Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Messung von doi: 10.3791/54581 Published: February 22, 2017

Abstract

HIV-1-Hüllproteine ​​eingreifen verwandten Rezeptoren auf der Zielzellenoberfläche, die durch die Freisetzung des viralen Capsid (CA) Kern in das Cytoplasma, gefolgt viral-Zellmembranfusion führt. Anschließend bezeichnet der virale Reverse Transkriptase (RT), als Teil eines gleichnamigen Nukleoproteinkomplex der reversen Transkription Complex (RTC), wandelt den viralen einzelsträngige RNA-Genom in eine doppelsträngige DNA-Kopie (vDNA). Dies führt zur Biogenese von anderen Nukleoprotein-Komplex, bezeichnet als die Präintegrationskomplexes (PIC), der sich aus der vDNA und assoziierter Virus-Proteinen und Wirtsfaktoren. Der PIC-assoziierten viralen Integrase (IN) orchestriert die Integration der vDNA in die chromosomale Wirts-DNA in einer zeitlich und räumlich reguliert zweistufiger Prozess. Zunächst verarbeitet die in der 3'-Enden des vDNA im Zytoplasma und zweitens, nachdem der PIC an den Kern Verkehre, sie vermittelt Integration der verarbeiteten vDNA in die chromosomale DNA. Die PICs isoliertvon Zielzellen sind akut mit HIV-1 infiziert in vitro funktionell, da sie kompetent sind den zugehörigen vDNA in eine exogen zugesetztem heterologe Ziel - DNA zu integrieren. Solche PIC-basierte in vitro Integrationstests haben die mechanistischen Details der retroviralen Integration abgrenzen und zu entdecken IN Inhibitoren beigetragen. In diesem Bericht erarbeiten wir auf einem aktualisierten HIV-1 PIC Test, der zur Messung der in vitro Integration Aktivität von isolierten nativen PICs eine verschachtelte quantitative Echtzeit - Polymerase - Kettenreaktion (qPCR) -basierte Strategie beschäftigt.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1-Replikation in der Zielzelle umfasst mehrere Schritte, im Großen und Ganzen gruppiert in zwei Phasen: frühe und späte Ereignisse. Die frühen Ereignisse beginnen , wenn HIV-1 sequentiell an den Oberflächenrezeptor Zielzelle bindet , CD4 und einem der beiden Co-Rezeptoren (CCR5 oder CXCR4) 1. Folglich wird die Virus-Zellmembranen verschmelzen, und das virale Capsid (CA) Kern in das Zytoplasma 2 freigegeben. Die CA Kern enthält die virale genomische einzelsträngige RNA (ssRNA) und mehrere Proteine, sowohl viralen und zellulären Ursprungs. Die CA-assoziierten viralen Proteine ​​umfassen Reverse Transkriptase (RT) und Integrase (IN), zwei Enzyme, die während der frühen Ereignisse in der viralen Replikation kritischen Schritte vermitteln. Die RT und IN - Funktion in Zusammenhang mit Nucleoprotein - Komplexe, nämlich die reverse Transkription Complex (RTC) und das Präintegrationskomplexes (PIC), die jeweils 3, 4, 5 <sup>, 6. Die Enden des viralen Genoms ssRNA Hafen terminal repeat (R) Elemente benachbart zu der einzigartigen Sequenzen U5 (am 5'-Ende) und U3 (am 3'-Ende). Die RTC wandelt das virale ssRNA-Genom in eine doppelsträngige (ds) DNA-Kopie (vDNA). Diese umgekehrte Transkriptionsprozess resultiert auch in Duplizierung der U5 und U3 - Sequenzen, so lange terminale Wiederholungen (LTR) an beiden Enden der vDNA 7, 8 zu erzeugen. Anschließend katalysiert das PIC-assoziiertes in zwei aufeinanderfolgenden biochemischen Reaktionen, die die Integration der vDNA in das Wirtschromosom 9, 10, 11 ermöglichen. Zuerst wird im Zytoplasma, IN Multimere Eingriff beide LTRs 12 und ein Dinukleotid aus jeder der 3'-terminalen Enden abzuspalten. Diese 3'-End - Verarbeitung erzeugt an jedem 3'-Ende (CA OH) der vDNA eine Hydroxylgruppe.Als nächstes Verkehre PIC an den Kern, wobei in der vDNA CA OH als Nucleophil verwendet beide Stränge der chromosomalen DNA in einer gestaffelten Art und Weise zu schneiden. Gleichzeitig Spleiße IN koordinativ an beiden Enden der vDNA der resultierenden Phosphodiesterbindungen auf gegenüberliegenden Stränge der chromosomalen DNA. Im Anschluss an diese Strangtransferschritt entfernt die Wirtszelle Maschinen die beiden ungepaarten Nukleotide am 5'-Enden der vDNA und repariert die folgenden einsträngige Lücken an der Kreuzung von der Integrationsstelle. Die frühen Ereignisse also mit der Einrichtung eines integrierten DNA-Kopie (Provirus) des HIV-1-Genoms gipfeln. Das Provirus stellt eine geeignete Umgebung für die effiziente virale Genexpression, die einschließlich der Expression der Virus-kodierten Proteinen spätere Ereignisse initiiert; Montage des unreifen Virus; und Knospung, Release und Reifung in infektiöse Virionen 13.

Gereinigte rekombinante retrovirale IN ist zuständigdurchzuführen, in vitro, beide 3'-End - Verarbeitung und Strangtransferaktivitäten auf exogen zugeführt LTR artiges Substrat - DNA. Biochemische Untersuchungen so gereinigte rekombinante bei der Verwendung haben ergeben , kritische Aspekte der vDNA Integration 14, 15, 16, 17. Jedoch anders als in natürlichen Infektion, diese in vitro biochemische Reaktion unterstützt nicht abgestimmten Integration beider Enden der Substrat - DNA in das Ziel - DNA. Im Gegensatz dazu integrieren Retrovirus PICs isoliert aus akut infizierten Zellen concertedly beide Enden des endogenen vDNA in heterologe Ziel-DNA. Dies führte zu der weit verbreiteten Annahme und nachfolgende Verfeinerungen von I n - vitro - Integration (IVI) Assays isoliert nativen PICs mit.

In der ersten berichteten retroviralen IVI-Assay, Zytoplasmaextrakte von Zellen mit einem rekombinanten Mäuse infiziertLeukemia Virus (MLV) , um das E. coli supF - Gen in seiner LTR beherberge diente als Quelle der IN - Aktivität und der DNA eines mutierten Lambda - Phagen - defekt in das lytische Wachstum wurde exogen als die Ziel - DNA zugeführt. Erfolgreiche Integration der rekombinanten DNA MLV Kopieren in die Phagen-DNA und die Expression supF anschließenden führte zur Wiederherstellung der Plaque-bildenden Fähigkeit der rekombinanten Phagen. Allerdings ist diese experimentellen Strategie ist mühsam und Maßnahmen Integration in indirekter Weise. Um solche Einschränkungen, ein Southern - Blot-basierte indirekte Endmarkierung Assay adressieren, die die PIC-assoziiertes IVI Aktivität als Maß für das endogene vDNA in exogene linearisierte Bakteriophage phiX174 - DNA integriert quantifiziert wurde 6 entwickelt, 7, 18. Obwohl dieses Verfahren ein direktes Maß der Integrationsereignisse liefert, relativ hohe Mengen an PIC Herstellung erforderlich sind, was eine technisch anspruchsvolle bleibtbemühen. Um dies zu umgehen, Nested-PCR - basierte Assays erfordern nur geringe Mengen an PICs wurden 4, 5 entwickelt, 19.

In diesem Bericht beschreiben wir eine aktualisierte Version von einer verschachtelten PCR-basierten In - vitro - Methode entwickelt , um die HIV-1 - PIC-vermittelte Integration Aktivität zu rekapitulieren während einer natürlichen Infektion auftreten. Diese Methode verwendet die zytoplasmatischen Extrakten von HIV-1-infizierten Zielzellen als eine Quelle für endogene PIC-Aktivität, die mit einem quantitativen Echtzeit-Polymerase-Kettenreaktion (qPCR) gemessen wird. Die Verfahren für die PICs zu isolieren und ihre Integrationsaktivitäten Messung angepasst sind, mit Modifikationen, von Protokollen , die vom Engelman Labor veröffentlicht 20. In diesem Verfahren wird die PIC-assoziiertes Integrations Aktivität initiiert durch eine exogene lineare Ziel - DNA 21 bietet, und die DNA - Produkte ausDiese Integrationsreaktion werden gereinigt und als Ausgangsmaterial für die nachfolgende PCR-basierte Quantifizierung verwendet. In der ersten Runde konventionellen PCR, die viral-Ziel-DNA-Übergänge unter Verwendung geeigneter Primer amplifiziert. In der zweiten Runde qPCR, LTR-spezifische Primer verwendet werden, um spezifisch die vDNA Bevölkerung aus der ersten Runde der PCR-Produkte bereichern. Bitte beachten Sie die Protokollabschnitt für eine detaillierte Beschreibung dieses Verfahrens.

In - vitro - Studien mit retroviralen PICs haben zu erheblichen Fortschritten im Verständnis des Mechanismus der retroviralen DNA - Integration und in der Entwicklung von IN Inhibitoren geführt. Basierend auf der jüngsten verstärkten Fokus auf Mapping-HIV-1-Integrationsstellen, die Rolle von viralen und Wirtsfaktoren in HIV-1-Integration zu bestimmen und die Entwicklung neuer antivirale Medikamente gegen Arzneimittelresistenz Bekämpfung erwarten wir ein verstärktes Interesse an und weit verbreiteten Einsatz von IVI-Assays , wie die in diesem Bericht beschrieben ein. Dies wiederum, führt zuZukunft Verfeinerungen bei dem Verfahren Diversifizierung dadurch den Umfang seiner Anwendungen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Virus-Produktion

HINWEIS: Um die hohe Titer von infektiösen HIV-1 erzeugen, transfizieren die menschliche embryonale Nieren (HEK) Zelllinie 293T mit einem infektiösen HIV-1 molekularen Klon ein aktiviertes Dendrimer-basierten Transfektionsreagenz verwenden. Es wurde beobachtet, dass das Calciumphosphat-Transfektionsverfahren vergleichbare Ergebnisse ergibt.

  1. In einer biologischen Sicherheitsstufe 2 (BSL2) lab, seed 3 x 10 6 293T - Zellen pro 10 cm - Schale in 8 ml Dulbeccos modifiziertem Eagle Medium (DMEM) , ergänzt mit 10% fötalem Rinderserum (FBS), Penicillin und Streptomycin. Kultur die Zellen in einem Inkubator bei 37 ° C und 5% CO 2 O / N.
  2. Am nächsten Tag für Zellen in jeder 10 cm - Schale Transfizieren verdünnen 8 ug pNL4-3 Plasmid DNA (Materials Tabelle) bis zu einem Endvolumen von 300 & mgr; l DMEM fehlt Serum und Antibiotika. In 80 ul des Transfektionsreagenz, gut mischen durch Pipettieren, und Inkubation bei RTVon 5 bis 10 min für die Transfektion Komplexbildung.
  3. Entfernen Sie das Medium aus den Schalen von Aspiration und 7 ml pro Schale mit frischem DMEM, das Serum und Antibiotika.
  4. In 1 ml DMEM, das Serum und Antibiotika zur Transfektion komplex, mischen durch Pipettieren, und fügen Sie diese Mischung auf die Zellen. Vorsichtig schwenken die Schale gleichmäßige Verteilung der Transfektion Komplexe zu erleichtern.
  5. Unmittelbar übertragen Sie die Zellen an die BSL3 - Labor, in einem Inkubator eingestellt bei 37 ° C und 5% CO 2, und die Kultur der Zellen für 48 h.
  6. Sammeln Sie die virushaltige Gewebekulturüberstand mit einer Pipette und dann übertragen sie in ein Zentrifugenröhrchen. Zentrifuge bei 300 × g für 5 min, um die Zellen zu pelletieren und Schutt, und filtern dann den Überstand durch ein 0,45 & mgr; m Porengröße Spritzenfilter.
  7. Um jegliche Übertrags Plasmid-DNA in diesem zellfreien Viruspräparation zu beseitigen, Behandlung mit DNase 1 (20 ug / ml) bei 37 ° C für 1 h.
  8. Zur Quantifizierung derHIV-1 - Titer, verwenden Sie die p24-spezifische Enzyme Linked Immuno Assay (ELISA), da es eine schnelle und zugänglich Methode für den Routineeinsatz 22 ist.
    HINWEIS: Es sollte beachtet werden, dass die p24-ELISA die physikalische Titer (Anzahl der Viruspartikel) misst. Alternativ liefert das Virus-assoziierten RT-Aktivität messen (exogenen RT-Assay) oder Virus-Infektiosität (TZM-bl Indikatorzellleitungsbasierte Infektiosität-Assays) exclusive Auslesung von infektiösen Viruspartikeln.

2. Virus-Infektion von Sup-T1-Zellen (BSL3 Lab)

  1. In einem BSL2 lab pflegen Sup-T1 - Zellen zwischen 1,0 x 10 6 und 2,0 x 10 6 Zellen / mL in Roswell Park Memorial Institute (RPMI) Medium , ergänzt mit 10% hitzeinaktiviertem FBS, Penicillin und Streptomycin (Aufteilungsverhältnis von 1 : 2 alle 2 - 3 d). Pool die Sup-T1-Zellen aus den Kulturflaschen, gut mischen durch Pipettieren und bestimmen die Lebendzellzahl durch eine Zählkammer und die Trypanblau staining Verfahren.
    1. Bereiten Sie die erforderliche Anzahl von Aliquoten von 80 x 10 6 Zellen (pro Virusinfektion) in 50 ml konischen Zentrifugenröhrchen.
    2. Zentrifugation der Zellen in einem Schwenkbecherrotor bei 500 xg und 25 ° C für 5 min. Ohne das Zellkulturmedium entfernt wird, übertragen die Röhrchen pelletierten Zellen zur BSL3 lab für die weitere Verarbeitung enthält. aspirieren vorsichtig das Zellkulturmedium aus dem Rohr, ohne das Zellpellet zu stören.
  2. Fügen Sie eine angemessene Menge an DNase I behandelten Virusinokulum zu den Zellen in das Röhrchen und mischen Sie gut durch vorsichtiges Pipettieren. 80 x 10 6 Zellen, verwendet werden 30 ml DNase I-behandelte Virus (50 & mgr; g p24-Äquivalent - Virus).
    HINWEIS: Isolation von funktionellen PICs erfordert die Zielzellen mit sehr hohen Multiplizitäten der Infektion zu infizieren (MOI).
  3. Verteilen Sie die Mischung gleichmäßig zwischen zwei 6-Well - Gewebekulturplatten (dh 12 x 2,5-ml - Anteile; verwenden 2 Platten pro InfektIon).
  4. Für spinoculation, legen Sie die Kulturplatten in Plattenträger und Zentrifuge eine Schwingbecherrotor bei 480 × g und 25 ° C für 2 h verwendet wird.
  5. Inkubieren der spinoculated Zellen bei 37 ° C und 5% CO 2 für 5 Stunden.

3. Ernte und Lyse von infizierten Zellen (BSL3-Labor)

  1. Pool der Zellen jeder Infektion entspricht, von den Kulturplatten in ein 50 ml konisches Zentrifugenröhrchen (ca. 30 ml insgesamt).
  2. Ernte der Zellen durch Zentrifugation bei 300 xg und 25 ° C für 10 min. Vorsichtig absaugen (verwenden Sie alternativ mit einer Pipette) den Überstand aus dem Rohr.
  3. Um jegliche Restviruspartikel zu entfernen, Waschen jedes Zellpellet durch Zugabe von 2 ml Puffer K - / - (150 mM KCl, 20 mM HEPES, pH 7,6, 5 mM MgCl 2) und Zentrifugieren der Probe bei 300 xg und 25 ° C für 10 Minuten. Dann, ohne das Pellet zu stören, entfernen Sie vorsichtig den Überstand durch Absaugen oder durch eine Pipette.
  4. Repeat Schritt 3.3.
  5. Entfernen Sie vorsichtig restliche Puffer von einer Mikropipette. Resuspendieren jedes Zellpellet in 2 ml eiskaltem Lysepuffer K + / + (Puffer K - / - mit 0,025% Digitonin ergänzt, 1 mM DTT, 20 ug / ml Aprotinin), mischen Inhalt durch vorsichtiges Pipettieren, und in ein 2 ml Mikrozentrifugenröhrchen.

4. Herstellung von Cytoplasma-PICs (BSL3-Labor)

  1. Rock die Proben auf einem Rotationsschüttler bei RT für 10 min.
  2. Zentrifugiere die Proben mit dem Rotor vorgekühlt auf 4 ° C, bei 1500 xg und 4 ° C für 4 min.
  3. Ohne das Pellet zu stören, übertragen sorgfältig den Überstand in ein frisches Mikrozentrifugenröhrchen und zentrifugiere bei 16.000 xg und 4 ° C für 1 min.
  4. übertragen Sie vorsichtig den Überstand in ein neues Mikrozentrifugenröhrchen. Hinzufügen RNase A (20 mg / mL) auf eine Endkonzentration von 20 ug / ml (2 & mgr; l für 2 ml PICs) und Inkubieren der Inhalt bei RT für 30 min (kein rocking). </ Li>
  5. Hinzufügen , Saccharose (60% w / v in Puffer K - / -) bis zu einer Endkonzentration von 7% und gut mischen durch vorsichtiges Pipettieren. Bereiten Sie Aliquoten (zB 200 & mgr; l) der PICs in Mikrozentrifugenröhrchen, flash-freeze in flüssigem Stickstoff, und in einem -80 ° C Gefrierschrank für die Langzeitlagerung.

5. In - vitro - Integration (IVI) Tests unter Verwendung von HIV-1 PICs

  1. Bereiten Sie die Ziel-DNA in der IVI-Assay verwendet, indem ein 2,0 kb-Region von der phiX174 Plasmid-DNA mit PCR Amplifikation unter Verwendung von maßgeschneiderten Primern, phiX174-F und phiX174-R.
    1. Bauen Sie die PCR - Gemisch , wie in Tabelle 1 beschrieben. Führen Sie die PCR in einem Thermocycler die thermischen Zyklusbedingungen unter Verwendung der in Tabelle 2 empfohlen. Gel-Reinigung des PCR-Produktes unter Verwendung eines Gel-Reinigungskits (nach vom Hersteller empfohlenen Protokoll), und speichern die gereinigten Ziel-DNA als Aliquots bei -80 ° C bis zur Verwendung.
  2. In 600 ng der Ziel-DNA zu 200 - & #181 L aliquote Menge von PICs, gut mischen und für 45 Minuten bei 37 ° C inkubiert.
    Hinweis: IVI Reaktionen Ziel - DNA Weglassen oder einschließlich eines Integrase - Inhibitor (zB Raltegravir) sind Kontrollreaktionen empfohlen.
  3. Beenden Sie die Reaktion durch Zugabe von IVI SDS, EDTA und Proteinase K bis zu Endkonzentrationen von 0,5%, 8 mM und 0,5 mg / ml. Mischen Sie die Reaktionsinhalt gründlich und Inkubation über Nacht bei 56 ° C.
  4. Am nächsten Tag, reinigen die Gesamt-DNA aus dem IVI Reaktion durch Phenol / Chloroform-Extraktion und Ethanolfällung. Führen Sie alle Zentrifugationsschritte bei 16.000 xg und RT.
  5. Fügen Sie ein gleiches Volumen an Phenol zur entproteinierte Probe, mischen kräftig durch Verwirbelung und Zentrifuge für 2 min. Entfernen Sie vorsichtig die obere wässrige Phase und übertragen sie in ein frisches Röhrchen.
  6. Wiederholen Sie Schritt 5.5. Übertragen Sie die obere wässrige Phase in ein frisches Röhrchen.
  7. Fügen Sie ein gleiches Volumen von 1: 1 Phenol: Chloroform-Mischung, mischen kräftig durch Verwirbelung und Zentrifuge for 2 min. Übertragen Sie die obere wässrige Phase in ein frisches Röhrchen.
  8. Fügen Sie ein gleiches Volumen Chloroform, kräftig mit Verwirbelung und Zentrifuge für 2 min. Übertragen Sie die obere wässrige Phase in ein frisches Röhrchen.
  9. DNA auszufällen, fügen Glykogen auf eine Endkonzentration von 0,1 & mgr; g / & mgr; l, 3 M Natriumacetat bis zu einer Endkonzentration von 0,3 M und 2,5 Volumina 100% igem Ethanol (eiskaltem). Vortex mischen, Zentrifuge kurz den Inhalt zu sammeln, und legen Sie den Schlauch bei -80 ° CO / N.
  10. Am nächsten Tag zentrifugieren der Probe für 30 min bei 16.000 xg und 4 ° C für 30 min. Entfernen Sie vorsichtig den Überstand, ohne das Pellet zu stören.
  11. Hinzufügen 500 & mgr; l von 80% Ethanol (eiskaltem) zu dem Pellet und Zentrifuge bei 16.000 xg und 4 ° C für 10 min. Luft trocknen den DNA-Pellet bei RT und gründlich in 50 ul Nuklease-freies Wasser suspendieren. Speichern der DNA-Proben bei -20 ° C.

6. PCR Assays für die Quantifizierung von PIC Aktivität

  1. Führen der ersten Runde konventionellen PCR unter Verwendung von Primern, die das virale LTR und die phiX174 DNA (LTR und phiX174 Primern, jeweils) Targeting die Übergänge der integrierten HIV-1-DNA zu amplifizieren.
    1. Bauen Sie die Erstrunden-PCR - Gemisch , wie in Tabelle 3 beschrieben. Bauen Sie einen Master-Mix aller Komponenten der Matrizen-DNA auszuschließen, verzichten 45-ul-Aliquots in separate PCR-Röhrchen, und mit 5 & mgr; l Template-DNA oder Nuklease-freies Wasser (Kontrolle).
    2. Führen Sie die PCR in einem Thermocycler die thermischen Zyklusbedingungen unter Verwendung der in der Tabelle empfohlen 4.
  2. Führen der zweiten Runde qPCR unter Verwendung von Primern, die einen kurzen Bereich des viralen LTR (LTR-R und LTR-U-Primer) flankieren, um selektiv die integrierte vDNA Sequenzen aus dem ersten ro amplifizierenund PCR-Produkte. Um die integrierten vDNA Kopienzahlen bestimmen, um eine Standardkurve zu erzeugen um den Faktor 10 Reihenverdünnungen von bekannten Kopienzahlen (zB 10 0 - 10 8) des HIV-1 molekularen Klon.
    1. Montieren Sie die zweite Runde qPCR Mischung , wie in Tabelle 5 beschrieben. Bauen Sie einen Master-Mix aller Komponenten der Matrizen-DNA auszuschließen, sorgfältig verzichtet werden 25 & mgr; l-Aliquots in die entsprechende Anzahl von Vertiefungen in einer 96-Well-PCR-Reaktionsplatte, und fügen Sie dann 5 ul der ungereinigtem ersten Runde PCR-Produkte oder Nuklease-freies Wasser (steuern). Führen Sie alle qPCR Reaktionen in dreifacher Ausfertigung.
    2. Laden Sie die PCR - Platte in die Echtzeit - PCR - Instrument und führen qPCR mit den Zyklusbedingungen empfohlen in Tabelle 6.
    3. Analysieren Sie die Daten, die eine geeignete Software.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Isolierung von HIV-1 PICs

Ein Schema des Protokolls für die Isolierung von HIV-1 PICs von akut infizierten Sup-T1 - Zellen verwendet , ist in Abbildung 1 dargestellt. Dieses Protokoll wird von den Methoden von Engelman et al beschrieben abgeleitet. 19, 20. HIV-1 PICs sind Nucleoprotein - Komplexe , die in infizierten Zellen zusammengesetzt sind und die aus der revers transkribiert vDNA, viralen Proteinen und zellulären Faktoren 19, 20. Das Verfahren in diesem Bericht beschriebenen verwendet die zytoplasmatischen Extrakten von HIV-1-infizierten Zellen als Quelle des PIC-assoziierten Integrations Aktivität.

In vitro Integrations Aktivität von HIV-1 PICs

Abbildung 2 dargestellt. Dieses Verfahren verwendet eine nested-qPCR basierte Strategie PIC-assoziiertes IVI Aktivität zur Messung, und die Verfahren sind angepasst, mit Modifikationen von Protokollen , die vom Labor Engelman 19 veröffentlicht, 20, 21. In diesem Verfahren wird die PIC-assoziiertes Integrations Aktivität initiiert durch eine heterologe linearen Ziel - DNA 21 bietet, und die DNA - Produkte von dieser Integrationsreaktion resultierenden werden gereinigt und als Ausgangsmaterial für die nachfolgende PCR-basierte Quantifizierung verwendet. In der ersten Runde konventionellen PCR, die viral-Ziel-DNA Junctions unter Verwendung von geeigneten Primern amplifiziert. In der zweiten Runde qPCR, LTR-spezifische Primer verwendet werden, um spezifisch die vDNA Bevölkerung aus der ersten Runde der PCR-Produkte bereichern. Bitte sehen Sie das Protokoll sPLANS für eine detaillierte Beschreibung dieses Verfahrens.

Repräsentative Ergebnisse aus einer IVI - Assay durchgeführt HIV-1 PICs verwenden , sind in Abbildung 3 dargestellt. Sup-T1 - Zellen (80 x 10 6 Zellen / Infektion) wurden mit 30 ml DNase 1-behandelten HIV-1 (~ 50 & mgr; g p24 - Äquivalent) bei 480 in Abwesenheit oder Gegenwart von 1 uM HIV-1 IN Raltegravir spinoculated xg und 25 ° C für 2 h. Zellen wurden anschließend für 5 h bei 37 ° C und 5% CO 2. PICs wurden isoliert wie im Protokoll beschrieben. Die IVI-Reaktionen wurden durchgeführt, jeweils unter Verwendung von 200 & mgr; l von PICs und 600 ng der Ziel-DNA (2 kb DNA-Fragment aus phiX174-DNA durch PCR amplifiziert), bei 37 ° C für 45 min. Die Reaktionen wurden durch Proteinase K-Behandlung in Gegenwart von SDS und EDTA bei 56 ° CO / N deproteinisiert. Die Reaktionsprodukte wurden zweimal mit Phenol extrahiert, einmal mit Phenol: Chloroform (1: 1) -Mischung, und wennmit Chloroform. Anschließend wurde die DNA-Ethanol ausgefällt in Gegenwart von Salz und dem Co-Fällungs Glykogen und das DNA-Pellet wurde einmal mit 80% Ethanol gewaschen. Die gereinigte DNA wurde in 50 & mgr; l Nuklease-freiem Wasser resuspendiert. Eine verschachtelte qPCR-Strategie wurde verwendet, um die Anzahl der vDNA integriert in die phiX174-DNA zu bestimmen. In der ersten Runde konventionellen PCR, Primer, die komplementär zu Sequenzen auf der phiX174 Ziel-DNA und der viralen LTR-Region wurden verwendet, um die integrierten viralen DNA-Ziel junctions von 5 ul der DNA-Integration Reaktionsprodukte zu verstärken. In der zweiten Runde qPCR, LTR-Spanning - Primer ausschließlich verwendet wurden , um die HIV-spezifische DNA - Sequenzen von 5 & mgr; l der ersten Runde Amplicon Produkte und von 10-fach Reihenverdünnungen von bekannten Kopienzahl (10 8 -10 0) verstärken des HIV-1 molekularen Klon (Standards).

Alle qPCR Reaktionen wurden in dreifacher Ausfertigung und die Daten durchgeführt were analysiert kommerzielle Software. Die Werte von den Standards abgeleitet wurden aufgetragen, um eine Standardkurve zu erzeugen, aus dem die integrierte vDNA Kopienzahlen interpoliert wurden. Fehlerbalken stellen Standardabweichungen. Wie in der Figur 3 gezeigt, sind die HIV-1 PICs robust die zugehörige vDNA in die Ziel - DNA (Spur 5) zu integrieren. Wichtig ist, dass die IVI Effizienz von PICs stark in Reaktionen mit dem IN-Inhibitor Raltegravir (Bahn 6), ergänzt reduziert. Diese Attribute stark die Integration Aktivität in diesem Test gemessen, um HIV-1 IN. Ferner keine Integration Aktivität zeigten die Kontrollreaktionen zytoplasmatischen Lysate aus nicht-infizierten Zellen (Spur 1), PICs allein (Spur 2) enthält, Ziel-DNA allein (Spur 3) und Puffer alleine (Spur 4). Darüber hinaus ist die Steuerung, die Taq-Polymerase in der ersten Runde PCR (Bahn 7) ausgeschlossen haben verstärken nicht Integrationsprodukte. Bemerkenswert ist, zeigten die Daten von der PICs-alone-Steuerung (Spur 2), dass die verschachtelte qPCR-Strategie spezifimatisch misst die integrierte vDNA aber nicht die PIC-assoziierten vDNA. Zusammengefasst zeigen diese Daten, um die Messung von PIC-assoziierte Integration Aktivität.

Abbildung 1
Abbildung 1: Schematische Darstellung des Protokolls zur Herstellung von HIV-1 PICs. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Cytoplasmatischen Extrakte PICs sind isoliert von HIV-1-infizierte Sup-T1-Zellen enthält. Diese Bilder sind als die Quelle der Integrationstätigkeit in dem in vitro Integrationstest verwendet.

Figur 2
Abbildung 2: Schematische Darstellung der in - vitro m> Integration Assay von HIV-1 PICs. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Integration Tests wurden in vitro durchgeführt unter Verwendung von HIV-1 PICs und das heterologe Ziel phiX174 DNA. Die integrierte HIV-1-DNA wurde durch eine nested PCR Strategie gemessen, wobei die erste PCR-Runde herkömmlichen verstärkt die Integration Gänge, aus denen vDNA-spezifische Sequenzen werden in einer zweiten Runde qPCR bevorzugt amplifiziert.

Figur 3
Abbildung 3: HIV-1 - PIC-assoziierte vDNA Integration Aktivität. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

"Fo: keep-together.within-page =" 1 "> Repräsentative Ergebnisse der HIV-1-PIC-assoziierte Integration Aktivitätstest Die integrierten vDNA Zahlen kopieren wurden durch Auftragen Werte bestimmt aus einer Standardkurve abgeleitet erzeugt unter Verwendung von 10-fach Reihenverdünnungen. bekannt Kopienzahlen eines HIV-1 molekularen Klon. Alle Reaktionen wurden dreifach durchgeführt und die Daten wurden unter Verwendung kommerzieller Software analysiert. die Fehlerbalken Standardabweichungen darstellen.

Komponente Stock Das endgültige Volumen für 50 & mgr; l - Reaktion
phiX174 Plasmid DNA 10 ng / & mgr; l 5,0 ul
GoTaq Reaktionspuffer 5x 10,0 ul
dNTP Nukleotid-Mix Jeweils 10 mM 1,0 ul
phiX174-F-Primer 10 & mgr; M 2,5 ul
phiX174-R Grundierung 10 & mgr; M 2,5 ul
GoTaq DNA Polymerase (5 U / ul) 0,25 & mgr; l
Nuklease-freies destilliertes Wasser - 28.75 ul

Tabelle 1.

95 ° C = 2 min
Zyklus 34 Wiederholungen:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 min
4 ° C = Halte

Tabelle 2.

Komponente Stock Das endgültige Volumen für 50 & mgr; l - Reaktion
IVI Reaktion DNA-Produkt - 5,0 ul
GoTaq Reaktionspuffer 5x 10,0 ul
dNTP Nukleotid-Mix Jeweils 10 mM 1,0 ul
LTR-Primer 10 & mgr; M 2,5 ul
phiX174 Primer 10 & mgr; M 2,5 ul
GoTaq DNA Polymerase (5 U / ul) 0,25 & mgr; l
Nuklease-freies destilliertes Wasser - 28.75 ul

Tisch 3.

95 ° C = 5 min
Zyklus 23 Wiederholungen:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 min
4 ° C = Halte

Tabelle 4.

<td> TaqMan-Sonde
Komponente Stock Das endgültige Volumen für 30 & mgr; l - Reaktion
1. Runde PCR - Produkte - 5,0 ul
LTR-R-Primer 10 & mgr; M 0,9 ul
LTR-U-Primer 10 & mgr; M 0,9 ul
10 & mgr; M 0,3 ul
iQ Supermix 2x 15,0 ul
Nuklease-freies destilliertes Wasser - 7,9 ul

Tabelle 5.

95 ° C = 3 min
Zyklus 39 Wiederholungen:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
Platte lesen

Tabelle 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Biochemische Analysen von retroviralen PICs haben kritische Einblicke in den Mechanismus der retroviralen DNA-Integration zur Verfügung gestellt. Die Messung der Integration Aktivität von retroviralen PICs kann durch die Bildung von Plaque-Assay, Southern-Blot-Analyse und verschachtelte qPCR erreicht werden. Die experimentelle Strategie der Plaque - Assay ist arbeitsaufwendig , und verwendet eine indirekte Methode 6 Integration zu messen, 7, 18. Southern - Blot-basierte Assays messen die Integration direkt erfordern jedoch relativ hohe Mengen an PICs 6, 7, 18.

Dieser Bericht beschreibt eine verschachtelte qPCR - Strategie zur Messung von HIV-1 - PIC-assoziierte Integration Aktivität in vitro. Der große Vorteil und die Bedeutung dieses Verfahrens ist das Erfordernis der relativ geringen Mengen an PIC Zubereitung pro Reaktion 4, 5, 19. Die kritischsten Schritte dieses Verfahrens sind die Erzeugung eines hochtitrigen Virus für die Infektion und die Handhabung von PIC Zubereitung. Es sollte hier angemerkt werden, dass die erste Runde der PCR exponentielle Amplifikation der Integrations junctions beinhaltet. Folglich sind die Kopienzahlen von integrierten vDNA in der zweiten Runde qPCR bestimmt semi-quantitative und daher haben die Begrenzung der nicht ein gewisses Maß an PIC-assoziierten vDNA Kopien geben. Allerdings kann der PIC-assoziierten vDNA durch qPCR bestimmt werden von der DNA von PICs mit LTR-spezifischen Primer gereinigt. Das Verhältnis der integrierten vDNA Kopienzahlen an den entsprechenden PIC-assoziiertes vDNA Informationen über die Integrationseffizienz einer in vitro Integrationsreaktion bereitstellen kann. Dieses Verfahren kann durch die Einbeziehung anderer heterologe Ziel-DNA-Auswahl und andere Primer modifiziert werden, die Integration auf beiden Orientierungen zu erkennen. Zusammenfassend ist das VerfahrenHier misst die Integration Aktivität von HIV-1 PICs quantitativ beschrieben und kann im Bereich der Forschung werden, um ein Verständnis der biochemischen Details der retroviralen Integration.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, keine konkurrierenden finanziellen und nicht-finanziellen Interessen.

Acknowledgments

Diese Arbeit wird zum Teil durch Zuschüsse DA024558, DA30896, DA033892 und DA021471 von der NIDA / NIH auf CD unterstützt. Wir erkennen auch die RCMI Zuschuss G12MD007586, die Vanderbilt CTSA UL1RR024975 gewähren, die Meharry Translational Research Center (MeTRC) CTSA Zuschuss U54 RR026140 vom NCRR / NIH, der U54 Zuschuss MD007593 vom NIMHD / NIH, und die Gewährung P30 AI110527 Tennessee CFAR.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Messung von<em&gt; In Vitro</em&gt; Integration Aktivität von HIV-1 Preintegration Komplexe
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter