Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Misurazione doi: 10.3791/54581 Published: February 22, 2017

Abstract

proteine ​​HIV-1 busta impegnano recettori cognate sulla superficie delle cellule bersaglio, che porta a fusione della membrana virale delle cellule seguita dal rilascio del nucleo capside virale (CA) nel citoplasma. Successivamente, il virale trascrittasi inversa (RT), come parte di un complesso omonimo nucleoproteina definito il trascrizione inversa Complex (RTC), converte il virale genoma RNA a singolo filamento in una copia di DNA a doppio filamento (vDNA). Questo porta alla biogenesi di un altro complesso nucleoproteina, chiamato il complesso di pre-integrazione (PIC), composto dal vDNA e proteine ​​del virus associati e fattori dell'ospite. L'integrasi virale PIC-associato (IN) orchestra l'integrazione della vDNA nel DNA cromosomico host in un processo in due fasi temporalmente e spazialmente regolamentato. Innanzitutto, l'IN elabora estremità 3 'della vDNA nel citoplasma e, dall'altro, dopo il PIC traffici al nucleo, essa media integrazione del vDNA trasformata nel DNA cromosomico. I PIC isolatida cellule bersaglio con infezione acuta da HIV-1 sono funzionali in vitro, in quanto sono competenti per integrare il vDNA associato in un DNA bersaglio eterologo esogena aggiunto. Tale PIC-based nei test di integrazione in vitro hanno contribuito in modo significativo a delineare i dettagli meccanicistici di integrazione retrovirale e alla scoperta IN inibitori. In questo rapporto, elaboriamo su un test HIV-1 PIC aggiornato che si avvale di un annidato in tempo reale Polymerase Chain Reaction quantitativa (qPCR) strategia basata su per misurare l'attività in vitro integrazione di isolati PIC nativi.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Replicazione dell'HIV-1 nella cella di destinazione prevede più passaggi, in linea di massima raggruppati in due fasi: eventi precoci e tardive. Gli eventi precoci iniziano quando HIV-1 in sequenza si lega alla superficie del recettore cellula bersaglio CD4 e una delle due co-recettori (CCR5 o CXCR4) 1. Di conseguenza, le membrane fusibile virus-cellula, e il capside virale (CA) nucleo viene rilasciato nel citoplasma 2. Il nucleo CA contiene il genomico RNA virale a singolo filamento (ssRNA) e diverse proteine, sia virali e cellulare in origine. Le proteine ​​virali CA-associati includono trascrittasi inversa (RT) e integrasi (IN), due enzimi che mediano passaggi critici durante eventi precoci nella replicazione virale. La RT ed in funzione nel contesto di complessi nucleoproteina, cioè la trascrizione inversa Complex (RTC) e il complesso di pre-integrazione (PIC), rispettivamente 3, 4, 5 <sup>, 6. Le estremità del virale ssRNA genoma porto terminale di ripetizione (R) elementi adiacenti alla unica sequenze U5 (al 5 ') e U3 (al 3'). Il RTC converte il genoma virale ssRNA in un (ds) copia di DNA a doppia elica (vDNA). Questo processo di trascrizione inversa provoca anche la duplicazione delle U5 e U3 sequenze, generando così ripetizioni terminali lunghe (LTR) ad entrambe le estremità del vDNA 7, 8. Successivamente, il IN PIC-associata catalizza due reazioni biochimiche sequenziali che consentono l'integrazione del vDNA nel cromosoma ospite 9, 10, 11. Innanzitutto, nel citoplasma, IN multimeri coinvolgere sia LTR 12 e fendere un dinucleotide da ciascuna delle estremità 3'-terminali. Questa elaborazione 3'-end genera un gruppo ossidrilico ad ogni 3'-end (CA OH) del vDNA.Avanti, PIC traffici al nucleo, in cui IN utilizza il vDNA CA OH come nucleofilo per tagliare entrambi i filamenti di DNA cromosomico in modo sfalsato. Contemporaneamente, IN giunzioni coordinatamente due estremità del vDNA ai legami fosfodiestere risultanti sui filamenti opposti del DNA cromosomico. A seguito di questa fase di trasferimento filone, il macchinario cellula ospite rimuove i due nucleotidi spaiati alle estremità 5 'del vDNA e riparazioni le conseguenti lacune singolo filamento allo svincolo del sito di integrazione. I primi eventi culminano quindi con la creazione di una copia di DNA integrato (provirus) del virus HIV-1 genoma. Il provirus fornisce un ambiente adatto per l'espressione genica virale efficiente, che avvia eventi successivi, compreso l'espressione delle proteine ​​virali codificate; assemblaggio del virus immaturo; e in erba, il rilascio e la maturazione in virioni infettivi 13.

Purificata ricombinante retrovirale IN è competente aeffettuare, in vitro, sia attività di trasformazione e di trasferimento filo 3'-end in modo esogeno forniti LTR-come il DNA substrato. Studi biochimici utilizzando tali ricombinante purificata hanno rivelato aspetti critici vDNA integrazione 14, 15, 16, 17. Tuttavia, a differenza di infezione naturale, questa reazione biochimica in vitro non supporta l'integrazione concertata di entrambe le estremità del DNA substrato nel DNA bersaglio. Al contrario, i PIC retrovirali isolate da cellule con infezione acuta concertata integrano entrambe le estremità della vDNA endogena nel DNA bersaglio eterologo. Ciò ha portato alla diffusa adozione e le successive raffinatezze di saggi in vitro Integration (IVI) I n usando isolati PIC nativi.

Nel primo saggio riportato retrovirale IVI, estratti citoplasmatici di cellule infettate con un murino ricombinanteLeukemia Virus (MLV) ospitare il gene E. coli supF nella sua LTR servito come fonte di attività IN, e il DNA di fago lambda mutante difettoso in crescita litico fu esogenamente forniti come il DNA bersaglio. Successful integrazione del ricombinante MLV DNA copia nel DNA fagico e l'espressione conseguente supF portato al ripristino della capacità di formazione di placca dei fagi ricombinanti. Tuttavia, questa strategia sperimentale è laboriosa e misure di integrazione in maniera indiretta. Per far fronte a tali avvertimenti, un test indiretto end-etichettatura Southern Blot-based, che quantifica l'attività IVI PIC-associata come misura della vDNA endogena integrato in esogeni batteriofago linearizzato phiX174 DNA, è stato sviluppato 6, 7, 18. Anche se questo metodo fornisce una misura diretta di eventi di integrazione, sono necessarie quantità relativamente elevate di preparazione PIC, che rimane tecnicamente difficilesforzo. Per aggirare questo, sono stati sviluppati test basati sulla PCR nested che richiedono solo modeste quantità di PIC 4, 5, 19.

In questo rapporto, descriviamo una versione aggiornata di un nested PCR-based metodo in vitro ideato per ricapitolare l'attività di integrazione di HIV-1 PIC-mediata che si verificano durante l'infezione naturale. Questo metodo utilizza gli estratti citoplasmatici delle cellule bersaglio HIV-1-infetti come fonte di attività PIC endogena, che viene misurata con un tempo reale Polymerase Chain Reaction quantitativa (qPCR). Le procedure per isolare PIC e misurare le loro attività di integrazione sono adattati, con modificazioni, dalla protocolli pubblicati dal laboratorio Engelman 20. In questo metodo, l'attività di integrazione PIC-associato viene avviato fornendo un target DNA esogeno lineari 21, ed i prodotti di DNA risultanti dallaquesta reazione integrazione sono purificate e utilizzato come materiale di partenza per la quantificazione successiva basata sulla PCR. Nel primo turno convenzionale PCR, le giunzioni del DNA virale bersaglio sono amplificati utilizzando primer appropriati. Nel secondo turno qPCR, primer LTR-specifici vengono utilizzati per arricchire specificamente la popolazione vDNA dal primo turno di PCR prodotti. Vedere la sezione protocollo per una descrizione dettagliata di questo metodo.

Studi in vitro con PIC retrovirali hanno portato a significativi progressi nella nostra comprensione del meccanismo di integrazione del DNA retrovirale e nello sviluppo di inibitori IN. Sulla base della recente maggiore attenzione alla mappatura di HIV-1 siti di integrazione, determinare il ruolo dei fattori virali e dell'ospite in HIV-1 integrazione e lo sviluppo di nuovi farmaci antivirali alla lotta contro la resistenza ai farmaci, prevediamo un crescente interesse e l'uso diffuso di IVI saggi , come quello descritto in questa relazione. Questo, a sua volta, porterà afuturi perfezionamenti nel metodo, diversificando in tal modo la portata delle sue applicazioni.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Virus Produzione

NOTA: Per generare alti titoli di contagioso dell'HIV-1, trasfezione la linea cellulare embrionale umano Rene (HEK) 293T con un contagioso dell'HIV-1 clone molecolare utilizzazione di un reagente di trasfezione dendrimeri basati attivato. È stato osservato che il metodo del calcio fosfato trasfezione produce risultati comparabili.

  1. In un laboratorio di biosicurezza di livello 2 (BSL2), semi di 3 x 10 6 293T cellule per 10 centimetri piatto di 8 ml di Modified Eagle Medium di Dulbecco (DMEM) supplementato con 10% siero fetale bovino (FBS), la penicillina, e streptomicina. Cultura le cellule in un incubatore a 37 ° C e 5% CO 2 O / N.
  2. Il giorno successivo, per trasfezione le cellule in ciascun piatto 10 centimetri, diluire 8 mg di DNA plasmidico pNL4-3 (vedi Materiali tabella) per un volume finale di 300 ml di DMEM privo di siero e antibiotici. Aggiungere 80 ml di reagente di trasfezione, mescolare bene pipettando, e incubare a temperatura ambiente per5 - 10 min per la trasfezione formazione del complesso.
  3. Rimuovere il supporto dai piatti tramite aspirazione e aggiungere 7 ml per ogni piatto di DMEM fresco contenente siero e antibiotici.
  4. Aggiungere 1 ml di DMEM contenente siero e antibiotici per il complesso trasfezione, mescolare pipettando, e aggiungere questa miscela alle cellule. Agitare delicatamente il piatto per facilitare la distribuzione uniforme dei complessi trasfezione.
  5. Trasferire immediatamente le cellule in laboratorio BSL3, posto in un incubatore a 37 ° C e 5% CO 2, e coltivare le cellule per 48 h.
  6. Raccogliere il tessuto surnatante cultura virus contenenti con una pipetta e poi trasferirlo in una provetta da centrifuga. Centrifugare a 300 xg per 5 minuti per far sedimentare le cellule e detriti, e poi filtrare il surnatante attraverso un filtro siringa da 0,45 micron pori di dimensioni.
  7. Per eliminare ogni DNA plasmidico riporto in questa preparazione privo di virus-cellula, trattare con DNasi 1 (20 mg / ml) a 37 ° C per 1 h.
  8. Per quantificare laHIV-1 titolo, utilizzare la specifica-p24 immunoenzimatico (ELISA), in quanto è un metodo rapido e sensibile per l'uso di routine 22.
    NOTA: Si deve notare che la p24 ELISA misura il titolo fisica (numero di particelle virali). In alternativa, misurando l'attività associata al virus RT (saggio RT esogena) o infettività del virus (test di infettività basati linea cellulare spia TZM-bl) fornirà lettura esclusiva di particelle virali infettive.

2. Infezione da virus di cellule Sup-T1 (BSL3 Lab)

  1. In un laboratorio BSL2, mantenere le cellule Sup-T1 tra 1,0 x 10 6 e 2.0 x 10 6 cellule / ml in Roswell Park Memorial Institute (RPMI) medium supplementato con 10% inattivato al calore FBS, penicillina e la streptomicina (rapporto di divisione di 1 : 2 ogni 2 - 3 d). Pool le cellule Sup-T1 dalle fiasche di coltura, mescolare bene pipettando, e determinare il numero di cellule vitali utilizzando un emocitometro e trypan blu stMetodo aining.
    1. Preparare il numero richiesto di aliquote di 80 x 10 6 cellule (per infezione virale) in 50 provette coniche centrifuga mL.
    2. Centrifugare le cellule in un rotore oscillante secchio a 500 xg e 25 ° C per 5 min. Senza rimuovere il mezzo di coltura cellulare, trasferire le provette contenenti cellule in pellet al laboratorio BSL3 per ulteriori elaborazioni. Con attenzione aspirare il terreno di coltura cellulare dal tubo senza disturbare il pellet.
  2. Aggiungere una quantità appropriata di inoculo virus DNasi I trattati per le cellule nel tubo e mescolare bene delicatamente pipettando. Per 80 x 10 6 celle, utilizzare 30 ml di virus DNasi I-trattati (50 mg di virus p24-equivalente).
    NOTA: L'isolamento del PIC funzionale richiede di infettare le cellule bersaglio con altissime molteplicità di infezione (MOI).
  3. Distribuire il composto in modo uniforme tra due piastre di coltura tissutale 6 pozzetti (cioè 12 aliquote x 2,5 mL; utilizzare 2 piastre per infettareion).
  4. Per spinoculation, posizionare le piastre di coltura nei portatori piastra e centrifugare con un rotore secchio oscillante a 480 xg e 25 ° C per 2 ore.
  5. Incubare le cellule spinoculated a 37 ° C e 5% CO 2 per 5 ore.

3. Raccolta e lisi delle cellule infette (BSL3 lab)

  1. In comune le celle corrispondenti ad ogni infezione dalle piastre di coltura in una provetta da 50 ml centrifuga (~ 30 ml in totale).
  2. Raccogliere le cellule per centrifugazione a 300 xg e 25 ° C per 10 min. Con attenzione aspirare il surnatante dal tubo (in alternativa, utilizzare una pipetta).
  3. Per rimuovere eventuali particelle virali residui, lavare ciascun pellet cellulare aggiungendo 2 mL di tampone K - / - (150 mM KCl, 20 mM HEPES, pH 7,6, 5 mM MgCl 2) e centrifugazione del campione a 300 xg e 25 ° C per 10 minuti. Poi, senza disturbare il pellet, rimuovere con attenzione il surnatante tramite aspirazione o utilizzando una pipetta.
  4. ripett passo 3.3.
  5. Rimuovere con cura qualsiasi residuo di tampone utilizzando una micropipetta. Risospendere ogni pellet di cellule in 2 ml di ghiacciata tampone di lisi K + / + (Buffer K - / - integrata con 0,025% digitonina, 1 mM DTT, 20 mg / ml aprotinina), mescolare il contenuto di delicato pipettaggio, e versare in un 2 ml provetta.

4. Preparazione del PIC citoplasmatici (BSL3 lab)

  1. Rock the campioni su un agitatore rotante a temperatura ambiente per 10 min.
  2. Centrifugare i campioni, con il rotore preraffreddato a 4 ° C, a 1.500 xg e 4 ° C per 4 min.
  3. Senza disturbare il pellet, trasferire accuratamente il surnatante in una provetta fresco e centrifugare a 16.000 xg e 4 ° C per 1 min.
  4. trasferire con cautela il surnatante in una provetta fresca. Aggiungere RNasi A (20 mg / ml) ad una concentrazione finale di 20 mg / ml (2 microlitri per 2 mL di PIC) e incubare i contenuti a ta per 30 min (senza dondolo). </ Li>
  5. Aggiungere saccarosio (60% w / v in tampone K - / -) ad una concentrazione finale del 7% e mescolare bene delicatamente pipettando. Preparare aliquote (ad esempio, 200 ml) dei PIC in tubi microcentrifuga, flash-congelamento in azoto liquido, e mettere in un -80 ° C per una conservazione a lungo termine.

5. In Vitro Integration (IVI) Assays Utilizzando HIV-1 PIC

  1. Preparare il DNA bersaglio usato nel saggio IVI amplificando una regione 2,0 kb dal plasmide DNA phiX174 con PCR usando primer su misura, phiX174-F e phiX174-R.
    1. Assemblare la miscela di PCR come descritto nella Tabella 1. Eseguire la PCR in un termociclatore base alle condizioni di ciclo termico raccomandate in Tabella 2. Gel-purificare il prodotto di PCR utilizzando un kit di gel-purificazione (seguendo il protocollo consigliato dal produttore), e memorizzare il DNA bersaglio purificato come aliquote a -80 ° C fino al momento dell'uso.
  2. Aggiungere 600 ng di DNA bersaglio a 200 - & #181; L aliquota di PIC, mescolare bene, e incubare a 37 ° C per 45 min.
    Nota: Le reazioni IVI omettendo DNA bersaglio o tra un inibitore dell'integrasi (ad esempio, raltegravir) sono reazioni di controllo raccomandati.
  3. Arrestare la reazione IVI con l'aggiunta di SDS, EDTA e proteinasi K a concentrazioni finali di 0.5%, da 8 mm e 0,5 mg / ml, rispettivamente. Mescolare il contenuto di reazione a fondo e incubare una notte a 56 ° C.
  4. Il giorno successivo, purificare il DNA totale dalla reazione IVI da fenolo / estrazione cloroformio e precipitazione in etanolo. Eseguire tutte le fasi di centrifugazione a 16.000 xg e RT.
  5. Aggiungere un volume uguale di fenolo al campione deproteinizzato, mescolare vigorosamente su vortex e centrifugare per 2 min. Rimuovere con attenzione la fase acquosa superiore e trasferirlo in una nuova provetta.
  6. Ripetere il punto 5.5. Trasferire la fase acquosa superiore in una nuova provetta.
  7. Aggiungere un uguale volume di 1: 1 di fenolo: miscela di cloroformio, agitare vigorosamente su vortex e centrifugare for 2 min. Trasferire la fase acquosa superiore in una nuova provetta.
  8. Aggiungere un uguale volume di cloroformio, agitare vigorosamente con vortex e centrifugare per 2 min. Trasferire la fase acquosa superiore in una nuova provetta.
  9. Per precipitare DNA, aggiungere glicogeno ad una concentrazione finale di 0,1 mg / mL, 3 M di acetato di sodio ad una concentrazione finale di 0,3 M e 2,5 volumi di etanolo 100% (ghiacciata). Vortex per miscelare, centrifugare brevemente per raccogliere il contenuto, e posizionare il tubo a -80 ° CO / N.
  10. Il giorno successivo, centrifugare il campione per 30 minuti a 16.000 xg e 4 ° C per 30 min. rimuovere con attenzione il surnatante senza disturbare il pellet.
  11. Aggiungere 500 ml di etanolo all'80% (ghiacciata) al pellet e centrifugare a 16.000 xg e 4 ° C per 10 min. Far asciugare il pellet di DNA a temperatura ambiente e accuratamente risospendere in 50 ml di acqua priva di nucleasi. Conservare i campioni di DNA a -20 ° C.

6. PCR per quantificare PIC Activity

  1. Eseguire il primo turno convenzionale PCR usando primer di targeting (rispettivamente LTR e phiX174 primer,) la LTR virale e il DNA phiX174 per amplificare le giunzioni del virus HIV-1 DNA integrato.
    1. Montare la miscela primo turno di PCR, come descritto nella tabella 3. Assemblare un master mix di tutti i componenti ad eccezione del DNA stampo, dispensare aliquote di 45 microlitri in tubi PCR separati, e aggiungere 5 ml di stampo di DNA o di acqua priva di nucleasi (controllo).
    2. Eseguire la PCR in un termociclatore base alle condizioni di ciclo termico raccomandate in Tabella 4.
  2. Eseguire il secondo turno qPCR utilizzando primer che fiancheggiano una breve regione del LTR virale (LTR-R e primer LTR-U) per amplificare selettivamente le sequenze vDNA integrati dal primo-roprodotti und PCR. Per determinare i vDNA integrati copia numeri, generare una curva standard utilizzando 10x diluizioni seriali numero di copie noto (ad esempio, 10 0 - 10 8) del clone molecolare di HIV-1.
    1. Montare la miscela secondo turno qPCR come descritto nella Tabella 5. Assemblare un master mix di tutti i componenti ad eccezione del DNA stampo, con attenzione a meno di 25 aliquote microlitri nel numero appropriato di pozzi in un pozzo 96 piastra di reazione PCR e aggiungere 5 ml di non purificata primo turno di PCR prodotti o acqua priva di nucleasi (controllo). Eseguire tutte le reazioni qPCR in triplice copia.
    2. Caricare la lastra PCR nello strumento PCR in tempo reale ed eseguire qPCR base alle condizioni di ciclo raccomandate in Tabella 6.
    3. Analizzare i dati utilizzando un software adatto.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'isolamento del virus HIV-1 PIC

Uno schema del protocollo usato per l'isolamento del virus HIV-1 PIC da cellule SUP-T1 infezione acuta è illustrato in Figura 1. Questo protocollo è derivato dai metodi descritti da Engelman et al. 19, 20. HIV-1 PIC sono complessi nucleoproteici che vengono assemblati nelle cellule infette e sono composti del vDNA reverse-trascritte, proteine virali e fattori cellulari 19, 20. Il metodo descritto nella presente relazione utilizza gli estratti citoplasmatici delle cellule HIV-1-infetti come fonte di attività di integrazione PIC-associata.

In attività di integrazione vitro di HIV-1 PIC

figura 2. Questo metodo utilizza una strategia nested qPCR-based per misurare l'attività IVI PIC-associata, e le procedure sono adattate, con modificazioni, dalla protocolli pubblicati dal laboratorio Engelman 19, 20, 21. In questo metodo, l'attività di integrazione PIC-associato viene avviato fornendo un target DNA eterologo lineari 21, ed i prodotti di DNA risultanti da questa reazione integrazione sono purificati e utilizzato come materiale di partenza per la quantificazione successiva basata sulla PCR. Nel primo turno convenzionale PCR, le giunzioni del DNA virale bersaglio sono amplificati utilizzando primer appropriati. Nel secondo turno qPCR, primer LTR-specifici vengono utilizzati per arricchire specificamente la popolazione vDNA dal primo turno di PCR prodotti. Si prega di consultare il protocollo sezione per una descrizione dettagliata di questo metodo.

Risultati rappresentativi da un test IVI eseguiti utilizzando HIV-1 PIC sono mostrati nella Figura 3. Cellule SUP-T1 (80 x 10 6 cellule / infezione) sono stati spinoculated con 30 ml di DNasi 1-trattata HIV-1 (~ 50 mg di p24 equivalente) in assenza o presenza di 1 mM HIV-1 IN inibitore Raltegravir a 480 xg e 25 ° C per 2 h. Le cellule sono state poi coltivate per 5 ore a 37 ° C e 5% CO 2. PIC sono stati isolati come descritto nella sezione del protocollo. Le reazioni sono state condotte IVI, ciascuno utilizzando 200 ml di PIC e 600 ng del DNA bersaglio (un frammento di DNA 2 kb amplificato da phiX174 DNA mediante PCR), a 37 ° C per 45 min. Le reazioni sono state deproteinizzato mediante proteinasi K trattamento in presenza di SDS e EDTA a 56 ° CO / N. I prodotti di reazione sono stati estratti due volte con fenolo, una volta con fenolo: cloroformio (1: 1) della miscela, e una voltacon cloroformio. Successivamente, il DNA è stato precipitato con etanolo in presenza di sale e il glicogeno co-precipitante, e il pellet di DNA è stato lavato una volta con etanolo 80%. Il DNA purificato è stato risospeso in 50 ml di acqua priva di nucleasi. Una strategia nested qPCR stata utilizzata per determinare il numero di vDNA integrato nel DNA phiX174. Nel primo turno convenzionale PCR, primer complementari alle sequenze sul DNA bersaglio phiX174 e virali regione LTR sono stati usati per amplificare le giunzioni del DNA virale bersaglio integrati da 5 ml dei prodotti di reazione del DNA integrazione. Nel secondo turno qPCR, primer LTR-spanning sono stati utilizzati per amplificare esclusivamente le sequenze di HIV-specifiche DNA da 5 ml di primo turno prodotti ampliconi e da 10 diluizioni seriali del numero di copie noto (10 8 -10 0) del clone molecolare di HIV-1 (Standards).

Tutte le reazioni qPCR sono stati eseguiti in triplicato ei dati Were analizzati utilizzando il software commerciale. I valori derivati ​​dalle norme sono state tracciate per generare una curva standard, i numeri sono stati interpolati da cui i vDNA integrate di copia. barre di errore rappresentano deviazioni standard. Come mostrato nella figura 3, i PIC HIV-1 robustamente integrano l'vDNA associato nel DNA bersaglio (Lane 5). È importante sottolineare che l'efficienza IVI di PIC è stato notevolmente ridotto nelle reazioni integrati con l'inibitore IN Raltegravir (Lane 6). Questo attribuisce fortemente l'attività di integrazione misurata in questo test per l'HIV-1 IN. Inoltre, le reazioni di controllo contenenti lisati citoplasmatici di cellule non infette (corsia 1), da soli PIC (corsia 2), DNA bersaglio da solo (Lane 3), e buffer da solo (corsia 4) non ha mostrato alcuna attività di integrazione. Inoltre, il controllo che esclude Taq polimerasi nel primo turno PCR (Lane 7) non amplificare prodotti di integrazione. In particolare, i dati dal PIC-alone di controllo (corsia 2) hanno indicato che la strategia nidificato specifi qPCRcamente misura integrato vDNA ma non il vDNA PIC-associata. Collettivamente, questi dati dimostrano la misurazione delle attività di integrazione PIC-associata.

Figura 1
Figura 1: Rappresentazione schematica del protocollo per la preparazione di HIV-1 PIC. Clicca qui per vedere una versione più grande di questa figura.

estratti citoplasmatici contenenti PIC sono isolati dalle cellule Sup-T1 HIV-1-infetti. Questi PIC sono utilizzati come fonte di attività di integrazione nel saggio integrazione in vitro.

figura 2
Figura 2: Rappresentazione schematica del in Vitro m> Integrazione Assay dell'infezione da HIV-1 PIC. Clicca qui per vedere una versione più grande di questa figura.

Saggi di integrazione sono state effettuate in vitro mediante HIV-1 PIC e la porta eterologa phiX174 DNA. L'HIV-1 DNA integrato è stata misurata mediante una strategia PCR nested, in cui il primo turno convenzionale PCR amplifica le giunzioni di integrazione da cui sequenze vDNA-specifici sono preferenzialmente amplificati in un secondo turno qPCR.

Figura 3
Figura 3: HIV-1 PIC-associati vDNA integrazione di attività. Clicca qui per vedere una versione più grande di questa figura.

"Fo: together.within-page keep-=" 1 "> risultati rappresentativi del saggio di attività di integrazione di HIV-1 PIC-associati I vDNA integrati copiare i numeri sono stati determinati tracciando valori derivati ​​da una curva standard generata utilizzando 10x diluizioni seriali di. conosciuti numero di copie di un clone molecolare di HIV-1. Tutte le reazioni sono state eseguite in triplicato ed i dati sono stati analizzati utilizzando il software commerciale. barre di errore rappresentano la deviazione standard.

Componente Azione Volume finale di reazione di 50 microlitri
phiX174 plasmide DNA 10 ng / ml 5.0 ml
tampone di reazione GoTaq 5x 10,0 ml
mix nucleotide dNTP 10 mm Ogni 1,0 ml
phiX174-F Primer 10 mM 2,5 ml
phiX174-R Primer 10 mM 2,5 ml
GoTaq DNA polimerasi (5 U / mL) 0,25 ml
acqua distillata priva di nucleasi - 28.75 ml

Tabella 1.

95 ° C = 2 min
Ciclo di 34 ripetizioni di:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 min
4 ° C = attesa

Tavolo 2.

Componente Azione Volume finale di reazione di 50 microlitri
IVI prodotto di DNA di reazione - 5.0 ml
tampone di reazione GoTaq 5x 10,0 ml
mix nucleotide dNTP 10 mm Ogni 1,0 ml
LTR Primer 10 mM 2,5 ml
phiX174 Primer 10 mM 2,5 ml
GoTaq DNA polimerasi (5 U / mL) 0,25 ml
acqua distillata priva di nucleasi - 28.75 ml

Tabella 3.

95 ° C = 5 min
Ciclo di 23 ripetizioni di:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 min
4 ° C = attesa

Tabella 4.

<td> Sonda Taqman
Componente Azione Volume finale di reazione di 30 microlitri
1 prodotti di PCR rotonda st - 5.0 ml
LTR-R Primer 10 mM 0,9 ml
LTR-U Primer 10 mM 0,9 ml
10 mM 0,3 ml
iQ Supermix 2x 15.0 ml
acqua distillata priva di nucleasi - 7.9 ml

Tabella 5.

95 ° C = 3 min
Ciclo di 39 ripetizioni di:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
piastra Leggi

Tabella 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

analisi biochimiche di PIC retrovirali hanno fornito spunti critici nel meccanismo di integrazione del DNA retrovirale. Misurazione dell'attività integrazione dei PIC retrovirali può essere ottenuto mediante saggio di placca formazione, analisi Southern blot, e nested qPCR. La strategia sperimentale del saggio di placca è laboriosa e utilizza un metodo indiretto per misurare integrazione 6, 7, 18. Southern integrazione test misura macchia-based direttamente, ma richiedono quantità relativamente elevate di PIC 6, 7, 18.

La presente relazione illustra una strategia annidato qPCR per la misurazione di HIV-1 attività di integrazione PIC-associata in vitro. Il principale vantaggio e il significato di questo metodo è il requisito di relativamente piccole quantità di preparazione PIC per reazione 4, 5, 19. Le fasi più critiche di questo metodo sono la generazione di un virus alto titolo di infezione e il trattamento di preparazione PIC. Si deve notare qui, che il primo round di PCR coinvolge l'amplificazione esponenziale delle giunzioni di integrazione. Di conseguenza, i numeri di copie di integrato vDNA di cui al secondo turno qPCR sono semi-quantitativa e, di conseguenza, hanno il limite di non dare una misura di copie vDNA PIC-associata. Tuttavia, il vDNA PIC-associato può essere determinato qPCR del DNA purificato da PIC con primer LTR-specifici. Il rapporto tra i vDNA integrati copiare i numeri al corrispondente vDNA PIC-associate in grado di fornire informazioni circa l'efficienza integrazione di un vitro reazione integrazione. Questo metodo può essere modificato incorporando altro DNA bersaglio eterologo di scelta e altri primer per rilevare integrazione a entrambi gli orientamenti. In sintesi, il metodoqui descritta misura dell'attività integrazione di HIV-1 PIC quantitativamente e può essere adottato per ricerca sviluppando una comprensione dei dettagli biochimici di integrazione retrovirale.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano interessi finanziari e non finanziari concorrenti.

Acknowledgments

Questo lavoro è in parte sostenuto da sovvenzioni DA024558, DA30896, DA033892, e DA021471 dal NIDA / NIH su CD. Riconosciamo inoltre la concessione G12MD007586 RCMI, la Vanderbilt CTSA concedere UL1RR024975, il Meharry Translational Research Center (MeTRC) CTSA concessione U54 RR026140 dal NCRR / NIH, l'U54 concessione MD007593 dal NIMHD / NIH, e il Tennessee CFAR concessione P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Misurazione<em&gt; In Vitro</em&gt; Integrazione di attività del virus HIV-1 preintegrazione Complessi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter