Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Laterale Root inducibile di sistema in doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il sistema radicale è cruciale per la crescita delle piante, in quanto garantisce l'ancoraggio e l'assorbimento di acqua e nutrienti dal terreno. Poiché l'espansione di un sistema radicale si basa principalmente sulla produzione di radici laterali, la loro iniziazione e formazione sono stati ampiamente studiati. Radici laterali sono iniziati in uno specifico sottogruppo di cellule pericycle, chiamate cellule fondatore 1. Nella maggior parte delle dicotiledoni, come Arabidopsis thaliana, queste cellule si trovano ai poli protoxylem 2, mentre in monocotiledoni, come il mais, si trovano ai poli floema 3. Fondatore cellule sono caratterizzati da un aumento della risposta auxina 4, seguita dalla espressione di specifici geni del ciclo cellulare (ad esempio, CYCLIN B1; 1 / CYCB1; 1), dopo di che subiscono un primo giro di asimmetrici divisioni anticlinali 5. Dopo una serie di divisioni anticlinali e periclinal coordinati, un primordio radice laterale è formata che finalmente emergerà come unradici laterali utonomous. La posizione e la tempistica di apertura laterale root non sono comunque prevedibile, poiché questi eventi sono né abbondanti né sincronizzato. Questo impedisce l'utilizzo di approcci molecolari, come trascrittomica per studiare questo processo.

Per affrontare questo, una laterale Root inducibile System (Lris) è stato sviluppato 6, 7. In questo sistema, piantine vengono prima trattati con acido N -1-naphthylphthalamic (NPA), che inibisce il trasporto e l'accumulo di auxina, bloccando di conseguenza laterali iniziazione radice 8. Con successiva cessione delle piantina di terreno contenente l'auxina sintetico acido acetico 1-naftalene (NAA), l'intero strato pericycle risponde ai livelli di auxina elevati così massicciamente che inducono alla radice l'avvio divisioni cellulari laterali 6. Come tale, questo sistema porta a veloci, sincroni ed estese radici laterali iniziazioni, che consente un facile prelievo di campioni di radice arricchito da una determinata fase di ritardolo sviluppo delle radici ral. Successivamente, questi campioni possono essere utilizzati per determinare profili di espressione a livello di genoma durante la formazione delle radici laterali. Il Lris ha prodotto conoscenze già significativo circa iniziazione laterale radici in Arabidopsis e mais 9-13, ma la necessità di applicare questo sistema per altre specie di piante diventa più evidente quanto più genomi sono in sequenza e non vi è un interesse crescente per trasferire la conoscenza a economico importante specie.

Qui, sono indicati i protocolli dettagliati della Arabidopsis e mais LRISs. Successivamente, un esempio di utilizzo del sistema è fornito, illustrando come trascrittomica dati ricavati dal mais Lris possono essere utilizzati per identificare omologhi funzionali che hanno una funzione conservata durante l'inizio radice laterale attraverso diverse specie vegetali. Infine, le linee guida per ottimizzare il Lris sono proposti per altre specie vegetali.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis Lris protocollo

Nota: Il testo fa riferimento a "piccoli" o "grandi" esperimenti scala. Esperimenti su scala ridotta, come l'analisi linea marcatore e colorazione istologica 6, 14, richiedono solo un paio di esempi. Esperimenti su vasta scala, come quantitativa real-time qRT-PCR, microarray 9-11 o RNA sequencing, richiedono una maggiore quantità di campioni. In quanto tale, un importo pari a ~ 1000 piantine per campione è stato utilizzato da Vanneste et al. 11 per eseguire esperimenti di microarray dopo segmento radice dissezione.

GIORNO 1

  1. Sterilizzazione di Arabidopsis Seeds
    Nota: selezionare una delle seguenti procedure per la sterilizzazione del seme. Uno di essi è adatto per le prossime fasi del protocollo. Sterilizzazione a gas (1.1.2) presenta due vantaggi principali rispetto sterilizzazione liquida (1.1.1): ci vuole meno tempo quando si maneggia una grande intorpiditoer di semi, poiché nessuna pipettaggio deve verificarsi per i singoli campioni; ei semi sterilizzati possono essere conservati per un periodo più lungo. Tuttavia, esso richiede un essiccatore e accurato trattamento.
    1. Sterilizzazione liquido
      1. Versare il numero desiderato di semi in tubi di micro-centrifuga. Utilizzare fino a 20 mg (~ 800 semi) in una provetta da 1,5 ml o 40 mg (~ 1600 semi) in 2 ml provette micro-centrifuga.
      2. Aggiungere 1 ml di etanolo al 70%. Invertire o scuotere delicatamente per 2 minuti.
      3. Sostituire l'etanolo al 70% con 1 ml di soluzione di sterilizzazione per 15 min. (Preparare la soluzione di sterilizzazione fresco: 3,85 ml di ipoclorito di sodio (NaOCl) stock (12%) (ATTENZIONE: l'utilizzo fumi cappa), 5 ml Tween 20, fino a 10 ml con acqua invertire i tubi diverse volte per assicurarsi che tutti i semi arrivano. in contatto con la soluzione.
      4. In una cappa a flusso laminare, sostituire la soluzione di sterilizzazione con 1 ml di acqua distillata sterile e sciacquare i semi 5 volte per 5 min da ripetutily sostituzione con 1 ml di acqua distillata sterile fresca.
    2. Sterilizzazione Gas
      1. Versare il numero desiderato di semi in un tubo da centrifuga micro-2 ml. Utilizzare singoli tubi quando si lavora con più linee indipendenti, e disporli aperti in una scatola tubi micro-centrifuga di plastica o di supporto. Se il numero di semi in un tubo supera 500 (12,5 mg), suddividere i semi al numero appropriato di provette per assicurare sterilizzazione. Assicurarsi che i tappi di tubi adiacenti non coprono l'un l'altro. Montare insieme il coperchio della scatola sul fondo, in quanto deve essere nell'essiccatore anche per la sterilizzazione.
      2. Posizionare la scatola nella ciotola di un essiccatore, insieme a un bicchiere di vetro (ATTENZIONE: l'utilizzo dei fumi cappa).
      3. Riempire il bicchiere con 100 ml di 12% NaOCl (ATTENZIONE: Utilizzare cappa). Mettere il coperchio sulla essiccatore, ma lasciare una piccola apertura in cui è collocato il bicchiere.
      4. Aggiungere 3 ml di acido cloridrico 37% (fumigante) (CAUZIONE: Usa fume hood) al bicchiere attraverso la piccola apertura e chiudere rapidamente un essiccatore. La volontà bolla soluzione per qualche tempo a causa di Cl formazione 2 -gas. Lasciare il sistema chiuso O / N (o almeno 8 ore).
      5. Togliere il coperchio del essiccatore. Estrarre la scatola e coprire con il coperchio per evitare la contaminazione durante il trasporto.
      6. Mettere la scatola in un armadio flusso laminare, togliere il coperchio e lasciare i semi per circa 1 ora a temperatura ambiente per permettere la fuoriuscita di gas.
        Nota: I semi possono essere secca in tubi di micro-centrifuga chiusi conservati in modo sicuro fino a 2 settimane a 4 ° C.
  2. Laterale induzione Root in Arabidopsis
    1. Laterale Root inibizione (NPA Treatment)
      1. Preparare il terreno di coltura per la crescita in vitro. Il terreno contiene metà forza Murashige e Skoog miscela di sale 15, 0,1 g / L mio-inositolo, 10 g / L di saccarosio, ed è tamponata con 0,5g / L 2- (N-morfolino) Acido etansolfonico (MES).
      2. Regolare il pH a 5,7 con 1 M KOH. Aggiungere 8 g / L di agar pianta tessuto e il mezzo autoclave per 20 minuti a 121 ° C.
      3. Preparare una soluzione madre 25 mm di NPA in dimetilsolfossido (DMSO) (ATTENZIONE: Indossare guanti). In una cappa a flusso laminare, raffreddare il mezzo autoclavato fino a circa 65 ° C (che è la temperatura a cui la bottiglia può essere tenuto a mano), e aggiungere 25 soluzione madre NPA mM per ottenere una concentrazione finale di 10 pM NPA.
      4. Omogeneizzare su oltre agitando delicatamente il flacone per 10 secondi. Versare 50 ml di terreno per ogni piatto quadrato di Petri (12 cm x 12 cm).
        Nota: In caso di esperimenti su larga scala, applicare una rete di nylon (20 micron) per assicurare un facile trasferimento. Preparare una maglia (9 cm x 9 cm) per la sterilizzazione in autoclave (Figura 1A). Quando autoclave, applicare la rete al mezzo di crescita con una pinzetta sterile (Figura 1B). Spingere delicatamente la maglia al mezzo di crescita con una sterilized drigalsky per assicurarsi che sia in buon contatto con il mezzo di crescita (Figura 1B) (ATTENZIONE: Il lavoro in condizioni sterili).
      5. Seminare i semi sui NPA piastre.
        Nota: Nel caso in cui è previsto un esperimento su larga scala, seminare 2 file densi e ben allineati di 50 semi di facilitare il prelievo (vedi 1.2.2.3).
        1. In caso di sterilizzazione liquido, seminare i semi su NPA-lastre con una pipetta 200 l. Tagliare 3 - 4 mm dalla fine delle punte di pipettaggio in condizioni sterili (o prima della sterilizzazione delle punte) per poter pipettare i semi. Pipettare su e giù un paio di volte a ri-sospendere i semi, poi pipettare acqua circa 150 microlitri sterile con 10 - 20 semi e aspettare che il sedimento semi sul fondo della punta. (ATTENZIONE: Il lavoro in condizioni sterili)
          Nota: Toccando l'agar o mesh delicatamente con la punta, una goccia d'acqua con un seme sarà rilasciato da esso (Figura 1C).
        2. <li> In caso di sterilizzazione a gas, seminare i semi con autoclave toothpicks.Pinch la stuzzicadenti nel agar prima di prendere i semi per garantire una superficie adesiva. Raccogliete la semi uno a uno con lo stuzzicadenti e distribuire i semi sulle piastre (Figura 1D). In alternativa, aggiungere acqua sterile per i semi, e di seminare come descritto in 1.2.1.5.1 (ATTENZIONE: Il lavoro in condizioni sterili).
      6. Sigillare le piastre con nastro adesivo traspirante e memorizzarli piastre a 4 ° C al buio per almeno 2 giorni e massimo una settimana. Questo è necessario per stratificazione e garantisce sincronizzati e germinazione più efficiente.
        Nota: In alternativa, i semi possono essere stratificati prima della semina, immerse in acqua distillata in tubi micro-centrifuga, che richiede meno spazio frigorifero. In questo caso, conservare le provette per almeno una settimana a 4 ° C, e spostare le piastre al mobile crescita subito dopo la semina (vedi 1.2.1.7).
        GIORNO 3 Spostare le piastre al mobile crescita (luce continua (110 μE m -2 s -1), 21 ° C) per 5 giorni (2 giorni di germinazione e 3 giorni di crescita) in posizione quasi verticale (80 a 90 °) per assicurare la crescita delle radici, e non nel mezzo.
        GIORNO 8
    2. Laterale Root induzione (NAA Treatment)
      1. Preparare lo stesso terreno di coltura come descritto in 1.2.1.1 e 1.2.1.2. Preparare una soluzione 50 mM magazzino di NAA in DMSO (ATTENZIONE: Indossare guanti). Raffreddare il terreno autoclavato fino a 65 ° C e aggiungere la soluzione NAA al mezzo per ottenere una concentrazione finale di 10 mM NAA (NOTA: Il lavoro in condizioni sterili).
        1. Omogeneizzare su oltre agitando delicatamente il flacone per 10 secondi. Versare 50 ml di terreno per ogni piatto quadrato di Petri (12 cm x 12 cm).
      2. Trasferire le piantine dalle piastre contenenti terreno di coltura supplementato con 10 micron NPA a quelli supsere realizzata con 10 micron NAA.
        1. Agganciare le braccia di pinzette ricurve sotto i cotiledoni della piantina e rimuoverla delicatamente dalla piastra. Trasferire solo piantine le cui radici sono cresciuti completamente in contatto con il mezzo NPA-crescita e preferibilmente verso il basso.
        2. Skim la radice nel medio di crescita della superficie-NAA che contiene oltre una piccola distanza. Assicurarsi che le radici delle piante sono in buon contatto con il mezzo di crescita. Se necessario, premere il radice delicatamente sulla superficie terreno di coltura con le pinzette.
          Nota: Nel caso di un grande esperimento, rimuovere tutti piantine che non sono in contatto con la rete e trasferimento sollevando la mesh ai due angoli superiori con pinzette. Assicurarsi che la maglia è in buon contatto con il mezzo-NAA contenente schiumando maglia sulla superficie agar su una piccola distanza (Figura 1E).
      3. Sigillare le nuove piastre con nastro adesivo traspirante e metterli nel quadro di crescita (conluce continuo (110 μE m -2 s -1), 21 ° C) in posizione verticale per il tempo desiderato dopo induzione fino al campionamento.
        Nota: Nel caso di un grande esperimento, utilizzare un bisturi per tagliare i segmenti radice tutti in una volta direttamente sulla maglia e campionare raschiando delicatamente la superficie della mesh.

2. Lris mais protocollo

  1. Stratificazione di mais kernel
    1. Incubare i chicchi di mais a 4 ° C al buio per almeno 1 settimana.
      Nota: Questo protocollo è stato sviluppato utilizzando la linea inbred di mais B73.
  2. Sterilizzazione di mais kernel
    GIORNO 1
    Nota: Anche se piante di mais non devono essere coltivate in condizioni di sterilità, si consiglia di sterilizzare i chicchi di mais e di lavorare con materiale sterile per prevenire la crescita di funghi nel rotolo di cartasistema.
    1. Mettere il numero necessario di chicchi di mais in un bicchiere di vetro sterilizzati.
    2. Aggiungere 100 ml di soluzione di sterilizzazione (6% NaOCl in acqua) (ATTENZIONE: l'utilizzo cappa).
    3. Aggiungi un ancoretta magnetica e posizionare il bicchiere su un agitatore magnetico a bassa velocità di agitazione (circa 250 giri al minuto) a temperatura ambiente per 5 minuti.
    4. Risciacquare cinque volte per 5 min, sostituendo la soluzione con 100 ml di acqua fresca sterile.
  3. La semina mais kernel
    1. Indossare guanti per ridurre il rischio di contaminazione, e prendere un rotolo di carta assorbente.
    2. Strappare due tratti di mano un tovagliolo di carta con una lunghezza totale di due fogli (circa 92 centimetri x 24 cm) e metterli uno sopra l'altro su una superficie pulita (Figura 2A).
    3. Piegare i fogli raddoppiare la lunghezza (circa 92 cm x 12 cm) (Figura 2A).
    4. Utilizzare le pinzette per distribuire 10 kernel a circa 2 cm dalla parte superiore su tegli intera lunghezza della carta, mantenendo un'intercapedine di 8 cm tra ogni kernel e 8 cm connessione alle due estremità (Figura 2B). Assicurarsi che la radichetta del kernel sia rivolta verso il basso e verso la carta (Figura 2B).
    5. Rotolare delicatamente la carta su tutta la lunghezza, pur mantenendo i semi in sede (Figura 2B). Per facilitare il rotolamento, è facoltativo spruzzare prima la carta con acqua sterile.
    6. Mettere i rotoli di carta in tubi di vetro sterilizzati di circa 6 cm di diametro e 14 cm di altezza (per esempio, 250 ml provette centrifuga) e metterli in un rack (Figura 2C).
  4. Laterale induzione Root in mais
    1. Preparare una soluzione al 50 NPA mM magazzino (disciolto in DMSO) (ATTENZIONE: Indossare guanti).
    2. Per ogni tubo, fare una soluzione al 50 micron NPA aggiungendo 125 microlitri della soluzione madre 50 NPA mM a 125 ml di acqua sterile, in un bicchiere di vetro sterilizzati.
    3. Mescolare bene eversare 125 ml di soluzione 50 mM NPA sopra il rotolo di carta nel tubo. Il rotolo di carta in grado di assorbire la soluzione e diventare completamente assorbito.
      Nota: Quando si utilizzano rotoli di carta e tubi con altre dimensioni, regolare il volume di conseguenza. Il liquido dovrebbe raggiungere a metà strada del tubo per assicurare l'assorbimento sufficiente.
    4. Collocare il sistema rotolo di carta in un armadio di crescita per tre giorni (27 ° C, luce continua, il 70% di umidità relativa). Assicurarsi che i rotoli di carta rimangono impregnati con l'aggiunta extra di 50 micron soluzione NPA, dal momento che la soluzione evapora nel tempo (Figura 2D).
      GIORNO 4
    5. Preparare una soluzione al 50 NAA mM magazzino (disciolto in DMSO) (ATTENZIONE: Indossare guanti).
    6. Per ogni tubo, preparare una soluzione NAA 50 micron con l'aggiunta di 125 microlitri dal magazzino 50 NAA mM a 125 ml di acqua sterile in un bicchiere di vetro sterilizzati.
    7. Premere delicatamente la maggior parte della rimanente soluzione di NPA dai rotoli di carta e posizionare ilm di acqua sterile per 5 minuti per lavare fuori (ATTENZIONE: Indossare guanti). Spremere delicatamente la maggior parte dell'acqua dai rotoli di carta. Ripetere questa operazione di lavaggio per tre volte.
    8. Mescolare bene e versare la soluzione NAA 50 micron sui rotoli di carta nei tubi. Assicurarsi che siano completamente immersi.
    9. Posizionare il sistema rotolo di carta nel gabinetto crescita (27 ° C, luce continua, 70% di umidità relativa) per la durata desiderata dopo induzione.
  5. Laterale induzione Root in accidentale Corona Roots of Maize
    Nota: Il Lris come descritto sopra induce radici laterali nella radice primaria. Tuttavia, nel mais e altre monocotiledoni, la radice primaria e le radici seminali embrionali, insieme con le loro radici laterali, sono principalmente importante durante lo sviluppo piantina. In una fase successiva della crescita delle piante, le radici avventizie postembrionali sorgono sullo stelo e anche sviluppare radici laterali per formare un nuovo sistema di radice 16. Il Lris può anche essere utilizzatod per indurre radici laterali su queste post-embrionali radici avventizie corona seguendo alcuni piccoli aggiustamenti alla Lris sulla radice primaria embrionale.
    1. Per rendere i rotoli di carta, creare un sandwich di carte con rispettivamente due strati di mano tovagliolo di carta sul lato esterno, e due strati di carta all'interno di germinazione. Posizionare i kernel sterilizzati (vedere i passi 2,1-2,2) tra i due fogli di carta germinazione. Carta germinazione, rispetto alla carta asciugamani, sarà meno incline ad essere penetrato da peli radicali e radici laterali, che renderà l'apertura del rotoli di carta più facile in seguito. D'altra parte, i due strati esterni di asciugamano di carta saranno facilitare l'assorbimento del liquido.
    2. Inserire i rulli in 700 ml di tubi di vetro e versare acqua sterile senza NPA su di loro. Assicurarsi che siano completamente immersi.
    3. Germinare i chicchi sterilizzati nell'armadio di crescita (vedi punto 2.4.9).
    4. Crescere le piante fino alle radici avventizie coronainiziare ad emergere (6 giorni per B73). Assicurarsi che i rotoli di carta sono tenute umido in ogni momento con l'aggiunta di acqua sterile quando necessario.
    5. Trasferimento a una soluzione 25 mM NPA per 4 giorni (vedi i punti 2.4.1 a 2.4.4), seguita da una simile induzione di apertura laterale radice sostituendo la soluzione con una soluzione NPA NAA 50 pM dopo una fase di lavaggio (vedi passo 2.4 0,5 a 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Applicazione del Lris per eseguire Trascrittomica comparativi del processo laterale Root Iniziazione

Un'applicazione della Lris è il confronto e correlazione dei profili di espressione genica durante la formazione delle radici laterali in specie diverse. Trascrittomica comparata approcci creare la possibilità di individuare i geni ortologhi coinvolti nel processo di sviluppo delle radici laterali in diverse specie. Apertura laterale delle radici, che consiste nella formazione di un nuovo organo da un sottogruppo di cellule contenute in un asse principale già formata, è il meccanismo principale condivisa da angiosperme per controllare la loro architettura radice. Di conseguenza, è molto probabile che si sia evoluto da percorsi esistenti presenti in un antenato comune ed è stata conservata durante l'evoluzione. Infatti, i potenziali regolatori comuni di laterale iniziazione radice sono stati trovati in diverse specie <sup> 17, 18.

Materiale di campionamento utilizzando il Lris in Arabidopsis e mais, e analisi del trascrittoma

La Lris è stata stabilita in due specie diverse:. Arabidopsis e mais 10, 13 In entrambe le specie, si è deciso di campionare piante appena prima del trattamento NAA, e poco dopo induzione, al momento della comparsa di, o durante la risposta auxina, come così come al momento della comparsa di, o durante le prime divisioni nel pericycle. Inoltre, Fluorescenza attivato cellulare Ordinamento 19 (FACS) è stato utilizzato in Arabidopsis o Laser Capture Microscopia 20, 21 (LCM) nel mais per selezionare per le cellule pericycle. In Arabidopsis, i punti di tempo di 2 e 6 ore dopo l'induzione sono stati scelti in base alla caratterizzazione trascrizionale del pDR5 :: GUS risposta auxina e pCYCB1; 1 :: ciclo cellulare linee marcatore GUS 9 (figura 3). Nel mais, il tempo punti 2, 3 e 4 ore dopo l'induzione, sono stati selezionati dopo caratterizzazione microscopica di attività divisione cellulare e l'analisi di espressione diversi geni marcatori ciclo cellulare utilizzando in tempo reale inversa reazione a catena della polimerasi della trascrizione (qRT-PCR) 13 . RNA è stato estratto dalle cellule isolate e ibridato su piattaforme microarray come precedentemente descritto 10, 13.

Trovare il ortologo di Arabidopsis CYCB1, 1 (AtCYCB1; 1) a mais

In Arabidopsis, la linea di marcatore pCYCB1; 1 :: GUS è stato ampiamente utilizzato per tracciare le prime divisioni del pericycle durante laterali iniziazione radice. Tale indicatore sarebbe moltoutile nel mais. Diversi omologhi di AtCYCB1; 1 sono stati trovati in mais (www.maizesequence.org, tutti i peptidi, BLASTP, impostazioni di default). Sei di loro erano presenti sul microarray eseguita dopo Lris nel mais e ha mostrato un arricchimento significativo. Il miglior colpo BLAST, GRMZM2G310115, hanno mostrato livelli molto elevati di trascrizione dopo Lris, simile a quanto osservato in Arabidopsis per AtCYCB1; 1 (Figura 4).

Applicazione del Lris Verifiche individuali di espressione genica

Per convalidare GRMZM2G310115 come un buon candidato ortologo di AtCYCB1; 1 nel mais laterali iniziazione radice, un real-time qRT-PCR su campioni prelevati in diversi momenti è stato eseguito nel corso di un Lris 13. Le piante sono state trattate come descritto nel suddetto protocollo e raccolte a tempi diversi: prima NTrattamento AA (NPA), e dopo 2, 3 e 4 ore di trattamento NAA. Inoltre, il materiale di piante coltivate solo in acqua è stata raccolta per confrontare l'espressione genica tra Lris e condizioni di neutralità. Subito dopo la raccolta, i segmenti di radice corrispondente ad una regione compresa tra 5 mm e 15 mm sopra la punta della radice sono stati sezionati con il binocolo. Con una pinzetta, la corteccia è stata separata dalla stele (che contiene il pericycle), e l'RNA è stato estratto da entrambi i tessuti. Quest'ultimo passaggio è stata effettuata anziché LCM, perché è molto più veloce ed economico per la convalida. Utilizzando il seguente rispettivo avanti e reverse primer qRT-PCR, AGCAGGACGCAGTTGGAGAG e GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 stati convalidati per essere up-regolata su Lris, e per essere precisi per i tessuti stele (Figura 5). Inoltre, questo esperimento dimostra che senza l'induzione sincrono, gli eventi discreti di laterale iniziazione radice che accadono in una radice che cresce in acqua non sono rilevabili, e illustrare la necessità della Lris per rivelare l'espressione genica differenziale relativo al processo di iniziazione laterali radice.

Figura 1
Figura 1. laterale Root inducibile sistema per Arabidopsis (A) Preparazione della rete di nylon (20 micron):. Tagliare la rete di nylon (9 cm x 9 cm), avvolgerla in un foglio di alluminio e metterlo in un bicchiere di vetro per la sterilizzazione in autoclave. (B) Applicare la rete di nylon su una piastra NPA contenente (10 micron) con una pinzetta. Quindi utilizzare un Drigalski sterile in modo da eliminare le bolle d'aria. (C) Sementi sul nylon mesh con una pipetta. (D) Sementi sulla rete di nylon con uno stuzzicadenti. (E) Trasferire la rete di nylon ad una piastra-NAA contenenti (10 micron) con una pinzetta.81 / 53481fig1large.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

Figura 2
Figura 2. Laterale Root inducibile sistema per mais.   (A) Preparazione dei rotoli di carta: luogo due strati di carta (92 cm x 24 cm, lunghezza di due fogli) uno sopra l'altro e piegare le raddoppiare la lunghezza (92 cm x 12 cm). (B) 10 Put chicchi di mais sterilizzati con radichetta rivolto verso il basso sulla carta a 2 cm dalla parte superiore con un interasse di 8 cm. Poi arrotolare la carta mantenendo le chicchi di mais a posto. (C) Posizionare i rotoli di carta in tubi (per esempio, da 250 ml provette per centrifugazione) e metterli in un rack. (D) Far crescere le piantine di mais, per tre giorni in una soluzione NPA 50 micron (a 27 ° C, luce continua, relativa Humidità 70%). (E) sinistra: piantina appena prima del trasferimento a NAA; Medio: sezioni trasversali microtomo appena prima del trasferimento a NAA e 2 giorni dopo il trasferimento a NAA; A destra:. Piantina con radici laterali visibili emerse 5 giorni dopo il trasferimento a NAA Cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. Laterale Root iniziazione è stimolata Su prolungato corso NAA trattamento. (AF) di tempo che indica la risposta dell'auxina nel corso di un trattamento NAA utilizzando la linea marcatore pDR5 :: GUS. La risposta auxina, che è uno dei primi eventi scatenanti laterale iniziazione radice, inizia 2 ore dopo l'inizio del trattamento NAA. Nel pannello superiore, viene presentata una panoramica di tutta la piantina; lo spettacolo pannello inferiores la risposta auxina nella punta della radice. Corso (GM) Tempo di un trattamento NAA utilizzando il pCYCB1; 1 :: GUS linea di marcatore. Il segnale GUS rappresenta l'espressione del CYCB1; 1 gene, indicando che le prime divisioni cellulari che portano alla formazione delle radici laterali iniziano 6 h dopo l'inizio del trattamento NAA. Nel pannello superiore, viene presentata una panoramica di tutta la piantina; il pannello inferiore mostra CYCB1;. 1 espressione nella punta della radice (GUS colorazione secondo Beeckman e Engler, 1994 22) Clicca qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. L'espressione del profilo di geni CYCB1 in Arabidopsis e mais durante Lris.   (A) valori di espressione di Microarray AtCYCB1; 1 durante Lris come descritto da De Smet et al. 2008 valori di espressione 10 (B) microarray di potenziali orthologs di AtCYCB1; 1 durante Lris come descritto da Jansen et al. 2013 Punteggio 13 BLASTP è il punteggio ottenuto durante la sabbiatura la sequenza proteica di AtCYCB1, 1 sul genoma del mais. Le barre di errore esprimono la deviazione standard e ** sta per un p -value ≤0.01. Cliccate qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5. L'espressione di GRMZM2G310115 nella Stele e la corteccia di radici di mais durante Lris. L'espressione di <em> GRMZM2G310115 durante Lris nel mais è stata valutata quantitativa real-time qRT-PCR su campioni stele e corteccia sezionati. Un campione supplementare è stata effettuata su piante coltivate in acqua. I valori sono stati normalizzati per espressione nella stele in acqua. Le barre di errore esprimono la deviazione standard e ** sta per un p -value ≤0.01 (primer e geni di riferimento secondo Jansen et al. 2013 13). Cliccate qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nel protocollo Arabidopsis Lris, è importante trasferire solo le piantine che sono cresciuti completamente in contatto con il terreno di coltura contenente NPA. Questo assicura che laterale iniziazione radice è bloccato su tutta la lunghezza della radice. Al fine di prevenire il ferimento di piantine durante il trasferimento, le braccia delle pinze curve possono essere agganciati sotto i cotiledoni della piantina. Al trasferimento, assicurarsi che le radici di piantine sono in contatto sufficiente con il terreno agar-NAA contenente. Ciò può essere ottenuto mediante scrematura radice sulla superficie agar su una piccola distanza. Questo assicurerà un efficiente induzione sincronizzata dell'iniziazione radici laterali su tutta la lunghezza della radice. Le radici possono essere coltivate esposte alla luce senza influire negativamente sulla loro crescita e induzione delle radici laterali.

Nel protocollo di mais Lris, è importante che la radichetta del kernel rivolto verso il basso e verso la carta per garantire la radice crescerà downwards e allegare la carta al lato corretto 16. Dopo tre giorni di trattamento NPA, le piante dovrebbero sono emerse dal kernel con un piccolo germoglio, una radice primaria e radici seminali 16. La radice principale deve essere di circa 2 cm di lunghezza prima di procedere alla induzione di iniziazione laterali radice. Questo protocollo è stato sviluppato utilizzando la linea inbred di mais B73, ma in caso di una linea di mais con una crescita diversa, regolare il tempo di incubazione di conseguenza. Assicurarsi che i rotoli di carta rimangono impregnati aggiungendo regolarmente 50 mM soluzione NPA quando il liquido evapora nel tempo, altrimenti il ​​trattamento NPA potrebbe essere lo sviluppo delle radici laterali presto inefficiente e indesiderato potrebbe verificarsi. Il sistema stesso impedisce l'esposizione delle radici alla luce, ma la luce non è un grosso problema e non riguarda la crescita delle radici e l'induzione delle radici laterali.

Modi per l'induzione controllata di radici laterali alternativi sono l'uso di mechanical piegatura 23 o gravistimulation 24. Il vantaggio principale di questi sistemi è che essi hanno una maggiore induzione 'naturale' rispetto ai trattamenti di ormone nel Lris, ma lo svantaggio è che essi sono limitati nella quantità di materiale che può essere raccolta in un determinato tempo perché solo produrre un evento radice iniziazione laterali in curva per ogni piantina rispetto ad una induzione completo del pericycle nel Lris.

Il Lris utilizzato in Arabidopsis e mais può essere utilizzato in una varietà di piante, se le condizioni favorevoli devono essere ottimizzate. Per installare un Lris, due importanti fasi successive devono essere raggiunti: (1) il blocco del trasporto dell'auxina e (2) l'accumulo di auxina di indurre laterale iniziazione radice. Il sistema dovrebbe consentire crescente per l'assorbimento efficace ed uniforme dei composti e deve permettere un buon sviluppo delle piante. Sistemi alternativi per terreno solido (Arabidopsis) e rotoli di carta (mais), come coltura liquida, idroponica o aeroponica, potrebbe essere utilizzato per altre specie. La prima fase del Lris, cioè, il blocco del trasporto auxina, può essere ottenuto con l'aggiunta di un inibitore del trasporto auxina. Anche se NPA porta ad un blocco efficace di laterale iniziazione radici in Arabidopsis e mais, composti alternativi come l'acido 2,3,5-triiodobenzoico (TIBA) o acido chlorophenoxyisobutyric p- (PCIB) potrebbero funzionare meglio in altre specie. Una ottimizzazione simile può essere fatto per il secondo passo della Lris, cioè, il trattamento auxina. L'auxina sintetico NAA sembra essere il più adatto per una Lris. Il precursore auxina indol-3-butirrico (IBA) potrebbe essere una buona alternativa come anche induce fortemente radici laterali ed ha un'alta bioattività in impianti differenti 25, 26. D'altra parte, l'acido indol-3-acetico auxina naturali (IAA) è meno stabile e più facilmente metabolizzato 27, razionalizzando il suo effetto più debole sulla radice develluppo in per esempio il mais o di riso 25, 26. L'auxina sintetica acido 2,4-diclorofenossiacetico (2,4d) si accumula nelle cellule altamente pericycle, in parte perché non viene esportato dalle cellule 28, compromettendo il corretto avvio delle radici laterali e inducendo artificiale strutture fuse. Anche altri composti che interagiscono con percorsi auxina, come naxillin 12, hanno dimostrato di indurre laterale iniziazione radici in Arabidopsis e possono essere testati in altre specie.

In alcuni casi, la germinazione è inefficiente in presenza di NPA e si potrebbe scegliere di germinare prima i semi in assenza di NPA, trasferire successivamente le piantine al sistema NPA-contenenti. Questo induce un possibile rischio di primi primordi radice laterali avviati prima dell'induzione radice laterale con trattamento NAA e, quindi, è importante solo campionare la regione della radice allungata che durante il trattamento NPA. A seguito di questa strategia generale, uno shoULD essere in grado di ottimizzare un Lris per praticamente qualsiasi (seme) impianti e come tali hanno un sistema facile da studiare lo sviluppo delle radici laterali per l'impianto di interessi. Ulteriore caratterizzazione dei tempi di apertura delle radici laterali può avvenire tramite linee marcatore, come esemplificato per Arabidopsis. Se linee marcatore sono difficili da ottenere, uno studio istologico dettagliata potrebbe essere fatto, ma questo richiede tempo e le prime divisioni cellulari non sono facilmente riconoscibili. In alternativa, l'analisi di espressione dei marcatori di divisione cellulare può essere utilizzato per indicare i tempi delle prime divisioni cellulari.

Il Lris può essere utilizzato per diversi scopi, come l'analisi del trascrittoma 9-13 come descritto brevemente nei risultati, così come le osservazioni istologiche a livello macroscopico e microscopico durante laterali radice iniziazione 14. Diversi tipi di campionamento, che vanno da organo a scala cella 29, potrebbero permettere svelare diversi aspetti del più tardiAl iniziazione radice. Inoltre, il Lris può essere utilizzato per monitorare l'effetto dei diversi composti sulla radice apertura laterale 12, 30. Infine, utilizzando linee giornalista, un Lris può anche essere utilizzato per caratterizzare facilmente l'espressione genica e / o localizzazione delle proteine ​​durante laterale lo sviluppo delle radici.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Laterale Root inducibile di sistema in<em&gt; Arabidopsis</em&gt; E mais
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter