Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Lateral Root inducerbara systemet i doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rotsystemet är avgörande för växternas tillväxt, eftersom det garanterar förankring och upptag av vatten och näringsämnen från marken. Eftersom utbyggnaden av ett rotsystem bygger främst på produktion av sidorötter, deras initiering och bildning har i stor utsträckning studerats. Sido rötter initieras i en särskild undergrupp av pericycle celler, som kallas grundare celler 1. I de flesta dikotyledoner, såsom Arabidopsis thaliana, är dessa celler belägna vid protoxylem polerna 2, medan monokotyledoner, såsom majs, de finns på floemet polerna 3. Grundar celler är markerade med en ökad auxin svar 4, följt av uttryck av specifika cellcykelgener (t.ex. cyklin B1; 1 / CYCB1; 1), varefter de genomgår en första omgång av asymmetriska anticlinal divisioner 5. Efter en serie av samordnade anticlinal och periclinal divisioner, är en lateral rot primordium bildas som slutligen kommer att dyka upp som en autonomous lateral rot. Platsen och tidpunkten för sido rotinitiering är dock inte förutsägbara, eftersom dessa händelser är varken riklig eller synkroniserade. Detta hindrar användningen av molekylära metoder såsom transkriptomik att studera denna process.

För att ta itu med detta, har en lateral Root inducerbara systemet (LRIS) utvecklats 6, 7. I detta system är plantor först behandlades med N -1-naphthylphthalamic syra (NPA), som hämmar auxin transport och ackumulation därmed blockerar sido rotinitiering 8. Genom att därefter överföra plantan till medium som innehåller den syntetiska auxin 1-naftalenättiksyra (NAA), svarar hela pericycle skiktet till de förhöjda auxin nivåerna därigenom massivt inducerade sido rot initierar celldelningar 6. Som sådan, leder detta system till snabba, synkrona och omfattande sido rötter initieringar, vilket möjliggör enkel samling av rotprover berikade för en specifik scen senral rotutveckling. Därefter kan dessa prover användas för att bestämma genomomfattande uttryck profiler under lateral rotutveckling. Den LRIS har gett redan betydande kunskaper om sido rotinitiering i Arabidopsis och majs 9-13, men det är nödvändigt att tillämpa detta system till andra växtarter blir tydligare ju fler genomen sekvens och det finns ett ökat intresse för att överföra kunskap till ekonomiskt viktiga arter.

Här är de detaljerade protokoll från Arabidopsis och LRISs majs ges. Därefter visas ett exempel på användningen av det system som, genom att illustrera hur transkriptomik data som insamlas från LRIS majs kan användas för att identifiera funktionella homologer som har en konserverad funktion under lateral rotinitiering över olika växtarter. Slutligen, riktlinjer optimera LRIS för andra växtarter föreslås.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis LRIS protokoll

Obs: Texten hänvisar till "små" eller "stora" skaleförsök. Småskaliga experiment, såsom markörlinje analys och histologisk färgning 6, 14, kräver endast ett fåtal prover. Storskaliga experiment, såsom kvantitativ realtids-QRT-PCR, mikro arrayer 9-11 eller RNA sekvense, kräver en större mängd prover. Som sådan, till ett belopp på ~ 1000 plantor per prov användes av Vanneste et al. 11 utföra microarray experiment efter rot segment dissektion.

DAG 1

  1. Sterilisering av Arabidopsis frön
    Obs: Välj en av följande procedurer för utsäde sterilisering. Någon av dem är lämplig för nästa steg i protokollet. Gassterilisering (1.1.2) presenterar två huvudsakliga fördelar jämfört med flytande sterilisering (1.1.1): det tar mindre tid vid hantering av ett stort number av frön, eftersom ingen pipettering måste ske för de enskilda proven; och de steriliserade fröna kan lagras under en längre period. Det kräver dock en exsickator och noggrann hantering.
    1. Flytande sterilisering
      1. Häll det önskade antalet frön i mikrocentrifugrören. Använd upp till 20 mg (~ 800 frön) i ett 1,5 ml rör eller 40 mg (~ 1600 frön) i en 2 ml mikro-centrifugrör.
      2. Tillsätt 1 ml 70% etanol. Invertera eller försiktigt skaka i 2 minuter.
      3. Byt ut 70% etanol med 1 ml steriliseringslösning för 15 minuter. (Bered färsk steriliseringslösning: 3,85 ml natriumhypoklorit (NaOCl) lager (12%) (OBS: Använd dragskåp), 5 pl Tween 20, upp till 10 ml med vatten Vänd rören flera gånger för att se till att alla frön kommer. i kontakt med lösningen.
      4. I ett laminärt luftflöde skåp, byt steriliseringslösningen med 1 ml sterilt destillerat vatten och skölj fröna 5 gånger under 5 min genom upprepadly ersätta med 1 ml färskt sterilt destillerat vatten.
    2. Gas Sterilisering
      1. Häll det önskade antalet frön i en 2 ml mikro-centrifugrör. Använd individuella rör när du arbetar med flera oberoende linjer, och ordna dem öppnats i ett plastmikro centrifugrör box eller hållare. Om antalet frön i ett rör överstiger 500 (12,5 mg), dela fröna i lämpligt antal rör för att säkerställa ett framgångsrikt sterilisering. Se till att locken på angränsande rör inte täcker varandra. Passa ihop locket av lådan på botten, eftersom den måste vara i exsickatorn även för sterilisering.
      2. Placera lådan i bunken av en torkapparat, tillsammans med en glasbägare (OBS: Använd dragskåp).
      3. Fyll bägaren med 100 ml 12% NaOCl (OBS: Använd rök huva). Sätt på locket på exsickator, men lämnar en liten öppning där bägaren placeras.
      4. Tillsätt 3 ml av 37% saltsyra (rykande) (CAUTION: Använd dragskåp) till bägaren genom den lilla öppningen och snabbt stänga exsickatorn. Lösningen kommer att bubbla under en längre tid på grund av Cl 2-gas bildas. Låt systemet stängt O / N (eller åtminstone 8 h).
      5. Avlägsna locket på exsickator. Ta ut lådan och täck den med locket för att undvika kontaminering under transporten.
      6. Placera lådan i ett laminärt luftflöde skåp, ta bort locket och låt fröna i ca 1 h vid RT för att tillåta gasutsläpp.
        Note: utsäde kan lagras säkert torrt i slutna mikro centrifugrör i upp till 2 veckor vid 4 ° C.
  2. Sido Root Induktion i Arabidopsis
    1. Lateral Root Hämning (NPA Treatment)
      1. Förbered odlingsmedium för in vitro-tillväxt. Mediet innehåller halv styrka Murashige och Skoog-saltblandningen 15, 0,1 g / I myoinositol, 10 g / I sackaros och buffras med 0,5g / I 2- (N-morfolino) etansulfonsyra (MES).
      2. Justera pH till 5,7 med 1 M KOH. Lägg 8 g / I växtvävnad agar och autoklavera medium för 20 minuter vid 121 ° C.
      3. Förbered en 25 mM stamlösning av NPA i dimetylsulfoxid (DMSO) (OBS: Använd handskar). I ett laminärt luftflödesskåp, kyla den autoklaveras mediet ner till ca 65 ° C (som är den temperatur vid vilken flaskan kan hållas för hand), och tillsätt 25 mM NPA stamlösning för att erhålla en slutlig koncentration av 10 | iM NPA.
      4. Homogenisera vid tillsats genom att försiktigt skaka flaskan för 10 sek. Häll 50 ml medium per kvadrat petriskål (12 cm x 12 cm).
        Obs: Vid storskaligt experiment, tillämpa en nylonnät (20 nm) för att säkerställa enkel överföring. Förbered en mesh (9 cm x 9 cm) för autoklavering (Figur 1A). När autoklave, tillämpa nät för att tillväxtmediet med sterila pincett (Figur 1B). Tryck försiktigt nätet till tillväxtmediet med hjälp av en sterilized drigalsky se till att den är i god kontakt med odlingsmedium (Figur 1B) (OBS: Arbete i sterila förhållanden).
      5. Så frön på NPA-plattorna.
        Obs: Om ett storskaligt experiment planeras, sugga 2 täta och väl inriktade rader med 50 frön för att underlätta provtagningen (se 1.2.2.3).
        1. Vid flytande sterilisering, så frön på NPA plåtarna med en 200 l pipett. Skär av 3 - 4 mm i slutet av pipetterings tips i sterila förhållanden (eller före sterilisering av tips) för att kunna pipettera fröna. Pipett upp och ner ett par gånger för att återsuspendera fröna, sedan pipettera cirka 150 pl sterilt vatten med 10 - 20 frön och vänta tills fröna sediment på botten av spetsen. (OBS: Arbete i sterila förhållanden)
          Obs: När du trycker på agar eller nätet försiktigt med spetsen, kommer en droppe vatten med ett frö bli befriad från den (Figur 1C).
        2. <li> Vid gassterilisering, så frön med hjälp av autoklave toothpicks.Pinch tandpetare i agar innan fröna för att säkerställa en klibbig yta. Plocka upp frön en efter en med hjälp av tandpetare och distribuera fröna på plattorna (Figur 1D). Alternativt, tillsätt sterilt vatten till fröna, och sår som beskrivs i 1.2.1.5.1 (VARNING: Arbete i sterila förhållanden).
      6. Täta plattorna med andningsbar tejp och lagra dem plattorna vid 4 ° C i mörker under minst 2 dagar och maximalt en vecka. Detta behövs för stratifiering och säkerställer synkroniserade och effektivare grobarhet.
        Obs: Alternativt kan frön stratifieras före sådd, nedsänkt i destillerat vatten i mikrocentrifug rör, vilket kräver mindre kylskåp utrymme. I det här fallet, lagra rören under minst en vecka vid 4 ° C, och flytta plattorna till tillväxt skåpet omedelbart efter sådd (se 1.2.1.7).
        DAG 3 Flytta plattorna till odlingsskåpet (kontinuerligt ljus (110 uE m -2 s -1), 21 ° C) under 5 dagar (2 dagar av groning och 3 dagar av tillväxt) i en nästan vertikal position (80 till 90 °) att säkerställa rottillväxt på, och inte i mediet.
        DAG 8
    2. Lateral Root Induktion (NAA Treatment)
      1. Förbered samma odlingsmedium som beskrivs i 1.2.1.1 och 1.2.1.2. Förbered en 50 mM stamlösning av NAA i DMSO (OBS: Använd handskar). Kyl den autoklaveras mediet ner till 65 ° C och tillsätt NAA lösning till mediet för att erhålla en slutlig koncentration av 10 | iM NAA (VARNING: Arbete i sterila betingelser).
        1. Homogenisera vid tillsats genom att försiktigt skaka flaskan för 10 sek. Häll 50 ml medium per kvadrat petriskål (12 cm x 12 cm).
      2. Överför plantorna från plattorna innehållande tillväxtmedium kompletterat med 10 | iM NPA för fack suprats med 10 | iM NAA.
        1. Haka armarna böjda pincett under hjärtbladen av plantan och ta försiktigt bort den från plattan. Endast överföra plantor av vilka rötterna har vuxit helt i kontakt med NPA-tillväxtmedium och företrädesvis nedåt.
        2. Skumma roten över NAA innehållande tillväxtmedium yta över ett litet avstånd. Se till att växtrötterna är i god kontakt med tillväxtmediet. Om det behövs, tryck grund försiktigt till tillväxtmediet yta med pincett.
          Obs: Om ett storskaligt experiment ta bort alla plantor som inte är i kontakt med nätet och överföring genom att lyfta maskorna på de två övre hörnen med pincett. Se till nätet är i god kontakt med NAA innehållande mediet genom att skumma maskorna över agarytan över ett litet avstånd (figur 1E).
      3. Täta nya plattor med andas tejp och placera dem i tillväxten skåpet (conkontinuerlig ljus (110 uE m -2 s -1), 21 ° C) i vertikalt läge för önskad tid efter induktion tills provtagningen.
        Obs: Om ett storskaligt experiment använder en skalpell för att skära de bakomliggande segment på en gång direkt på nätet och prova dem genom att försiktigt skrapa ytan av nätet.

2. LRIS Majs protokoll

  1. Skiktning av majs Kärnor
    1. Inkubera kärnorna majs vid 4 ° C i mörker under minst en vecka.
      Obs: Detta protokoll har utvecklats med hjälp av B73 majs inavlad linje.
  2. Sterilisering av majs Kärnor
    DAG 1
    Obs! Även om plantor majs inte måste odlas i sterila förhållanden, är det rekommenderat att sterilisera kärnor majs och arbeta med sterilt material för att förhindra svamptillväxt i pappersrullensystem.
    1. Placera det nödvändiga antalet kärnor majs i en steriliserad glasbägare.
    2. Tillsätt 100 ml steriliseringslösning (6% NaOCl i vatten) (OBS: Använd dragskåp).
    3. Lägg till en magnetisk omrörarstav och placera bägaren på en magnetomrörare vid låg omrörningshastighet (ca 250 rpm) vid RT under 5 minuter.
    4. Skölj fem gånger för 5 minuter genom att ersätta lösningen med 100 ml färskt sterilt vatten.
  3. Sådd Maize Kärnor
    1. Sätt på handskar för att minska risken för kontaminering, och ta en rulle hushållspapper.
    2. Riv av två sträckor av handduk papper med en total längd av två ark (ca 92 cm x 24 cm) och placera dem ovanpå varandra på en ren yta (Figur 2A).
    3. Vik arken fördubblas över längden (ca 92 cm x 12 cm) (Figur 2A).
    4. Använd pincett för att distribuera 10 kärnor på ca 2 cm från toppen över than hela längd av papperet, samtidigt som ett mellanrum på 8 cm mellan varje kärna och 8 cm fri i båda ändar (figur 2B). Se till att rotanlaget av kärnan är vänt nedåt och mot papperet (Figur 2B).
    5. Rulla försiktigt på papperet längd, medan fröna på plats (Figur 2B). För att underlätta valsning, är det valfritt att först spraya pappret med sterilt vatten.
    6. Placera pappersrullar i steriliserade glasrör cirka 6 cm i diameter och 14 cm höjd (t ex 250 ml centrifugrör) och placera dem i ett rack (figur 2C).
  4. Sido Root Induktion i Maize
    1. Förbered en 50 mM NPA stamlösning (löst i DMSO) (OBS: Använd handskar).
    2. För varje rör, gör en 50 iM NPA lösning genom att tillsätta 125 pl från 50 mM NPA stamlösning till 125 ml sterilt vatten i en steriliserad glasbägare.
    3. Blanda väl ochHäll 125 ml av 50 ^ M NPA lösning under pappersrullen i röret. Pappersrullen kommer att absorbera lösningen och bli helt blöt.
      Obs: När du använder pappersrullar och rör med andra dimensioner, justera volymen därefter. Vätskan bör nå halvvägs röret för att säkerställa tillräcklig upptagning.
    4. Placera pappersrullsystemet i en tillväxtskåp under tre dagar (27 ° C, kontinuerligt ljus, 70% relativ fuktighet). Se till att pappersrullarna förblir blöt genom att lägga till extra 50 iM NPA-lösning, eftersom lösningen avdunstar med tiden (figur 2D).
      DAG 4
    5. Förbered en 50 mM NAA stamlösning (löst i DMSO) (OBS: Använd handskar).
    6. För varje rör, förbereda en 50 iM NAA lösning genom att tillsätta 125 pl från 50 mM NAA lager till 125 ml sterilt vatten i en steriliserad glasbägare.
    7. Försiktigt pressa ut det mesta av den återstående NPA lösningen från pappersrullarna och placeram i sterilt vatten för 5 minuter för att tvätta ut (OBS: Använd handskar). Försiktigt pressa ut det mesta av vattnet från pappersrullar. Upprepa detta tvättsteg tre gånger.
    8. Blanda väl och häll 50 iM NAA lösning över pappersrullarna i rören. Se till att de är helt dränkts.
    9. Placera pappersrullsystemet i tillväxten skåpet (27 ° C, kontinuerligt ljus, 70% relativ fuktighet) under den önskade varaktigheten efter induktion.
  5. Sido Root Induktion i Tillfällig Crown Rötter av Majs
    Obs! LRIS som beskrivits ovan inducerar laterala rötter i den primära roten. Men i majs och andra monokotyledoner, den primära roten och embryonala nyskapande rötter, tillsammans med sina sidorötter, är främst viktigt under fröplanta utveckling. I ett senare skede i växtligheten, efter embryonala oavsiktlig rötter uppstå på stjälken och även utveckla sidorötter för att bilda ett nytt rotsystem 16. Den LRIS kan också vara användningd för att inducera laterala rötter på dessa post embryonala tillfälliga krona rötter genom att följa några smärre justeringar i LRIS på embryonala primära roten.
    1. För att göra pappersrullarna, skapa en smörgås papper med respektive två lager av handduk papper på utsidan och två skikt av groning papper inom. Placera de steriliserade kärnorna (se steg från 2,1 till 2,2) i mellan de två arken av groning papper. Groning papper, jämfört med handduk papper, kommer att vara mindre benägna att penetreras av rothår och laterala rötter, som kommer att göra öppnandet av pappersrullar lättare senare. Å andra sidan kommer de två externa lager av handduk papper underlätta absorption av vätskan.
    2. Sätt valsarna i 700 ml glasrör och häll sterilt vatten utan NPA över dem. Se till att de är helt dränkts.
    3. Gro de steriliserade kärnorna i tillväxtskåpet (se steg 2.4.9).
    4. Odla plantorna tills tillfälliga krona rötterbörjar dyka upp (6 dagar B73). Kontrollera att pappersrullarna hålls våt vid alla tidpunkter genom tillsättning av sterilt vatten vid behov.
    5. Överföring till en 25 | iM NPA lösning under 4 dagar (se steg 2.4.1 till 2.4.4), följt av en liknande induktion av lateral rotinitiering genom att ersätta NPA-lösning med en 50 | iM NAA lösningen efter ett tvättsteg (se steg 2,4 0,5 till 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tillämpning av LRIS att utföra jämförande transkriptomik av Lateral rotinitiering Process

En tillämpning av LRIS är jämförelsen och korrelationen av genuttrycksprofilerna under sido rotbildning i olika arter. Jämförande transkriptomik närmar skapa en möjlighet att sätta fingret på ortologa gener involverade i utvecklingsprocessen sido rot i olika arter. Rot lateral initiering, som består av bildandet av ett nytt organ från en underuppsättning av celler som finns i en redan bildad rot axel, är den huvudsakliga mekanismen som delas av angiospermer att kontrollera sin rot arkitektur. Följaktligen är det mycket troligt att den utvecklats från befintliga vägar som finns i en gemensam förfader och bevarad genom evolutionen. I själva verket har gemensamma potentiella regulatorer för sido rotinitiering påträffats i olika arter <sup> 17, 18.

Provtagning Material använda LRIS i Arabidopsis och majs, och transkriptom analys

Den LRIS har upprättats i två olika arter. Arabidopsis och majs 10, 13 I båda arterna, beslutades att prova växterna strax före NAA behandling, och strax efter induktion, vid uppkomsten av, eller under auxin svar, som liksom i början av eller under de första divisionerna i pericycle. Vidare Fluorescensaktiverad cellsortering 19 (FACS) användes i Arabidopsis eller Laser Capture Mikroskopi 20, 21 (LCM) i majs för att selektera för pericycle celler. I Arabidopsis ades tidpunkterna 2 och 6 timmar efter induktion väljas utifrån transkriptions karakterisering av pDR5 :: GUS auxin respons och pCYCB1; 1 :: GUS cellcykel markör linjer 9 (Figur 3). I majs, tiden punkterna 2, 3 och 4 timmar efter induktion, valdes efter mikroskopisk karakterisering av celldelning verksamhet och analys av flera cellcykelmarkörgener uttryck med hjälp av realtids kvantitativ omvänd transkription polymeraskedjereaktion (QRT-PCR) 13 . RNA extraherades från de isolerade cellerna och hybridiserades på microarray plattformar som tidigare beskrivits 10, 13.

Att hitta ortolog i Arabidopsis CYCB1, 1 (AtCYCB1, 1) Majs

I Arabidopsis, markörlinjen pCYCB1, 1 :: GUS har i stor utsträckning används för att spåra de första uppdelningen av pericycle under sido rotinitiering. Sådan markör skulle vara mycketanvändbar i majs. Flera homologer av AtCYCB1, 1 återfanns i majs (www.maizesequence.org, alla peptider, BLASTP, standardinställningar). Sex av dem var närvarande på microarray utförs efter LRIS i majs och visade signifikant anrikning. Den bästa BLAST hit, GRMZM2G310115, visade mycket höga transkriptionsnivåer efter LRIS, liknande vad som observerades i Arabidopsis för AtCYCB1; 1 (Figur 4).

Tillämpning av LRIS vill kolla Individuell Gene Expression

För att validera GRMZM2G310115 som en bra kandidat ortolog av AtCYCB1, en ​​i sidled majs rotinitiering, en realtids QRT-PCR på prover tagna vid olika tidpunkter genomfördes under en LRIS 13. Växter behandlades som beskrivs i ovan nämnda protokoll och skördades vid olika tidpunkter: före NAA behandling (NPA), och efter 2, 3 och 4 timmar av NAA behandling. Dessutom var material av växter som odlas endast i vatten skördas för att jämföra genuttryck mellan LRIS och neutrala villkor. Omedelbart efter skörd, rot-segment som motsvarar en region som ligger mellan 5 mm och 15 mm från den rotspetsen dissekerades under kikare. Hjälp av en pincett, var cortex separeras från stele (som innehåller pericycle), och RNA extraherades från båda vävnader. Detta sista steget utfördes istället för LCM, eftersom det är mycket snabbare och billigare för validering. Använda följande respektive framåt och bakåt QRT-PCR-primers, AGCAGGACGCAGTTGGAGAG och GAGCCGAGAGCACAGAAGAAAG var GRMZM2G310115 valideras för att vara uppregleras på LRIS, och att vara specifik för stele vävnader (Figur 5). Dessutom visar detta experiment att utan synkron induktion, de diskreta händelser lateral rotinitiering händer i en rot som växer i vatten kan inte identifieras, och illustrera behovet av LRIS att avslöja differentiell genexpression relaterat till processen lateral rotinitiering.

Figur 1
Figur 1. Lateral Root inducerbara systemet för Arabidopsis (A) Förbereda nylonnät (20 pm). Klippa nylonnät (9 cm x 9 cm), slå in den i aluminiumfolie och placera den i en glasbägare för autoklavering. (B) Applicera nylonnät på en NPA-innehållande platta (10 M) med pincett. Använd sedan en steril Drigalski för att eliminera luftbubblor. (C) så frön på nylonnät med hjälp av en pipett. (D) så frön på nylonnät med hjälp av en tandpetare. (E) Överför nylonnät till en NAA innehållande platta (10 M) med pincett.81 / 53481fig1large.jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2. Lateral Root inducerbara systemet för majs.   (A) Förbereda pappersrullarna: plats två lager av papper (92 cm x 24 cm, längd av två ark) ovanpå varandra och vik dem dubbelt över längden (92 cm x 12 cm). (B) Sätt 10 steriliserade kärnor majs med rotanlaget nedåt på papperet på 2 cm från toppen anordnade med mellanrum på 8 cm. Rulla sedan upp papperet medan kärnorna majs på plats. (C) Placera pappersrullar i rör (t.ex. 250 ml centrifugrör) och lägg dem i ett rack. (D) Odla plantorna majs för tre dagar i en 50 iM NPA-lösning (vid 27 ° C, kontinuerligt ljus, relativa Humifuktigheten 70%). (E) Vänster: plantor strax före överföring till NAA; USA: mikrotomen tvärsektioner strax före överföring till NAA och 2 dagar efter överföring till NAA; Till höger:. Plantor med synliga uppstått laterala rötter 5 dagar efter överföring till NAA Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. Lateral rotinitiering stimuleras vid långvarig NAA behandling. (AF) Tidsförlopp visar auxin svar under en NAA behandling med hjälp av pDR5 :: GUS markeringslinjen. Den auxin svar, som är en av de första händelserna som utlöser sido rotinitiering startar två timmar efter starten av NAA behandlingen. I den övre panelen är en översikt över hela plantan ges; den undre panelen visarär den auxin svar i roten tips. (GM) Tidsförloppet för en NAA behandling med hjälp av pCYCB1, 1 :: GUS markeringslinjen. GUS-signalen representerar expressionen av CYCB1, 1-genen, vilket indikerar att de första celldelningarna leder till lateral rotbildning start 6 timmar efter start av NAA behandlingen. I den övre panelen är en översikt över hela plantan ges; den undre panelen visar CYCB1;. 1 uttryck i rotspetsen (GUS färgning enligt Beeckman och Engler, 1994 22) Klicka här för att se en större version av denna siffra.

Figur 4
Figur 4. Expression profil CYCB1 Gener i Arabidopsis och majs under LRIS.   (A) microarray expressions värden AtCYCB1, ett under LRIS såsom beskrivits av De Smet et al. 2008 10 (B) Microarray uttrycksvärden potentiella ortologer av AtCYCB1, 1 under LRIS såsom beskrivits av Jansen et al. 2013 13 BLASTP poäng är poängen erhålls när sprängning proteinsekvensen av AtCYCB1, 1 på genomet majs. Felstaplar uttrycker standardavvikelse och ** står för ett p-värde ≤0.01. Klicka här för att se en större version av denna siffra.

Figur 5
Figur 5. Expression av GRMZM2G310115 i Stele och Cortex av majs Roots under LRIS. Uttrycket av <em> GRMZM2G310115 under LRIS i majs utvärderades genom kvantitativ realtids-QRT-PCR på dissekerade stele och cortex prover. En kompletterande provtagning utfördes på växter som odlas på vatten. Värdena normaliserats för expression i stele i vatten. Felstaplar uttrycker standardavvikelse och ** står för ett p-värde ≤0.01 (primers och referensgener enligt Jansen et al. 2013 13). Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I Arabidopsis LRIS protokoll är det viktigt att endast överföra plantorna som har växt helt i kontakt med NPA-innehållande tillväxtmedium. Detta säkerställer att sido rotinitiering blockeras över hela rotlängd. För att förhindra sårbildning plantorna under överföring, kan armarna på böjda pincett hakas under hjärtbladen i plantan. Vid överlåtelse, se till att plantan rötter i tillräcklig kontakt med NAA innehållande agarmedium. Detta kan uppnås genom att skumma roten över agarytan över ett litet avstånd. Detta kommer att säkerställa en effektiv synkroniserad induktion av sido rotinitiering över den totala rotlängd. Rötterna kan odlas exponeras för ljus utan att negativt påverka deras tillväxt och lateral rot induktion.

I LRIS majs protokollet, är det viktigt att rotanlaget av kärnan vänd nedåt och mot papperet för att säkerställa att roten växer downwards och fäster vid papperet på rätt sida 16. Efter tre dagar av NPA behandling bör plantorna har kommit från kärnan med en liten shoot, en primär rot och fruktbärande rötter 16. Den primära roten bör vara ca 2 cm lång innan man induktion av sido rotinitiering. Detta protokoll har utvecklats med hjälp av B73 majs inavlad linje, men i händelse av en majslinjen med en annan tillväxttakt, justera inkubationstiden därefter. Se till att pappersrullarna förblir blöt genom att tillsätta regelbundet 50 iM NPA lösningen när vätskan förångas med tiden, annars NPA behandling kan vara ineffektiv och oönskad tidig sido utveckling rot kan inträffa. Själva systemet förhindrar utläggning av rötterna till ljuset, men ljuset är inte en stor fråga och påverkar inte rot tillväxt och lateral rot induktion.

Alternativa sätt för kontrollerad induktion av laterala rötter är användningen av mechanical böjning 23 eller gravistimulation 24. Den främsta fördelen med dessa system är att de har en mer "naturlig" induktion jämfört med de hormonbehandlingar i LRIS, men nackdelen är att de är begränsade i den mängd material som kan skördas vid en given tidpunkt, eftersom de endast ge en lateral händelse rotinitiering i kurvan per planta jämfört med en full induktion av pericycle i LRIS.

Den LRIS används i Arabidopsis och majs kan användas i en mängd olika växter, men gynnsamma förhållanden måste optimeras. Om du vill installera en LRIS, två viktiga successiva steg måste uppnås: (1) blockering av auxin transport och (2) ansamling av auxin att inducera lateral rotinitiering. Den växande systemet bör möjliggöra effektiv och enhetlig upptagning av föreningarna och bör medge god utveckling av plantor. Alternativa system till fast medium (Arabidopsis) och pappersrullar (majs), såsom flytande kultur, hydrokultur, eller aeroponics, skulle kunna användas för andra arter. Det första steget i LRIS, dvs blockering av auxin transporter, kan åstadkommas genom att tillsätta en auxin transport hämmare. Även NPA leder till en effektiv block av sido rotinitiering i Arabidopsis och majs, alternativa föreningar såsom 2,3,5-trijodbensoesyra (TIBA) eller p chlorophenoxyisobutyric syra (pCIB) kan fungera bättre i andra arter. En liknande optimering kan göras för det andra steget i LRIS, dvs auxin behandling. Den syntetiska auxin NAA verkar vara den mest lämpade för en LRIS. Den auxin prekursor indol-3-smörsyra (IBA) kan vara ett bra alternativ, eftersom det också starkt inducerar laterala rötter och har en hög bioaktivitet i olika växter 25, 26. Å andra sidan, den naturliga auxin indol-3-ättiksyra (IAA) är mindre stabil och lättare metaboliseras 27, rationalisera sin svagare effekt på rot develling i exempelvis majs eller ris 25, 26. Den syntetiska auxin 2,4-diklorfenoxiättiksyra (2,4D) ackumuleras högt i pericycle celler, delvis för att det inte exporteras från cellerna 28, försämrar korrekt lateral rotinitiering och förmå artificiell fuserade konstruktioner. Även andra föreningar som interagerar med auxin vägar, såsom naxillin 12, har visats inducera lateral rotinitiering i Arabidopsis och kan provas i andra arter.

I vissa fall är grobarheten ineffektiv i närvaro av NPA och en kan välja att först gro fröna i frånvaro av NPA, att därefter överföra plantorna till NPA-haltiga systemet. Detta framkallar en möjlig risk att få tidiga sido primordia rot inletts före lateral rot induktion med NAA behandling och därför är det viktigt att bara prova regionen av roten som långsträckta under NPA-behandling. Efter denna allmänna strategi, en should kunna optimera en LRIS för praktiskt taget alla (utsäde) anläggning och som sådan har ett enkelt system för att studera lateral utveckling rot för anläggningen av intresse. Ytterligare karakterisering av tidpunkten för den laterala rotinitiering kan ske via markeringslinjer, såsom har exemplifierats för Arabidopsis. Om markör linjer är svårt att få, kan en detaljerad histologisk undersökning göras, men det är tidskrävande och den första celldelningar är inte lätt att känna igen. Alternativt kan uttrycksanalys av celldelnings markörer användas för att indikera tidpunkten för de första celldelningar.

Den LRIS kan användas för olika ändamål, såsom transkriptomanalys 9-13 som beskrivs kortfattat i resultaten, liksom histologiska observationer på makroskopisk och mikroskopisk nivå under sido rotinitiering 14. Olika typer av provtagning, från organ till cell skala 29, kan tillåta rivas upp olika aspekter av senareal rotinitiering. Dessutom kan den LRIS användas för att övervaka effekten av olika föreningar på den laterala rotinitiering 12, 30. Slutligen, genom användning av reporter linjer, en LRIS kan också användas för att enkelt karakterisera genuttryck och / eller proteinlokalisering under lateral rotutveckling.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Lateral Root inducerbara systemet i<em&gt; Arabidopsis</em&gt; Och Maize
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter