gjennomsnittlige basen samtalen nøyaktighet er mindre enn 85%, gjenta trinn 6.10.1 til 6.10.3
    5. Bruk ChromatQuan web-verktøyet (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) å beregne viral ratio på hvert tidspunkt. Verktøyet krever sekvensen sporingsfilen (* .ab1) og sekvensen 5 'til nukleotid område av interesse. Verktøyet måler peak intensitet på det angitte stedet. Forholdet mellom toppintensitet svarer til rasjon av de to virusene (Figur 4B).
    6. Bruk GRC web-verktøy ( http://indra.mullins.microbiol.washington.edu/grc/ ) og de ​​registrerte toppintensiteter som inngangs å beregne viral relativ fitness (d). Se trinn 6.10.6. 20

Representative Results

For å studere virkningen av trenings enkel aminosyre endringer i HIV-1 gag-p24, brukte vi oligonukleotid-rettet mutagenese for å innføre mutasjoner i en pNL4-3 plasmid inneholdende HIV-1 COTB-p24 genet 23,32,33. Viral aksjer ble generert ved transfeksjon av 293T celler og høstet etter 48 timer. Vi beregnet at 50% vevskultur infeksiøs dose (TCID 50) av hver virus lager av Reed-Muench-metoden 31. Den TCID 50 av prototypen og mutante virus varierte fra 10 april til 10 mai IU / ml (figur 3a).

Vekstkinetikken for de rekombinante virus ble etablert i PBMC fra en enkelt donor ved en MOI på 0.005. RT-qPCR ble anvendt for å måle virale cDNA-kopi-antall daglig i seks dager. Alle mutante og prototype virus vokste eksponensielt mellom dag 2 og dag 4, hvoretter viral vekst avtatt, som indikert ved en redusert helling av det virale RNA-kopitallet økning (<strong> figur 3B). Reduksjonen i cDNA kopitall mellom dag 0 (tilsvarende inokulum) og dag 2 er på grunn av absorpsjon av viruset til cellene og fjerning av ubundne virioner ved dag 1 vaske (trinn 5.1.6). I den eksponentielle vekstfasen, alle tre mutanter hadde en lavere vekstrate (g) enn prototype virus (Figur 3C).

Alle tre mutanter ble konkurrert mot prototype virusvekst i kompetitive analyser med en total MOI på 0.005. Virale vekstkinetikk i dobbeltkrum infiserte kulturer var lik den i monoinfection; viral eksponensiell vekstfase var mellom dag 2 og 4, og viral vekst nådd et platå rundt dag 5 (figur 4A).

Virale vekstrate forskjeller ble utledet fra endring i det virale grad over tid. Den virale forholdet ble beregnet på grunnlag av cDNA kopi antall referanse- og de mutante virus ved hjelp av RT-qPCR, og ved å sammenligne topphøyderi rekkefølge kromatogrammene ved nukleotid områder som skiller de to virus (figur 4b). Veksttakten forskjeller bestemmes ved hjelp av peak-høyde og virale RNA kopitall metoder ga lignende resultater (Figur 4C). Alle tre mutanter hadde lavere replikering trenings enn prototype virus med mutant I256V har den laveste fitness (Figur 4C).

Figur 1
Figur 1: Flytskjema av protokollene som presenteres i denne artikkelen The Virus Forberedelse protokoller bekymring bygging av HIV-1 rekombinante kloner og generering av virus aksjer.. Fitness Analyser protokollene er for å etablere virusvekstkinetikk og bestemme relativ viral fitness. Stiplede linjer representerer alternative strømmer for protokollene. For eksempel kan en mutasjon innføres direkte i HIV-1 NL4-3molekylær klone uten å generere et rekombinant klone.

Figur 2
Figur 2:. Bygging av HIV-1 NL4-3 COTB Gag-p24 rekombinante molekylære kloner bruker overlapping utvidelse PCR (A) Design kimæriske primere. Den 5 'halvdeler av primerene inneholde NL4-3 vektorsekvensen og 3'-halvdelene inneholder endene av innsatsen sekvensen. (B) Kimære primere anvendt for å amplifisere innsatsen fragment, COTB Gag-p24. (C) De innskutte fragmenter blir brukt som primere for en andre PCR for å generere en ny rekombinant plasmid.

Figur 3
Fig. 3: viral vekst egenskaper i PBMC (A) 10 Log TCID50 (B) Viral vekstkinetikk i monoinfections begynt på en MOI = 0,005. (C) viral vekst rater over seks dager, inkludert den eksponentielle vekstfasen (dager 2-4) avledet fra panel (b). De viste verdiene representerer gjennomsnittet av tre gjentak fra ett eksperiment. De feilfelt representerer 95% konfidensintervall.

Figur 4
Figur 4: Viral vekst og relativ fitness bestemmelser (A) Viral vekst i dually infiserte PBMC kulturer.. (B) prosenter av T242N og prototype virus bestemmes ved hjelp av RT-qPCR eller sekvensetopphøyde metoden. (C) Netto virale vekstrate forskjeller (d) mellom det mutante og prototypen virus i dobbeltkrum infiserte kulturer, som vist i (A). d-verdier ble beregnet fROM virusforholdsdata vist i (B). De viste verdiene representerer gjennomsnittet av tre gjentak fra ett eksperiment. De feilfelt representerer 95% konfidensintervall.

Discussion

Protokollene som presenteres bestod av to hoveddeler: Konstruksjon av rekombinant HIV-1 molekylære kloner og vekst kompetitive analyser. For å kunne skille mellom to virus i en dobbeltkrum infisert cellekultur, er det viktig at de konkurrerende molekylære kloner inneholder sekvenskoder, som kan oppdages av en RT-qPCR-primer eller probe-analyse av Sanger-sekvensering. Denne protokollen gjør bruk av VIFA og VifB tags, som opptar samme region av HIV-1 NL4-3 VIF og koder samme aminosyresekvens men avviker med seks synonyme mutasjoner. Disse mutasjonene ble vist ikke å påvirke virusreplikasjon trenings 20. PCR-basert kloningsfremgangsmåten anvendt i denne protokollen gir mer fleksibilitet i valg av kloningsseter, sammenlignet med restriksjonssetet basert kloning. Men effektiviteten av PCR kloning avtar når innskuddsstørrelse øker. Den nåværende grensen av innsatsen størrelse er ~ 5 kb 34. For PCR-basert kloning og site rettet mutagenesis, er bruken av en høy-fidelity DNA polymerase avgjørende for å redusere sannsynligheten for ekstra mutasjoner. Bruk av det minimale antall PCR-sykluser som trengs for å gi tilstrekkelige mengder av produktene er også anbefalt. I vår erfaring, kan vi ikke påvise noen ekstra mutasjoner etter at PCR-basert kloning og seterettet mutagenese trinnene som er beskrevet her. Ikke desto mindre PCR-produktene skal bli sekvensert for å kontrollere eventuelle uønskede mutasjoner. Ideelt sett bør hele HIV kodende regionen bli resequenced.

Minst tre prøvetakings tidspunkter bør undersøkes innen den eksponentielle vekstfasen 9. Virusvekstkinetikk må først bli etablert ved hjelp av daglig prøvetaking for å finne riktige kulturen periode og prøvetaking tidspunkter for vekst konkurransen. En faktor som påvirker virale vekstkinetikk er en multiplisitet for infeksjon (MOI). Denne protokollen bruker totalt MOI på 0,005 for både monoinfection og vekst konkurranse, da det viste seg å gi mer robust resultater enn lavere Mois 9. Likevel kan lavere MOIS anvendes for å oppnå en lengre eksponensiell vekstfase ved behov, men på bekostning av resultatet konsistens. Denne protokollen foreslår en første infeksjonen forhold på 50:50, forutsatt at fitness forskjeller virusene er generelt ukjent forhånd. Men bruk av ulike innsatsforhold er hensiktsmessig når det er foreløpige data som antyder signifikante forskjeller i virusreplikasjon kinetikk. I disse tilfeller er en infeksjon på 70:30 anbefales for å tillate deteksjon av en stor trenings forskjell der den mindre plass viruset er anbrakt i overkant 9.

Protokollen for bestemmelse av TCID 50, virale vekstkinetikk og for å utføre vekst kompetitive analyser ble optimalisert ved hjelp av HIV-1 subtype B, har NL4-3 COTB-p24, og PBMC fra en enkelt donor PBMC som vist konsistent følsomhet overfor HIV- 1-infeksjon in vitro. Kulturen periodenog sampling tidspunkter som presenteres i denne protokollen er sannsynlig å være egnet for å studere HIV-1 gruppe M virus i humane PBMC. Ved hjelp av PBMC fra en enkelt kilde er sterkt anbefalt for å oppnå konsistente resultater som virusreplikasjon kan variere i ulike donorceller 35. Selv om mindre ønskelig, kan PBMC samlet fra flere donorer anvendes som en erstatning, forutsatt at den samme bassenget er brukt i alle eksperimentene. Et annet alternativ er bruk av cellelinjer. Protokollen presenteres her ble brukt med hell med T-cellelinje CEMx174 23,36. Det er imidlertid viktig at antall celler sådd er re-optimalisert for å oppnå konsistent cellevekst. Virale vekstkinetikk må også bli gjenopprettet, som det er sannsynlig å variere i forskjellige cellelinjer, for å bestemme de aktuelle sampling tidspunkter i vekstkonkurranse trinn.

To ulike metoder for å bestemme viral ratio for beregning fitness er inkludert i protocol. Den første bruker RT-qPCR å måle viral cDNA-kopi-antall på hvert prøvetakingstidspunkt punkt. Viral replikasjon form ble deretter beregnet fra den virale forholdet, basert på cDNA-kopi-antall. Alternativt kan den virale forholdet bestemmes basert på forholdet mellom kromatogrammet topphøyde på VifAB tag nettsteder. De to metodene ga sammenlignbare resultater (figur 4). Kromatogrammet topphøyden fremgangsmåten kan anvendes for andre HIV-1-stammer uten en konstruert sekvens kode. For RT-qPCR, bruk av primere eller prober for å skille virale varianter må først omhyggelig undersøkt (se 20). Likevel gir RT-qPCR bedre følsomhet for prøver med en liten mengde av viralt RNA, slik som de fra det første tidspunkt i løpet av den eksponentielle vekstfasen. Direkte måling av viral cDNA gir også påvisning av tekniske problemer som kan oppstå fra RNA ekstraksjon og cDNA syntese. Ved hjelp av molekylære kloner med sekvens tags gir en kostnadseffektiv løsning to RT-qPCR metoder, som bare to par av primere og prober for å undersøke flere virus. Denne strategien unngår også problemet med peak-høyde variasjon i rekkefølge kromatogrammene skyldes nabobaser 37, som sekvensering utføres på samme sted på tvers av alle virus i studien. PCR-produktene som produseres for RT-qPCR og Sanger-sekvensering kan også benyttes sammen med andre metoder for å bestemme viral forhold slik som bulk-sekvensering av individuelle kloner 12,13, HTA 4,7,17,19, eller oligonukleotid ligering assay (OLA) 38 .

Disclosures

Forfatterne hevder at de ikke har noen konkurrerende økonomiske interesser. Meningene uttrykt her er de av forfatterne, og bør ikke tolkes som offisiell eller representerer synspunktene til det amerikanske Department of Defense eller Institutt for hæren.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Parvise Vekst Konkurranse analyse for Bestemme Replication Fitness av humant immunsviktvirus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter