The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.
Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is however tedious, because it occurs only in a few cells inside the root and in an unpredictable manner. To circumvent this problem, a Lateral Root Inducible System (LRIS) has been developed. By treating seedlings consecutively with an auxin transport inhibitor and a synthetic auxin, highly controlled lateral root initiation occurs synchronously in the primary root, allowing abundant sampling of a desired developmental stage. The LRIS has first been developed for Arabidopsis thaliana, but can be applied to other plants as well. Accordingly, it has been adapted for use in maize (Zea mays). A detailed overview of the different steps of the LRIS in both plants is given. The combination of this system with comparative transcriptomics made it possible to identify functional homologs of Arabidopsis lateral root initiation genes in other species as illustrated here for the CYCLIN B1;1 (CYCB1;1) cell cycle gene in maize. Finally, the principles that need to be taken into account when an LRIS is developed for other plant species are discussed.
The root system is crucial for plant growth, since it ensures anchorage and uptake of water and nutrients from the soil. Because the expansion of a root system mainly relies on the production of lateral roots, their initiation and formation have been widely studied. Lateral roots are initiated in a specific subset of pericycle cells, called founder cells1. In most dicots, such as Arabidopsis thaliana, these cells are located at the protoxylem poles2, whereas in monocots, such as maize, they are found at the phloem poles3. Founder cells are marked by an increased auxin response4, followed by expression of specific cell cycle genes (e.g., CYCLIN B1;1 / CYCB1;1), after which they undergo a first round of asymmetric anticlinal divisions5. After a series of coordinated anticlinal and periclinal divisions, a lateral root primordium is formed that finally will emerge as an autonomous lateral root. The location and timing of lateral root initiation are however not predictable, since these events are neither abundant nor synchronized. This impedes the use of molecular approaches such as transcriptomics to study this process.
To tackle this, a Lateral Root Inducible System (LRIS) has been developed6, 7. In this system, seedlings are first treated with N-1-naphthylphthalamic acid (NPA), which inhibits auxin transport and accumulation, consequently blocking lateral root initiation8. By subsequently transferring the seedling to medium containing the synthetic auxin 1-naphthalene acetic acid (NAA), the entire pericycle layer responds to the elevated auxin levels thereby massively inducing lateral root initiating cell divisions6. As such, this system leads to fast, synchronous and extensive lateral roots initiations, allowing easy collection of root samples enriched for a specific stage of lateral root development. Subsequently, these samples can be used to determine genome-wide expression profiles during lateral root formation. The LRIS has yielded already significant knowledge about lateral root initiation in Arabidopsis and maize9-13, but the need to apply this system to other plant species becomes more apparent as more genomes are sequenced and there is an increasing interest to transfer knowledge to economical important species.
Here, the detailed protocols of the Arabidopsis and maize LRISs are given. Next, an example of the use of the system is provided, by illustrating how transcriptomics data gained from the maize LRIS can be used to identify functional homologs that have a conserved function during lateral root initiation across different plant species. Finally, guidelines to optimize the LRIS for other plant species are proposed.
1. Arabidopsis LRIS Protocol
Note: The text refers to "small" or "large" scale experiments. Small scale experiments, such as marker line analysis and histological staining6, 14, require only a few samples. Large scale experiments, such as quantitative real-time qRT-PCR, micro-arrays9-11 or RNA sequencing, require a larger amount of samples. As such, an amount of ~1000 seedlings per sample was used by Vanneste et al.11 to perform microarray experiment after root segment dissection.
DAY 1
2. LRIS Maize Protocol
Application of the LRIS to Perform Comparative Transcriptomics of the Lateral Root Initiation Process
One application of the LRIS is the comparison and correlation of gene expression profiles during lateral root formation in different species. Comparative transcriptomics approaches create the possibility to pinpoint orthologous genes involved in the lateral root development process in different species. Lateral root initiation, which consists of the formation of a new organ from a subset of cells contained in an already formed root axis, is the major mechanism shared by angiosperms to control their root architecture. Consequently, it is very likely that it evolved from existing pathways present in a common ancestor and was conserved throughout evolution. Indeed, common potential regulators of lateral root initiation have been found in different species17, 18.
Sampling Material using the LRIS in Arabidopsis and Maize, and Transcriptome Analysis
The LRIS has been established in two different species: Arabidopsis and maize10, 13. In both species, it was decided to sample the plants just before NAA treatment, and shortly after induction, at the onset of, or during the auxin response, as well as at the onset of, or during the first divisions in the pericycle. Furthermore, Fluorescence Activated Cell Sorting19 (FACS) was used in Arabidopsis or Laser Capture Microscopy20, 21 (LCM) in maize to select for pericycle cells. In Arabidopsis, the time points of 2 and 6 hr after induction were chosen based on the transcriptional characterization of the pDR5::GUS auxin response and pCYCB1;1::GUS cell cycle marker lines9 (Figure 3). In maize, the time points 2, 3 and 4 hr after induction, were selected after microscopic characterization of cell division activity and the analysis of several cell cycle marker genes expression using real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)13. RNA was extracted from the isolated cells and hybridized on microarray platforms as previously described10, 13.
Finding the Ortholog of ArabidopsisCYCB1;1 (AtCYCB1;1) in Maize
In Arabidopsis, the marker line pCYCB1;1::GUS has been widely used to track the first divisions of the pericycle during lateral root initiation. Such marker would be very useful in maize. Several homologs of AtCYCB1;1 were found in maize (www.maizesequence.org, all peptides, BLASTP, default settings). Six of them were present on the microarray performed after LRIS in maize and showed significant enrichment. The best BLAST hit, GRMZM2G310115, showed very high transcription levels after LRIS, similar to what was observed in Arabidopsis for AtCYCB1;1 (Figure 4).
Application of the LRIS to Check Individual Gene Expression
To validate GRMZM2G310115 as a good candidate ortholog of AtCYCB1;1 in maize lateral root initiation, a real-time qRT-PCR on samples taken at different time points was performed during the course of an LRIS13. Plants were treated as described in the above-mentioned protocol and harvested at different time points: before NAA treatment (NPA), and after 2, 3 and 4 hr of NAA treatment. Also, material of plants grown only in water was harvested to compare gene expression between LRIS and neutral conditions. Immediately after harvesting, root segments corresponding to a region comprised between 5 mm and 15 mm above the root tip were dissected under the binocular. Using tweezers, the cortex was separated from the stele (which contains the pericycle), and RNA was extracted from both tissues. This last step was performed instead of LCM, because it is much faster and cheaper for validation. Using the following respective forward and reverse qRT-PCR primers, AGCAGGACGCAGTTGGAGAG and GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 was validated to be up-regulated upon LRIS, and to be specific for the stele tissues (Figure 5). Additionally, this experiment shows that without synchronous induction, the discrete events of lateral root initiation happening in a root growing in water are not detectable, and illustrate the need of the LRIS to reveal differential gene expression related to the process of lateral root initiation.
Figure 1. Lateral Root Inducible System for Arabidopsis. (A) Preparing the nylon mesh (20 µm): cut the nylon mesh (9 cm by 9 cm), wrap it in aluminum foil and put it in a glass beaker for autoclaving. (B) Apply the nylon mesh on an NPA-containing plate (10 µM) using tweezers. Then use a sterile drigalski in order to eliminate air bubbles. (C) Sowing seeds on the nylon mesh using a pipet. (D) Sowing seeds on the nylon mesh using a toothpick. (E) Transfer the nylon mesh to an NAA-containing plate (10 µM) using tweezers. Please click here to view a larger version of this figure.
Figure 2. Lateral Root Inducible System for Maize. (A) Preparing the paper rolls: place two layers of paper (92 cm x 24 cm, length of two sheets) on top of each other and fold them double over the length (92 cm x 12 cm). (B) Put 10 sterilized maize kernels with the radicle facing down on the paper at 2 cm from the top with an interspacing of 8 cm. Then roll up the paper while keeping the maize kernels in place. (C) Place the paper rolls in tubes (e.g., 250 ml centrifuge tubes) and put them in a rack. (D) Grow the maize seedlings for three days in a 50 µM NPA solution (at 27 °C, continuous light, relative humidity 70%). (E) Left: seedling just before transfer to NAA; Middle: microtome transversal sections just before transfer to NAA and 2 days after transfer to NAA; Right: seedling with visible emerged lateral roots 5 days after transfer to NAA. Please click here to view a larger version of this figure.
Figure 3. Lateral Root Initiation is Stimulated Upon Prolonged NAA Treatment. (A-F) Time course showing the auxin response during an NAA treatment using the pDR5::GUS marker line. The auxin response, which is one of the first events triggering lateral root initiation, starts 2 hr after the start of the NAA treatment. In the upper panel, an overview of the whole seedling is given; the lower panel shows the auxin response in the root tip. (G-M) Time course of an NAA treatment using the pCYCB1;1::GUS marker line. The GUS signal represents the expression of the CYCB1;1 gene, indicating that the first cell divisions leading to lateral root formation start 6 h after the start of the NAA treatment. In the upper panel, an overview of the whole seedling is given; the lower panel shows CYCB1;1 expression in the root tip (GUS staining according to Beeckman and Engler, 199422). Please click here to view a larger version of this figure.
Figure 4. Expression Profile of CYCB1 Genes in Arabidopsis and Maize during LRIS. (A) Microarray expression values of AtCYCB1;1 during LRIS as described by De Smet et al. 200810 (B) Microarray expression values of potential orthologs of AtCYCB1;1 during LRIS as described by Jansen et al. 201313 BLASTP score is the score obtained when blasting the protein sequence of AtCYCB1;1 on the maize genome. Error bars express standard deviation and ** stands for a p-value ≤0.01. Please click here to view a larger version of this figure.
Figure 5. Expression of GRMZM2G310115 in the Stele and the Cortex of Maize Roots during LRIS. The expression of GRMZM2G310115 during LRIS in maize was evaluated by quantitative real-time qRT-PCR on dissected stele and cortex samples. A supplementary sampling was performed on plants grown on water. Values were normalized for expression in the stele in water. Error bars express standard deviation and ** stands for a p-value ≤0.01 (primers and reference genes according to Jansen et al. 201313). Please click here to view a larger version of this figure.
In the Arabidopsis LRIS protocol, it is important to only transfer the seedlings that have grown entirely in contact with the NPA-containing growth medium. This ensures that lateral root initiation is blocked over the entire root length. In order to prevent wounding the plantlets during transfer, the arms of the curved forceps can be hooked under the cotyledons of the seedling. Upon transfer, make sure that the seedling roots are in sufficient contact with the NAA-containing agar medium. This can be achieved by skimming the root over the agar surface over a small distance. This will ensure an efficient synchronized induction of the lateral root initiation over the total root length. The roots can be grown exposed to light without negatively affecting their growth and lateral root induction.
In the maize LRIS protocol, it is important that the radicle of the kernel faces down and toward the paper to ensure the root will grow downwards and attach to the paper at the correct side16. After three days of NPA treatment, the seedlings should have emerged from the kernel with a small shoot, a primary root and seminal roots16. The primary root should be approximately 2 cm long before proceeding to the induction of lateral root initiation. This protocol has been developed using the B73 maize inbred line, but in case of a maize line with a different growth rate, adjust the incubation time accordingly. Make sure that the paper rolls remain soaked by adding regularly 50 µM NPA solution when the liquid vaporizes over time, otherwise NPA treatment could be inefficient and unwanted early lateral root development could occur. The system itself prevents exposition of the roots to the light, but light is not a major issue and doesn't affect root growth and lateral root induction.
Alternative ways for controlled induction of lateral roots are the use of mechanical bending23 or gravistimulation24. The main advantage of these systems is that they have a more 'natural' induction compared to the hormone treatments in the LRIS, but the disadvantage is that they are limited in the amount of material that can be harvested at a given time point because they only yield one lateral root initiation event in the bend per seedling compared to a full induction of the pericycle in the LRIS.
The LRIS used in Arabidopsis and maize can be used in a variety of plants, though favorable conditions need to be optimized. To install an LRIS, two important successive steps have to be achieved: (1) blocking of auxin transport and (2) accumulation of auxin to induce lateral root initiation. The growing system should allow for efficient and uniform uptake of the compounds and should permit good development of the seedlings. Alternative systems to solid medium (Arabidopsis) and paper rolls (maize), such as liquid culture, hydroponics, or aeroponics, could be used for other species. The first stage in the LRIS, i.e., the blocking of the auxin transport, can be achieved by adding an auxin transport inhibitor. Although NPA leads to an efficient block of lateral root initiation in Arabidopsis and maize, alternative compounds such as 2,3,5-triiodobenzoic acid (TIBA) or p-chlorophenoxyisobutyric acid (PCIB) might work better in other species. A similar optimization can be done for the second step of the LRIS, i.e., the auxin treatment. The synthetic auxin NAA seems to be the most suited for an LRIS. The auxin precursor indol-3-butyric acid (IBA) might be a good alternative as it also strongly induces lateral roots and has a high bioactivity in different plants25, 26 . On the other hand, the natural auxin indole-3-acetic acid (IAA) is less stable and more easily metabolized27, rationalizing its weaker effect on root development in for example maize or rice25, 26. The synthetic auxin 2,4-dichlorophenoxyacetic acid (2,4D) accumulates highly in pericycle cells, partially because it is not exported from the cells28, impairing proper lateral root initiation and inducing artificial fused structures. Also other compounds interacting with auxin pathways, such as naxillin12, have been shown to induce lateral root initiation in Arabidopsis and can be tested in other species.
In some cases, germination is inefficient in the presence of NPA and one might choose to first germinate the seeds in the absence of NPA, to subsequently transfer the seedlings to the NPA-containing system. This induces a possible risk of having early lateral root primordia initiated before lateral root induction with NAA treatment and, hence, it is important to only sample the region of the root that elongated during NPA treatment. Following this general strategy, one should be able to optimize an LRIS for practically any (seed) plant and as such have an easy system to study lateral root development for the plant of interest. Further characterization of the timing of the lateral root initiation can occur via marker lines, as exemplified for Arabidopsis. If marker lines are difficult to obtain, a detailed histological study could be done, but this is time-consuming and the first cell divisions are not easily recognizable. Alternatively, expression analysis of cell division markers can be used to indicate the timing of the first cell divisions.
The LRIS can be used for different purposes, such as transcriptome analysis9-13 as briefly described in the results, as well as histological observations at the macroscopic and microscopic level during lateral root initiation14. Different types of sampling, ranging from organ to cell scale29, might allow unraveling different aspects of the lateral root initiation. In addition, the LRIS can be used to monitor the effect of different compounds on the lateral root initiation12, 30. Finally, by using reporter lines, a LRIS can also be used to easily characterize the gene expression and/or protein localization during lateral root development.
The authors have nothing to disclose.
The authors thank Davy Opdenacker for technical assistance and photography. We greatly thank Dr. Annick Bleys for helpful suggestions to improve the manuscript. This work was financed by the Interuniversity Attraction Poles Programme IUAP P7/29 ‘MARS’ from the Belgian Federal Science Policy Office, by the FWO grant G027313N and by the Agency for Innovation by Science and Technology, IWT (IR).
ARABIDOPSIS LRIS | |||
Seeds | |||
Arabidopsis seeds | Col-0 ecotype | ||
Gas sterilization of seeds | |||
micro-centrifuge tubes 1.5 ml | SIGMA-ALDRICH | 0030 125.215 | Eppendorf microtubes 3810X, PCR clean |
micro-centrifuge tubes 2 ml | SIGMA-ALDRICH | 0030 120.094 | Eppendorf Safe-Lock microcentrifuge tubes |
hydrochloric acid | Merck KGaA | 1,003,171,000 | 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu |
glass desiccator | SIGMA-ALDRICH | Pyrex | |
glass beaker | |||
plastic micro-centrifuge tubes box or holder | |||
Bleach sterilization of seeds | |||
ethanol | Chem-Lab nv | CL00.0505.1000 | Ethanol, abs. 100% a.r. dilute to 70% |
sodium hypochlorite (NaOCl) | Carl Roth | 9062.3 | 12% |
Tween 20 | SIGMA-ALDRICH | P1379 | |
sterile water | |||
Growth medium | |||
Murashige and Skoog salt mixture | DUCHEFA Biochemie B.V. | M0221-0050 | |
myo-inositol | SIGMA-ALDRICH | I5125-100G | |
2-(N-morpholino)ethanesulfonic acid (MES) | DUCHEFA Biochemie B.V. | M1503.0100 | |
sucrose | VWR, Internation LLC | 27483.294 | D(+)-Sucrose Ph. Eur. |
KOH | Merck KGaA | 1050211000 | pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur |
Plant Tissue Culture Agar | LabM Limited | MC029 | |
Lateral root induction chemicals | |||
N-1-naphthylphthalamic acid (NPA) | DUCHEFA Biochemie B.V. | No. N0926.0250 | 10 µM (Arabidopsis) |
1-naphthalene acetic acid (NAA) | DUCHEFA Biochemie B.V. | No. N0903.0050 | 10 µM (Arabidopsis) |
dimethylsulfoxide (DMSO) | SIGMA-ALDRICH | 494429-1L | |
Making a mesh for transfer | |||
nylon mesh | Prosep byba | Synthetic nylon mesh 20 µm | |
Sowing and seedling handling | |||
square petri dish plates | GOSSELIN | BP124-05 | 12 x 12 cm |
50 ml DURAN tubes | SIGMA-ALDRICH | CLS430304 | Corning 50 mL centrifuge tubes |
drigalski | Carl Roth | K732.1 | |
pipette | |||
cut pipette tips | Daslab | 162001X | Universal 200, cut off 5 mm of tip before autoclaving |
breathable tape | 3M Deutschland GmbH | cat. no. 1530-1 | |
tweezers | Fiers nv/sa | K342.1; K344.1 | Dumont tweezers type a nr 5; Dumont tweezers type e nr 7 |
Growth conditions | |||
growth room | 21 °C, continuous light | ||
Materials | Company | Catalog | Comments |
MAIZE LRIS | |||
Seeds | |||
Maize kernels | B-73 | ||
Bleach sterilization of kernels | |||
glass beaker | |||
magnetic stirrer | Fiers nv/sa | C267.1 | |
sodium hypochlorite (NaOCl) | Carl Roth | 9062.3 | 12% |
sterile water | |||
Lateral root induction chemicals | |||
N-1-naphthylphthalamic acid (NPA) | DUCHEFA Biochemie B.V. | No. N0926.0250 | 50 µM (maize primary root), 25 µM (maize adventitious root) |
1-naphthalene acetic acid (NAA) | DUCHEFA Biochemie B.V. | No. N0903.0050 | 50 µM (maize) |
dimethylsulfoxide (DMSO) | SIGMA-ALDRICH | 494429-1L | |
Sowing and seedling handling | |||
paper hand towels | Kimberly-Clark Professional* | 6681 | SCOTT Hand Towels – Roll / White; sheet size (24 x 46 cm) |
seed germination paper | Anchor Paper Company | 10 X 15 38# seed germination paper | |
tweezers | Fiers nv/sa | K342.1; K344.1 | Dumont tweezers type a nr 5; Dumont tweezers type e nr 7 |
250 ml (centrifuge) tubes | SCHOTT DURAN | 2160136 | approx. 5.6 cm diameter and 14.7 cm height |
700 ml tubes | DURAN GROUP | 213994609 | cylinders, round foot tube, D 60 x 250 |
rack | for maize tubes, home made | ||
sterile water | |||
Growth conditions | |||
growth cabinet | 27 °C, continuous light, 70% relative humidity |