Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Lateral Kök İndüklenebilir Sistemi doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Topraktan gelen ankraj ve su alımını ve besin sağlar çünkü kök sistemi, bitki büyümesi için çok önemlidir. Bir kök sistemi gelişimi genel olarak yan kök üretimi dayandığından, bunların başlangıç ​​ve oluşum yaygın olarak incelenmiştir. Yanal kökleri kurucu hücreler 1 olarak adlandırılan, perisiklden hücrelerinin belirli bir alt başlatılır. Örneğin mısır gibi monokotlarda bölgesi, bunlar floem kutup 3 bulunan, oysa Arabidopsis thaliana gibi en dikotillere, bu hücreler, protoxylem kutup 2 yer almaktadır. Kurucu hücreleri özel hücre döngüsü genlerinin sentezlenmesi, ardından artan oksin yanıt 4 ile işaretlenmiştir (örneğin, siklin B1, 1 / CYCB1; 1), bundan sonra, asimetrik anticlinal bölümleri 5 bir birinci tur geçirilir. Koordineli antiklinal ve periclinal bölünmeler bir dizi sonra, lateral kök taslaklarının nihayet a olarak ortaya çıkacak oluşturulmuşturutonomous yanal kök. Bu olaylar bol ne de senkronize ne olduğundan konumu ve yan kök başlama zamanlaması, ancak öngörülebilir değildir. Bu, bu işlem çalışma transkriptomik gibi moleküler yaklaşımların kullanımı engeller.

Bu konuya ilişkin olarak, bir yanal kök İndüklenebilir Sistemi (lris), 6 geliştirilmiştir 7. Bu sistemde, fideler, ilk sonuç olarak yan kök başlangıcı bloke, oksin taşınmasını ve birikmesini engelleyen N -1-naphthylphthalamic asit (NPA) ile muamele edilir 8. Sonradan sentetik oksin 1-naftalin asetik asit (NAA) içeren ortama fide aktararak tüm perisiklden tabakası böylece kitlesel yüksek oksin seviyelerinin indükleyici yanal kök hücre başlatarak bölünmeler 6 yanıt verir. Bu nedenle, bu sistem, geç belirli bir aşaması için zenginleştirilmiş kök örnekleri kolayca toplanmasını sağlayan, hızlı, senkron ve geniş yan kökler inisiyasyonlara açarral kök gelişimi. Daha sonra, bu numune yan kök oluşumu sırasında genom çapında ekspresyon profillerini belirlemek için kullanılabilir. Iris diğer bitki türleri bu sistemi uygulamak için yan kök Arabidopsis başlatılması ve mısır 9-13, ancak ihtiyaç hakkında zaten önemli bilgiyi vermiştir fazla genomları sıralı olarak daha belirgin hale gelir ve ekonomik önemli bilgiyi aktarmak için artan bir ilgi var türler.

Burada, Arabidopsis ve darı LRISs ayrıntılı protokolleri verilmiştir. Daha sonra, sistemin kullanımına ilişkin bir örnek, mısır Iris elde transkriptomik veriler, farklı bitki türleri boyunca yanal kök başlatma sırasında korunmuş bir fonksiyonu sahip fonksiyonel homologları tespit etmek için kullanılabilir olduğunu göstererek temin edilmektedir. Diğer bitki türlerinin önerildiği için Son olarak, kılavuzlar Iris optimize etmek.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis lris Protokolü

Not: Metin "küçük" veya "büyük" ölçekli deneyler anlamına gelir. Bu tür işaret hattı analizi ve histolojik boyama 6, 14 gibi küçük ölçekli deneyler, sadece bir kaç numune gereklidir. Bu tür kantitatif gerçek zamanlı Mah-PCR, mikro-diziler 9-11 veya RNA sıralama gibi büyük ölçekli deneyler, örneklerin büyük bir miktarda gerektirir. Bu nedenle, her örnek için 1000 fide Vanneste ve arkadaşları tarafından kullanılan ~ arasında. 11 bir miktar kök kademeli bir diseksiyon sonra mikrodizi deneyi gerçekleştirmek için.

1.GÜN

  1. Arabidopsis tohumları Sterilizasyon
    Not: Tohum sterilizasyonu için aşağıdaki yöntemlerden birini seçin. Bunlardan herhangi protokol aşağıdaki adımları için uygundur. Gaz sterilizasyonu (1.1.2) sıvı sterilizasyon (1.1.1) üzerinden iki ana avantajı sunuyor: Büyük bir uyuşmuş tutarken daha az zaman alırTohumların er, pipetleme bireysel numuneleri oluşabilir gerektiği için; ve sterilize edilmiş tohumlar, daha uzun bir süre boyunca saklanabilir. Bununla birlikte, bu bir desikatörde ve dikkatli bir şekilde kullanılması gerekmektedir.
    1. Sıvı sterilizasyon
      1. Mikro-santrifüj tüplerine tohumların istenilen sayıda dökün. 2 ml'lik bir mikro santrifüj tüplerine 1.5 ml bir tüp içinde 20 mg (~ 800 tohumlar) ya da 40 mg (~ 1.600 tohumlar) kadar kullanın.
      2. % 70 etanol içinde 1 ml ilave edilir. Çevirin ya da hafifçe 2 dakika süreyle çalkalayın.
      3. 15 dakika boyunca 1 ml sterilizasyon solüsyonu ile% 70 etanol değiştirin. (Taze sterilizasyon çözüm hazırlayın: 3.85 ml sodyum hipoklorit (NaOCl) stok (% 12) (DİKKAT: Kullanım) kaput duman 5 ul Tween 20, su ile 10 ml'ye kadar tüm tohumların gelip emin olmak için boruları birkaç kez ters çevirin. çözeltisi ile temas halinde değildir.
      4. Tekrarlanan bir laminar hava akış kabini olarak, 5 dakika boyunca tohumlar 5 kez 1 ml steril damıtılmış su ile sterilizasyon solüsyonu yerine ve durulamaly taze, steril damıtılmış su içinde 1 ml değiştirilmesi.
    2. Gaz Sterilizasyon
      1. 2 ml mikro santrifüj tüpü içinde tohum istenilen sayıda dökün. Birkaç bağımsız çizgiler ile çalışan tek tek tüpler kullanımı ve bunların plastik bir mikro santrifüj tüplerine ya da kutu yuvasına açılan sağlayabilir. Bir tüp tohum sayısı 500 (12.5 mg) üzerinde ise, başarılı bir sterilizasyon sağlamak için boruların uygun sayıda tohum ayırabiliriz. Komşu tüplerin kapakları birbirine örtmeyen emin olun. O sterilizasyon için de desikatöre olması gerekir gibi alt kutunun kapağını birbirine uygun.
      2. Bir cam beher ile birlikte bir desikatörde bir kase kutusu yerleştirmek (DİKKAT: kaput duman).
      3. (: Kullan davlumbaz DİKKAT)% 12 NaOCİ 100 ml beher doldurun. Desikatöre kapağı koymak, ama beher yerleştirilen küçük bir diyafram bırakın.
      4. (CAU% 37 hidroklorik asit (dumanlı) 3 ml ilave edilirTION: kullan küçük delikten beher kaputu) duman ve hızlı bir şekilde desiccator kapatın. Cl 2-gaz oluşumu nedeniyle bir süredir çözüm olacak kabarcık. Sistemi bırakın O / N (veya en azından 8 saat) kapattı.
      5. Desikatöre kapağını kaldırın. Kutusunu çıkarın ve taşıma sırasında kontaminasyonu önlemek için kapak ile örtün.
      6. Bir laminar hava akışı kabini içinde kutu koyun kapağını çıkarın ve gaz çıkışına izin vermek için oda sıcaklığında yaklaşık 1 saat için tohum bırakın.
        Not: Tohum güvenli bir şekilde 4 ° C 'de 2 hafta boyunca, kapalı mikro santrifüj tüplerine kuru saklanabilir.
  2. Arabidopsis'te yanal kök indüksiyonu
    1. Yanal Kök İnhibisyon (NPA Tedavisi)
      1. In vitro büyüme için büyüme ortamı hazırlar. Ortamı, yarı kuvvetli Murashige ve Skoog tuzu karışımını 15, 0,1 g / L miyo-inositol, 10 g / L sakkaroz içeren, ve 0.5 ile tamponlanmıştırg / L 2- (N-morfolino) etansülfonik asit (MES).
      2. 1 M KOH ile 5.7 pH ayarlayın. Bitki doku agar 8 g / L ilave edin ve 121 ° C 'de 20 dakika boyunca ortam otoklav.
      3. Dimetilsülfoksit (DMSO) (: eldiven kullanın DİKKAT) NPA 25 mM stok çözeltisi hazırlayın. Levhalı bir hava akış kabininde, (şişe elle tutulabilen sıcaklıktır) yaklaşık 65 ° C'ye kadar otoklava ortamın soğutulması ve 10 uM NPA nihai bir konsantrasyon elde etmek için, 25 mM stok çözeltisi NPA ekleyin.
      4. Yavaşça 10 saniye boyunca şişeyi çalkalayarak eklendikten sonra homojenize. Kare petri tabağı başına ortam 50 ml (12 cm x 12 cm) dökün.
        Not: Büyük ölçekli deney durumunda, kolay aktarım sağlamak için, bir naylon örgü (20 um) uygulanır. Otoklavlama (Şekil 1A) bir örgü (9 cm x 9 cm) hazırlayın. Otoklavda sterilize edildiği zaman steril cımbız (Şekil 1B) kullanarak büyüme ortamına örgü uygulanır. Yavaşça ste kullanarak büyüme ortamına itmek örgü(: Steril şartlarda çalışmak DİKKAT) büyüme ortamına (Şekil 1B) ile iyi temas olduğundan emin olmak için drigalsky rilized.
      5. NPA-plakalar üzerinde tohum ekmek.
        , Durumunda büyük ölçekli deneme planlanmaktadır (1.2.2.3 bakınız) örnekleme kolaylaştırmak için 50 tohum 2 yoğun ve iyi hizalanmış satırları saçmak: Not.
        1. Sıvı sterilizasyon durumda, 200 ul pipet kullanılarak NPA-plakalar üzerinde tohumları ekmek. 3 kes - sırayla steril koşullar (ya da ipuçları sterilize edilmeden önce) içinde pipet uçları sonu 4 mm tohumları pipetlemeyin edebilmek için. Pipet yukarı ve tohum yeniden askıya birkaç kez aşağı, sonra 10 ile yaklaşık 150 ul steril su pipetlemeyin - 20 tohumlar ve bahşiş altındaki tohumlar sediment kadar bekleyin. (DİKKAT: Steril şartlarda Çalışma)
          Not: ucu ile hafifçe agar veya örgü dokunulduğunda bir tohumuyla bir damla su (şekil 1C) için serbest bırakılır.
        2. <Gaz sterilizasyon durumunda li> yapışkan bir yüzey sağlamak için tohumlarını almadan önce otoklava toothpicks.Pinch agar içine kürdan kullanarak tohumlarını ekmeye. Kürdan kullanarak tek tohum bir pick up ve plakaları (Şekil 1D) tohumları dağıtıyoruz. (: Steril şartlarda çalışmak DİKKAT) Alternatif olarak, tohumlara steril su ekleyin ve 1.2.1.5.1 tarif edildiği gibi ekmek.
      6. Hava yapışkan bir bantla kapatın ve plakalar, en az 2 gün, en fazla bir hafta boyunca karanlıkta 4 ° C de onları plakaları saklayın. Bu tabakalaşma ve senkronize sağlar ve daha verimli çimlenmesi için gereklidir.
        Not: Alternatif olarak, tohumlar, ekim öncesi tabakalı az soğutma alanı gerektirir mikro santrifüj tüplerine, damıtık suya daldırılır edilebilir. Bu durumda, 4 ° C'de en az bir hafta süreyle tüplerini muhafaza ve hemen (1.2.1.7 bakınız), ekimden sonra büyüme odasında plakaları hareket ettirin.
        3. GÜN Büyüme odasında plakaları hareket (sürekli ışık (110 μE m -2 s-1), 21 ° C) yaklaşık dikey bir pozisyonda 5 gün boyunca (çimlenme 2 gün ve büyüme 3 gün) (80-90 °) orta kök üzerinde büyümeyi değil, emin olmak için.
        8. GÜN
    2. Yanal Kök İndüksiyon (NAA Tedavisi)
      1. 1.2.1.1 ve 1.2.1.2 tarif edildiği gibi aynı büyüme ortamı hazırlayın. (: Eldiven kullanın DİKKAT) DMSO içinde NAA 50 mM stok çözeltisi hazırlayın. Aşağı 65 ° C'ye kadar soğutun ve otoklavlanmış orta 10 uM NAA bir son konsantrasyon elde etmek için ortama NAA solüsyonu (DİKKAT: steril koşullar altında çalışmak).
        1. Yavaşça 10 saniye boyunca şişeyi çalkalayarak eklendikten sonra homojenize. Kare petri tabağı başına ortam 50 ml (12 cm x 12 cm) dökün.
      2. Bu sup 10 uM NPA ile desteklenmiş büyüme ortamını ihtiva eden plakalar fide aktarma10 uM NAA ile eklentilerle.
        1. Fide kotiledonlarında altında kavisli cımbız silah kanca ve yavaşça plaka çıkarın. Sadece kökleri tamamen tercihen aşağı NPA-büyüme ortamı ile temas büyüdü hangi fidan aktarmak.
        2. Küçük bir mesafe boyunca NAA içeren büyüme ortamı içinde kök yağsız bir yüzey. Bitki kökleri büyüme ortamı ile iyi temas olduğundan emin olun. Gerekirse, cımbız ile büyüme ortamı yüzeyine hafifçe kök basın.
          Not: Büyük ölçekli deney durumunda, cımbız ile iki üst köşelerde örgü kaldırarak örgü ve transferi ile temas halinde olmayan tüm fideler çıkarın. Emin örgü küçük bir mesafe (Şekil 1E) üzerinde agar yüzeyi üzerinde örgü kaymağını tarafından NAA içeren ortamı ile iyi temas halinde olun.
      3. Nefes bandı ile yeni plakaları Seal ve (büyüme dolabında con koyun, devamlı ışık örnekleme kadar indüksiyonundan sonra istenen bir süre için dik bir konumda (110 μE m -2 s-1), 21 ° C).
        Not: büyük ölçekli deney durumunda, ağ üzerine bir defada, doğrudan kök parçalarını kesmek ve yavaşça mesh yüzeyini kazıyarak örnek onları için bir neşter kullanmak.

2. lris Mısır Protokolü

  1. Mısır çekirdeklerde Tabakalaşma
    1. En az 1 hafta süreyle karanlıkta 4 ° C'de mısır tanelerini inkübe edin.
      Not: Bu protokol B73 mısır kendilenmiş hattı kullanarak geliştirilmiştir.
  2. Mısır çekirdeklerde Sterilizasyon
    1.GÜN
    Not: mısır fideleri edilen steril şartlarda yetiştirildiği olmak zorunda değildir, ancak bu, kağıt rulo mantar büyümesini önlemek için mısır tanelerini sterilize ve steril bir malzeme ile çalışılması tavsiye edilmektedirsistemi.
    1. Steril bir cam beher içinde, mısır tanelerinin gerekli sayıda koyun.
    2. (Su içinde% 6 NaOCl) sterilizasyon solüsyonu (: kullan davlumbaz DİKKAT) 100 ml ekleyin.
    3. Manyetik bir karıştırma çubuğu ilave edin ve 5 dakika boyunca oda sıcaklığında, düşük karıştırma hızında (yaklaşık 250 rpm), bir manyetik karıştırıcı Beher yerleştirin.
    4. Taze steril su, 100 ml çözelti yerine 5 dakika boyunca beş kez çalkalayın.
  3. Mısır çekirdeklerde ekim
    1. Kontaminasyon riskini azaltmak ve kağıt havlu rulosu almak için eldiven giyin.
    2. Iki yaprak (yaklaşık 92 cm x 24 cm) toplam uzunluğu ile el havlusu kağıt iki uzanıyor yırtın ve temiz bir yüzeye (Şekil 2A) üzerinde birbirinin üstüne koyun.
    3. Yaprak uzunluğu (yaklaşık 92 cm x 12 cm) (Şekil 2A) üzerine çift katlayın.
    4. T üzerinde üstten yaklaşık 2 cm 10 çekirdekleri dağıtmak için cımbız kullanınO kağıt tüm uzunluğu, her iki ucunda (Şekil 2B) serbest, her çekirdek ve 8 cm arasında, 8 cm bir ara tutulmuştur. Çekirdeğin radicle aşağı ve kağıt (Şekil 2B) doğru baktığından emin olun.
    5. Tohum yerine (Şekil 2B) tutarken yavaşça, uzunluğu boyunca kağıt rulo. Haddeleme kolaylaştırmak için, ilk önce, steril su ile kağıt sprey isteğe bağlıdır.
    6. Yaklaşık 6 cm çapında ve 14 cm yüksekliğinde (örneğin, 250 ml santrifüj tüpleri) ve steril cam tüplerde kağıt ruloları koyun ve bir rafa (Şekil 2C) koyun.
  4. Mısırda Yanal Kök İndüksiyon
    1. (DMSO içinde çözülmüş) bir 50 mM stok çözelti NPA (: kullanımlar eldivenler DİKKAT) hazırlayın.
    2. Her bir tüp, bir steril cam beher 125 ml steril su 50 mM NPA stok çözeltisinden 125 ul ekleyerek 50 mcM NPA çözümünü yapmak.
    3. İyice karıştırın vetüp kağıt rulo üzerinde 50 uM NPA çözeltisi 125 ml dökün. Kağıt rulosu çözümü emer ve tamamen batırılmış olacak.
      Not: Diğer boyutlarıyla kağıt rulo ve tüpler kullanırken, buna göre ses seviyesini ayarlamak. Sıvı alımını sağlamak için yeterli yarım tüp ulaşmalıdır.
    4. Üç gün (27 ° C, sürekli ışığa,% 70 nispi nem) bir büyüme odasında kağıt rulo sistemi yerleştirin. Çözelti zaman (Şekil 2B) üzerinden buharlaşır çünkü kağıt ruloları, ekstra 50 mcM NPA çözeltisi ilave edilerek sırılsıklam kalır emin olun.
      4. GÜN
    5. (DMSO içinde çözülmüş) bir 50 mM stok çözelti NAA (: kullanımlar eldivenler DİKKAT) hazırlayın.
    6. Her bir tüp, bir steril cam beher içinde 125 ml steril su, 50 mM NAA stoktan 125 ul eklenmesi ile 50 uM NAA solüsyon hazırlanır.
    7. Yavaşça kağıt ruloları kalan NPA çözümün en sıkmak ve koyun5 dakika boyunca steril su m (: eldiven kullanın DİKKAT) dışarı yıkamak. Yavaşça kağıt ruloları gelen suyun çoğu sıkmak. Bu yıkama adımı üç kez tekrarlayın.
    8. İyice karıştırın ve tüplerde kağıt ruloları üzerinde 50 mcM NAA çözüm dökün. Tamamen batırılmış emin olun.
    9. Indüksiyon sonrası istenilen süre büyüme kabine (27 ° C, sürekli ışık,% 70 bağıl nem) kağıt rulo sistemi yerleştirin.
  5. Mısırın Adventif Taç Roots Yanal Kök İndüksiyon
    Not: İris primer kök yanal kökler indükler yukarıda tarif edildiği gibi. Ancak, mısır ve birlikte yan kökleri ile diğer monokotiledonlar, birincil kök ve embriyonik seminal kökleri içinde, fide gelişimi sırasında özellikle önemlidir. Bitki büyümesinde Daha sonraki bir aşamada, post-embriyonik adventif kökler kök üzerinde ortaya çıkan ve aynı zamanda yeni bir kök sistemine 16 oluşturmak için yan kökleri gelişir. Iris de kullanmak olabilird embriyonik birincil kök lris bazı küçük ayarlamalar takip ederek bu post-embriyonik adventif taç kökleri üzerinde yanal köklerini uyardığı.
    1. Kağıt rulo yapmak için, dış tarafında kağıt havlular sırasıyla iki tabaka ve içindeki çimlenme iki kağıt tabakası ile kağıt bir sandviç oluşturur. Çimlenme iki kağıt arasına sterilize çekirdekleri (adımları 2.2'ye 2.1 bakınız) yerleştirin. Çimlenme kağıt, el havlusu kağıt ile karşılaştırıldığında, kağıt açılması daha sonra daha kolay rulo yapacak kök tüyleri ve yanal kökler tarafından nüfuz daha az eğilimli olacaktır. Diğer yandan, kağıt havlular, iki dış tabakayı sıvı emilimini kolaylaştırır.
    2. 700 ml'lik cam tüplerde rulo yerleştirin ve üzerlerine NPA olmadan steril su dökün. Tamamen batırılmış emin olun.
    3. Büyüme kabine sterilize çekirdekleri çimlenmeye (adım 2.4.9 bakınız).
    4. Adventif taç kökleri kadar fidan büyür(B73 için 6 gün) ortaya başlar. Kağıt ruloları gerektiğinde steril su ekleyerek her zaman ıslak tutulur emin olun.
    5. Bir yıkama aşamasından sonra 50 uM NAA çözeltisi ile NPA çözeltisi değiştirerek yan kök başlatma benzer indüksiyon ardından 4 gün boyunca (adımları 2.4.4 2.4.1 bakınız) için 25 uM NPA çözeltisi transfer (adım 2.4 2.4.9 için 0,5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Iris Uygulama Yanal Kök Başlatma Süreci Karşılaştırmalı transkriptomik gerçekleştir

İris bir uygulaması, farklı türlerde yan kök oluşumu esnasında karşılaştırma ve gen ekspresyon profillerinin korelasyondur. Karşılaştırmalı transkriptomik farklı türler lateral kök geliştirme sürecine dahil orthologous genleri saptamak için olanak yaratmak yaklaşır. Önceden oluşturulmuş kök ekseninin içinde yer hücrelerinin bir alt kümesi ile ilgili yeni bir organın oluşumunu içerir yanal kök başlatma, kendi kök mimarisi kontrol etmek için kapalı-tohumlu tarafından paylaşılan en önemli mekanizmadır. Sonuç olarak, bu ortak bir atadan mevcut mevcut yolların evrimleştiği ve evrim boyunca korunmuş olduğu çok muhtemeldir. Nitekim, yan kök başlama ortak potansiyel düzenleyiciler farklı türler bulunmuştur <sup> 17, 18.

Arabidopsis ve Mısırda lris kullanılarak Örnekleme Malzeme ve Transkriptom Analizi

Gibi her iki türde de, sadece NAA tedavi öncesi bitkiler örnek karar Arabidopsis ve darı 10, 13, ve kısa bir süre indüksiyon sonrası, başlangıcında veya oksin tepkisi sırasında. Lris iki farklı türlerde kurulmuştur iyi başlangıcında olduğu gibi, ya da perisiklden ilk bölünmeler sırasında. Ayrıca, floresans 19 (FACS) Celi Aktif perisiklden hücreleri seçmek için Arabidopsis ya da mısır lazer yakalama Mikroskopi 20, 21 (LCM) kullanılmıştır. Arabidopsis, indüksiyon sonrası 2 ve 6 saat zaman noktaları seçilen transkripsiyonel pDR5 karakterizasyonu :: GUS oksin tepkisi ve pCYCB1 dayanmaktadır; 1 :: GUS hücre döngüsü işaretleyici hatları 9 (Şekil 3). Mısır, zaman 2, 3 ve indüksiyon sonrası 4 saat işaret mikroskobik hücre bölünmesinin karakterizasyonu ve gerçek zamanlı kantitatif ters transkripsiyon polimeraz zincir reaksiyonu (QRT-PCR) 13 kullanılarak birçok hücre döngüsü markör genlerin ekspresyonu analizinden sonra seçilen . RNA ile izole edilmiş hücrelerden çıkarılır ve önce 10, 13 tarif edildiği gibi mikro-dizi platformlarda melezlendi.

Arabidopsis CYCB1 ve ortologunun Bulunması; 1 (AtCYCB1; 1) Mısırda

Arabidopsis, işaret çizgisi pCYCB1 içinde, 1 :: GUS yaygın yan kök başlatılması sırasında perisiklden ilk bölünmeleri izlemek için kullanılır olmuştur. Böyle bir işaretleyici çok olurdumısır yararlıdır. AtCYCB1 çeşitli homologları, 1 mısır (www.maizesequence.org, tüm peptidler, BLASTP, varsayılan ayarlar) bulundu. Bunlardan altısı mısırda lris sonra yapılan mikrotertipte mevcuttu ve önemli zenginleşme gösterdi. 1 (Şekil 4), en iyi BLAST hit, GRMZM2G310115, AtCYCB1 için Arabidopsis'te gözlenmiş olana benzerdi lris sonra çok yüksek transkripsiyon seviyeleri gösterdi.

Iris Uygulama Bireysel Gen İfade kontrol etmek

AtCYCB1 arasında iyi bir aday olarak ortologunun GRMZM2G310115 doğrulamak için, 1, mısır yan kök başlatma bir İris 13 boyunca yapıldı, farklı zaman noktalarında alınan numuneler üzerinde gerçek zamanlı QRT-PCR. N öncesi Yukarıda bahsedilen protokolde tarif edildiği ve farklı zaman noktalarında toplandı gibi bitkiler muamele edilmiştirAA tedavisi (NPA) ve NAA tedavi 2, 3 ve 4 saat sonra. Ayrıca, sadece suda yetiştirilen bitkilerin malzemesi Iris ve nötr koşullar arasında gen ekspresyonu karşılaştırma hasat edilmiştir. Hemen hasattan sonra, kök segmentleri 5 mm ve kök ucu üzerinde 15 mm binoküler altında disseke edildi arasını kapsayan bir bölgeye karşılık gelir. Cımbız kullanarak, korteks bilinmektedir (perisiklden içerir) ayrılmış, hem de RNA dokulardan ekstre edilmiştir. O doğrulama için çok daha hızlı ve daha ucuz olduğu için bu son adım, yerine LCM gerçekleştirildi. Aşağıdaki, ilgili ileri ve ters QRT-PCR primerleri, AGCAGGACGCAGTTGGAGAG ve GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 yukarı regüle lris üzerine olduğu ve stel dokularda (Şekil 5) özgü olduğu doğrulandı. Ayrıca, bu deney senkron indüksiyon olmadan, suda büyüyen bir kök oluyor yanal kök başlama ayrık olaylar saptanabilir olmadığını gösterir, ve yanal kök başlatma işlemi ile ilgili farklı gen ekspresyonunu ortaya çıkarmak için lris ihtiyacını göstermektedir.

figür 1
Şekil 1. Arabidopsis için Yanal Kök İndüklenebilir Sistemi (A) naylon örgü (20 mikron) hazırlanması:., Naylon örgü (9 cm 9 cm) kesilmiş alüminyum folyoya sarın ve otoklav için bir cam beher koyun. (B) cımbız kullanarak bir NPA içeren plaka (10 uM) üzerine naylon örgü uygulayın. Daha sonra hava kabarcıklarını yok etmek için steril drigalski kullanın. Naylon (C) ekim tohumları pipet kullanarak örgü. Naylon (D) ekim tohumlar bir kürdan kullanarak örgü. (E) naylon cımbız kullanarak bir NAA içeren plaka (10 uM) mesh aktarın.81 / 53481fig1large.jpg "target =" _ blank "> bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 2,
Şekil 2. Mısır için Yanal Kök İndüklenebilir Sistemi.   Yer kağıt iki tabaka (92 cm x 24 cm, iki tabakanın uzunluğu) her bir üst üste ve bunların uzunluğu boyunca çift (92 cm x 12 cm) kat: (A) kağıt ruloları hazırlanması. (B) radicle 8 cm ara mesafeye sahip üstten 2 cm kağıt üzerine aşağı bakacak şekilde 10 sterilize mısır tanelerini koyun. Yerinde mısır çekirdekleri tutarken Ardından kağıdı rulo. (C) tüplerinde kağıt rulo (örneğin, 250 ml santrifüj tüpleri) koyun ve bir rafa koyun. (D) 27 ° C, sürekli ışık nispi Humi bir 50 uM NPA çözeltisi (üç gün mısır fideleri büyütündity% 70). (E) Sol: Sadece NAA aktarılmadan önce fide; Orta: Sadece NAA transferi ve NAA transfer edildikten sonra 2 gün önce mikrotom enine kesitleri; Sağ:. 5 gün NAA transfer edildikten sonra görünür ortaya çıkan yan kökleri ile fide bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3. Yanal Kök Başlatma pDR5 :: GUS marker satırını kullanarak NAA tedavisi sırasında oksin tepkisini gösteren Uzamış NAA Tedavisi. (AF) Zaman kursu üzerine uyarılan edilir. Yanal kök başlatılması tetikleyen ilk etkinliklerinden biri olan oksin cevabı, NAA tedavinin başlamasından sonraki 2 saat başlar. Üst panelde, tüm fide bir bakış verilir; alt panel gösterisiKök ucu oksin cevabı bu. PCYCB1 kullanarak bir NAA tedavi (GM) Zaman dersi; 1 :: GUS marker hattı. GUS sinyal CYCB1 ekspresyonunu temsil eder; 1 geni, yan kök oluşumuna yol açan ilk hücre bölünme NAA tedavinin başlamasından sonra 6 saat başlangıç ​​olduğuna işaret etmektedir. Üst panelde, tüm fide bir bakış verilir; alt panel CYCB1 göstermektedir. (Beeckman ve Engler, 1994 22 göre GUS boyanma) kök ucu 1 ifadesi bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
İris sırasında Arabidopsis ve Mısırda CYCB1 Genes Şekil 4. ifade profili.   (A) AtCYCB1 mikrodizi ifade değerleri, 1 lris sırasında De Smet ve arkadaşları tarafından tarif edildiği gibi. AtCYCB1 potansiyel ortologlar 2008 10 (B) 'mikrodizi ekspresyon değerler lris boyunca 1 Jansen ve diğerleri tarafından tarif edildiği gibi. Mısır genomu 1; 2013 13 BLASTP puanı AtCYCB1 protein dizisi patlatma sırasında elde edilen puandır. Hata çubukları standart sapmayı ifade ** p-değeri anlamına gelir ≤0.01. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 5,
Şekil 5. Stel içinde GRMZM2G310115 ifadesi ve lris sırasında Mısır Kökler Cortex. Ifadesidir <em> mısırda lris sırasında GRMZM2G310115 disseke stel ve korteks örneklerinde kantitatif gerçek zamanlı QRT-PCR ile değerlendirildi. Ek bir numune, su üzerinde yetiştirilen bitkiler üzerinde gerçekleştirildi. Değerler suda stelde ekspresyon için normalize edildi. Hata çubukları standart sapmayı ifade ** (Jansen ve ark. 2013 13 uyarınca primerleri ve referans genleri) p-değeri ≤0.01 anlamına gelir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Arabidopsis lris protokol, sadece tamamen NPA-ihtiva eden büyüme ortamı ile temas içinde büyüdü fide transferi için önemlidir. Bu yanal kök başlatma tüm kök uzunluğu boyunca bloke olmasını sağlar. Aktarım sırasında fidanları yaralama önlemek amacıyla, kavisli bir forseps kolları fide kotiledonlarında altında asılabilir. Devirden sonra fide kökleri NAA içeren agar ortamı ile yeterli temas halinde olduğundan emin olun. Bu, küçük bir mesafe boyunca agar yüzeyi üzerinde kök kaymağının elde edilebilir. Bu, toplam kök uzunluğu boyunca yanal kök başlatılması etkin bir senkronize indüksiyon sağlayacaktır. Kökler negatif büyüme ve yan kök indüksiyonu etkilemeden ışığa maruz yetiştirilebilir.

Mısır lris protokolü, bu çekirdeğin radicle d büyüyecek kök sağlamak için aşağı ve kağıt dönük olması önemlidirownwards ve doğru 16 kağıdın takmak. NPA tedavisinin üç gün sonra, fideler, küçük bir ateş, bir ilköğretim kök ve seminal kökleri 16 çekirdekten ortaya çıkmış olmalıdır. Birincil kök yan kök başlatma indüklenmesine geçmeden önce, yaklaşık 2 cm uzunluğunda olmalıdır. Bu protokol, B73 mısır inbred kullanılarak geliştirilmiştir, ancak farklı bir büyüme oranına sahip bir mısır hattının olması durumunda, buna göre kuluçka süresini ayarlamak edilmiştir. Kağıt ruloları sıvı zamanla buharlaşır zaman verimsiz ve istenmeyen erken yanal kök gelişimi oluşabilir olabilir aksi halde, NPA tedavisi düzenli 50 mcM NPA çözeltisi ilave edilerek sırılsıklam kalır emin olun. Sistemin kendisi ışığa köklerin fuar engeller, ama ışık önemli bir sorun değildir ve kök gelişimini ve lateral kök indüksiyonu etkilemez.

Yanal kökleri kontrollü indüksiyon için alternatif yollar mec kullanımı vardırhanical 23 ya gravistimulation 24 bükme. Bu sistemlerin en önemli avantajı, bunların lris hormon tedavilere göre daha 'doğal' indüksiyon sahip olduğunu, ancak dezavantajı, belirli bir zaman noktasında hasat edilebilir madde miktarı sınırlıdır ki bunlar çünkü Iris içinde perisiklden tam indüksiyon göre fide başına viraj bir yan kök başlatma olayı verim.

Uygun koşullar optimize edilmesi gerekir olsa Arabidopsis ve mısır kullanılan lris, çeşitli bitkiler kullanılabilir. Oksin nakil ve oksinin (2) birikim (1) bloke yan kök başlangıcını indükleme: Bir lris yüklemek için, iki önemli ardışık aşamaları elde edilmesi gerekir. Yetiştirme sistemi bileşimlerinin verimli ve muntazam alımı için izin vermeli ve fidelerin iyi gelişme izin vermelidir. Katı ortamda (Arabidopsis) ve kağıt ruloları alternatif sistemler (Bu tür sıvı kültürde, suda ya da aeroponi olarak mısır), diğer türler için kullanılabilir. Yani, lris ilk aşama, oksin taşıma engelleme, bir oksin nakil önleyici eklenerek elde edilebilir. NPA Arabidopsis ve mısır, lateral kök başlatma etkin bloğuna neden olsa da bu tür 2,3,5-triiyodobenzoik asit (TIBA) ya da p chlorophenoxyisobutyric asit (pCIB) gibi alternatif bileşikler diğer türlerin daha iyi çalışabilir. Benzer bir optimizasyon lris örneğin, oksin tedavinin ikinci adımı için yapılabilir. NAA görünmektedir sentetik oksin bir Iris için en uygun olduğu görülmektedir. Aynı zamanda güçlü bir yanal kök neden olur ve farklı bitki 25, 26. Öte yandan, doğal bir oksin indol-3-asetik asit, bir yüksek biyoaktiflik olduğu gibi oksin ön-madde indol-3-butirik asit (IBA), iyi bir alternatif olabilir (IAA) daha az istikrarlı ve daha kolay kök devel üzerine zayıf bir etkiye rasyonel, 27 metabolizeÖrnek mısır ya da pirinç 25, 26 için bölgesindeki sunmayı hedeflemektedir. Sentetik oksin 2,4-diklorofenoksiasetik asit (jıM 2,4 D) perisiklden hücrelerinde yüksek birikir, hücrelerde 28 ihraç edilmemesini çünkü kısmen, uygun bir yanal kök başlatma bozarak ve yapay indükleyici kaynaşık yapılar. Ayrıca bu gibi 12 naxillin olarak oksin yollar ile etkileşim diğer bileşikler, Arabidopsis'te yan kök başlamasını teşvik ettiği gösterilmiştir ve diğer türlerde test edilebilir.

Bazı durumlarda, çimlenme NPA huzurunda verimsiz ve bir ilk daha sonra NPA içeren sisteme fidan aktarmak için, NPA yokluğunda tohumları çimlenmeye seçebilirsiniz. Bu yalnızca NPA tedavisi sırasında uzamış kök bölgesini örnek dolayısıyla önemlidir NAA tedavi ve lateral kök indüksiyon öncesi başlatılan erken yanal kök Primordia sahip olası bir risk neden olur. Bu genel strateji takiben, tek shohemen her (tohum) bitki için bir Iris optimize etmek mümkün ULD ve kolay bir sisteme sahip olarak ilgi santral için yan kök gelişimini incelemek için. Arabidopsis için örneklendiği gibi yan kök başlama zamanı daha başka karakterizasyonu, markör hatları meydana gelmektedir. Işaretleyici hatları elde etmek zor iseniz, detaylı bir histolojik çalışma yapılabilir, ancak bu zaman alıcı ve ilk hücre bölünmeleri kolayca tanınabilir değildir. Alternatif olarak, hücre bölünmesi markerlerinin ifadesi analizi ilk hücre bölünmesini zamanlama işaret etmek için kullanılabilir.

İris örneğin transcriptome analizi gibi kısa bir süre sonuçları açıklandığı 9-13, hem de yan kök başlatma 14 boyunca makroskopik ve mikroskobik düzeyde histolojik gözlemler gibi farklı amaçlar için kullanılabilir. Organdan hücre ölçeğinde 29 arasında değişen örnekleme Farklı türleri, daha sonra farklı yönlerini çözülüyor izin olabiliral kök başlatma. Buna ek olarak, Iris yanal kök başlatma 12, 30 üzerinde farklı bileşiklerin etkisini izlemek için de kullanılabilir. Son olarak, raportör çizgileri kullanılarak bir lris de kullanılabilir, kolayca yan sırasında gen ekspresyonunu ve / veya protein lokalizasyonu karakterize etmek için Kök gelişimi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Lateral Kök İndüklenebilir Sistemi<em&gt; Arabidopsis</em&gt; Ve Mısır
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter