Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Ölçümü doi: 10.3791/54581 Published: February 22, 2017

Abstract

HIV-1 kaplama proteinleri sitoplazmaya Viral kapsid (CA) çekirdeğin serbest ardından viral hücre zarı birleşmesine yol açar, hedef hücre yüzeyi üzerinde aynı kökenli reseptörleri girerler. Daha sonra, viral ters transkriptazı (RT), bir adaşı nükleoprotein kompleksinin bir parçası olarak karmaşık Ters Transkripsiyon (RTC), çift iplikçikli bir DNA kopyasını (vDNA) viral tek iplikli RNA genomunu dönüştürür olarak adlandırılır. Bu, başka bir nukleoprotein kompleksinin biyogeneze açar, vDNA ve ilişkili virüs proteinleri ve konak faktörlerinin oluşan ön entegrasyon kompleksi (PIC) olarak adlandırılan. PIC-ilişkili viral integraz (İN), bir geçici ve mekansal olarak düzenlenmiştir, iki aşamalı bir işlemde konak kromozomal DNA içine vDNA entegrasyonunu yönetir. İlk olarak, PIC çekirdeğine trafik işlemlerini sonra, kromozomal DNA içine işlenmiş vDNA entegrasyonunu aracılık ikinci sitoplazmada vDNA 3 'uçları işler ve. PIC izolebunlar, bir eksogen olarak ilave heterolog hedef DNA'ya ilişkili vDNA entegre yetkinliğe sahip olan akut HIV-1 ile enfekte edilmiş hedef hücrelerden in vitro fonksiyonel. Böyle bir PIC tabanlı in vitro entegrasyon tayinlerde anlamlı retroviral entegrasyon mekanik ayrıntılarını ortaya koymayı amaçlayan ve inhibitörleri IN keşfetmek katkıda bulunmuştur. Bu yazıda, izole yerli PIC in vitro entegrasyon aktivitesini ölçmek için iç içe geçmiş bir gerçek zamanlı kantitatif Polimeraz Zincir Reaksiyonu (qPCR) tabanlı bir strateji benimseyerek güncelleştirilmiş bir HIV-1 PIC tahlil üzerine ayrıntılı.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Erken ve geç olayların: hedef hücre içinde, HIV-1 replikasyon genel olarak iki faza gruplanmış birden fazla aşamasını içerir. HİV-1, sırasıyla, hedef hücre yüzeyi reseptörü, CD4 ve iki ko-reseptörleri (CCR5 ya da CXCR4) 1 birine bağlandığı zaman, erken olayları başlar. Sonuç olarak, virüs-hücre membranları sigorta ve viral kapsid (CA), çekirdek sitoplazmaya 2 salınır. CA temel viral ve kaynaklı hücresel hem de viral genomik tek şeritli RNA (ssRNA) ve çeşitli proteinleri içerir. CA-ilişkili viral proteinler ters transkriptaz (RT) ve integraz (İN), viral replikasyon erken olaylan sırasında kritik adımları aracılık iki enzimler bulunmaktadır. RT ve nükleoprotein kompleksleri, yani ters transkripsiyon kompleksi (RTC) ve ön-uyum kompleksi (PIC), sırasıyla, 3, 4, 5 kapsamında işlevin <sup>, 6. '(Sonunda 3'ün at) (sonu ve U3 viral ssRNA genom liman terminal tekrarı (R) 5' ucunda) 'eşsiz dizileri U5 bitişik elemanları biter. RTC çift-şeritli (ds) DNA kopyasını (vDNA) viral ssRNA genomu dönüştürür. Bu ters transkripsiyon işlemi, bu şekilde vDNA 7, 8 her iki ucunda uzun terminal tekrarları (LTR) üretilmesi, U5 ve U3 dizilerinin çoğaltılması ile sonuçlanır. Daha sonra, PIC-ilişkili IN konukçu kromozom 9, 10, 11 içine vDNA entegrasyonunu sağlayan iki sıralı biyokimyasal reaksiyonları katalize eder. İlk olarak, sitoplazmada, multimerler her iki LTR 12 meşgul ve 3'-terminal uçlarının her birinden bir dinükleotid bölmektedir. Bu 3'-uç işleme, her 3'-ucunda vDNA (Ca OH) bir hidroksil grubu oluşturur.Zikzaklı bir şekilde kromozomal DNA'nın her iki kolunu kesmek için bir nükleofil olarak OH vDNA CA; buradaki sonra, PIC çekirdeğe trafik işlemlerini gerçekleştirir. Aynı zamanda, İN koordineli kromozomal DNA karşı sarmalda elde fosfodiester bağlarına vDNA her iki ucunu birleşim yerlerinin. Bu şerit transferi adımından sonra, konak hücre makine entegrasyonu sitenin kavşakta 5 'vDNA uçlarına ve onarım takip eden tek sarmallı boşluklar iki eşleşmemiş nükleotidleri kaldırır. Erken olaylar dolayısıyla HIV-1 genomunun entegre DNA kopyası (provirus) kurulmasıyla sonuçlanacak. Provirüs virüs kodlanmış proteinlerin ekspresyonu dahil olmak üzere, daha sonraki olayları başlattığı etkin viral gen ekspresyonu için uygun bir ortam sağlar; olgunlaşmamış virüs montaj; ve bulaşıcı virionlar 13 içine tomurcuklanma, serbest ve olgunlaşma.

Saflaştırılmış rekombinant retroviral IN yetkili olduğunuin vitro, yürütmek, hem 3'-uç işleme ve iplik aktarma faaliyetleri Eksojen LTR-benzeri DNA ana madde sağladı. Arıtılmış yeniden birleştirici kullanarak biyokimyasal çalışmalar, vDNA entegrasyonu 14, 15, 16, 17 kritik yönleri ortaya koymuştur. Bununla birlikte, doğal enfeksiyon farklı olarak, bu in vitro biyokimyasal reaksiyon, hedef DNA'ya alt-tabaka DNA'nın her iki ucundan ortak entegre desteklemez. Bunun aksine, akut olarak enfekte olan hücrelerden izole retroviral PIC concertedly heterolog hedef DNA'ya endojen vDNA her iki ucunu birleştirmek. Bu izole yerli Pics kullanarak yaygınlaşmasının ve ben n Vitro Entegrasyonu (IVI) deneyleri sonraki iyileştirmelere yol açtı.

İlk olarak retroviral IVI deneyi, bir rekombinant sıçan ile enfekte edilmiş hücrelerden alınan sitoplazmik özler raporBunu LTR E. coli supF genini barındıran Lösemi Virüsü (MLV) aktivite kaynağı ve litik büyüme hatalı dışsal, hedef DNA olarak verilen bir mutan lambda faj DNA olarak görev yaptı. rekombinant DNA MLV Başarılı entegrasyon faj DNA kopyalamak ve supF takip eden ifade rekombinant faj plak oluşturan yeteneğini restorasyonu yol açtı. Bununla birlikte, bu deneysel strateji dolaylı şekilde zahmetli ve önlemler entegrasyondur. Bu uyarılar gidermek için, eksojen doğrusallaştırılmış bakteriyofaj phiX174 DNA'sına entegre endojen vDNA bir ölçüsü olarak, PIC ilişkili IVI aktivitesi nicelleştiren bir Güney benek tabanlı dolaylı uç işaretleme analizi, 18 7, 6 geliştirilmiştir. Bu yöntem entegrasyon olayların doğrudan ölçüsünü verir rağmen, PIC hazırlık nispeten yüksek miktarlarda teknik olarak oldukça zor kalır, gerekligayret. Bu aşmak için, PIC bölgesinin sadece az miktarda gereken iç içe PCR bazlı deneyler, 19 5, 4 geliştirilmiştir.

Bu yazıda güncelleştirilmiş bir sürümünü tanımlayan bir iç içe doğal enfeksiyon sırasında meydana gelen HIV-1 PIC-aracılı entegrasyon faaliyeti özetlemek için tasarlanmış in vitro yöntem PCR tabanlı. Bu yöntem, bir gerçek zamanlı kantitatif Polimeraz Zincir Reaksiyonu (qPCR) ölçülen endojen PIC aktivite kaynağı olarak, HİV-1 ile enfekte edilmiş hedef hücrelerin sitoplazmik özler kullanılır. Onların entegrasyon faaliyetlerini PICS izole ve ölçmek için prosedürler Engelman laboratuvar 20 tarafından yayınlanan protokollerden, değişikliklerle, adapte edilir. Bu yöntemde PIC ilişkili entegrasyon aktivitesi eksojen bir doğrusal hedef DNA 21 ve elde edilen DNA ürünleri temin edilmesiyle başlatılırBu entegrasyon, reaksiyon saf hale getirilir ve daha sonra, PCR tabanlı bir miktar tayini için başlangıç ​​malzemesi olarak kullanılır. Birinci turda, geleneksel PCR, viral hedef DNA, kavşaklar, uygun primerler kullanılarak yükseltilir. ikinci turda qPCR, LTR-özel primerler, özellikle ilk tur PCR ürünlerinden vDNA popülasyonu ettirecek kullanılır. Bu yöntemin ayrıntılı bir açıklama için protokol bölümüne bakın.

Retroviral PIC ile in vitro çalışmalar retroviral DNA entegrasyon mekanizması anlayışımızda ve IN inhibitörlerinin gelişiminde önemli ilerlemelere yol açmıştır. HIV-1 entegrasyon viral ve konak faktörlerin rolünü belirlemek ve ilaç direncini mücadele yolunda yeni antiviral ilaçlar geliştirmek, haritalama, HIV-1 bütünleşme sitelerinde son artan odak dayanarak, IVI deneylerinin bir artış ilgi ve yaygın kullanımı tasavvur Bu raporda açıklanan gibi. Bu da, yol açacaktıryönteminde gelecek iyileştirmeler, böylece onun uygulamalarının kapsamını çeşitlendirilmesi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Virüs Üretimi

Not: bulaşıcı HIV-1'in yüksek titrelerini üretmek bir aktive dendrimer bazlı transfeksiyon reaktifi kullanarak bir enfeksiyon, HIV-1, moleküler klon, insan embriyonik böbrek (HEK) hücre çizgisi 293T transfekte etmek. Kalsiyum fosfat transfeksiyon yöntemi karşılaştırılabilir sonuçlar verir gözlenmiştir.

  1. Bir Biyolojik Güvenlik Seviye 2 (BSL2) Laboratuarda, tohum, 8 10 cm tabak başına 3 x 10 6 293T hücreleri mL% 10 fetal sığır serumu (FBS), penisilin ve streptomisin ile takviye edilmiş Dulbecco Modified Eagle Medium (DMEM) içinde. Kültür, bir 37 ° C 'ye ayarlanmış inkübatör ve% 5 hücreleri CO2 O / N.
  2. Sonraki gün, her biri 10 cm tabak hücreleri transfekte etmek için, serum ve antibiyotik yoksun DMEM 300 uL nihai hacim pNL4-3 plazmid DNA (bakınız Materyaller Tablo) 8 ug seyreltin. Transfeksiyon reaktifi 80 mcL pipetleme iyice karıştırın ve oda sıcaklığında inkübe5 - transfeksiyon kompleksi oluşumu için 10 dakika.
  3. Aspirasyon ile yemeklerin orta çıkarın ve serum ve antibiyotik içeren taze DMEM çanak başına 7 mL ekleyin.
  4. Transfeksiyon kompleksi DMEM içeren serum ve antibiyotik 1 ml ekleyin pipetleme karışım ve hücreler bu karışıma ekleyin. Yavaşça transfeksiyon komplekslerinden eşit dağılımını kolaylaştırmak için çanak girdap.
  5. Hemen, 48 saat boyunca hücre CO2, 37 ° C ve% 5 ayarlanmış bir kuluçka makinesi içinde BSL3 laboratuar yerde hücreleri transferi, ve kültür.
  6. bir pipet kullanılarak virüs içeren bir doku kültür süpernatant toplamak ve daha sonra bir santrifüj tüpüne transfer. 5 dakika boyunca 300 x g'de santrifüj hücreleri ve yıkıntıları pelet haline, ve daha sonra bir 0.45 mikron gözenek boyutlu şırınga filtre ile süpernatant filtre.
  7. Bu hücresiz virüsü hazırlanmasında herhangi bir devir plazmid DNA ortadan kaldırmak için 1 saat süreyle 37 ° C 'de DNase 1 (20 ug / ml) ile tedavi edilir.
  8. ölçmek içinBu rutin kullanım 22 için hızlı ve müsait yöntem olarak, HİV-1 titre, p24-özel enzim bağlı immünosorbent deneyi (ELISA) kullanın.
    Not: p24 ELISA fiziksel titresi (virüs parçacıklarının sayısı) ölçen Belirtilmelidir. Seçenek olarak ise, virüs ilişkili RT aktivitesi (ekzojen RT deneyi) veya virüs enfeksiyonu (tzm-BL endikatör hücre hattı bazlı enfekte deneyleri) ölçüm enfeksiyonlu virüs parçacığı özel olarak okunmasını sağlayacaktır.

Sup-T1 Hücreleri 2. Virüs Enfeksiyonu (BSL3 Lab)

  1. Bir BSL2 Laboratuarda, 1 6 ila 10 x 10 x 1,0 ile 6 ve 2.0 hücre / Roswell Park Memorial Institute (RPMI),% 10 ısı ile inaktive edilmiş FBS, penisilin ile desteklenen ortamda ve streptomisin mL (bölünme oranı Sup-T1 hücreleri korumak : 2 her 2-3 d). , Kültür şişeler Sup-T1 hücreleri havuz pipetle iyice karıştırın ve bir hemasitometre ve tripan mavisi dışlama st kullanarak canlı hücre sayısını belirlemekyöntemi Aining.
    1. 50 ml konik santrifüj tüpleri içinde (virüs enfeksiyonu başına) 80 x 10 6 hücre hacimde gerekli sayıda hazırlayın.
    2. 500 xg bir sallanan kepçeli rotor hücreleri santrifüj ve 5 dakika boyunca 25 ° C. Hücre kültürü ortamı çıkarmadan daha fazla işlem için BSL-3 laboratuara tanelenmiş hücreler ihtiva eden tüpler aktarın. Dikkatle hücre pelletini bozmadan tüpten hücre kültür ortamı aspire.
  2. tüp içinde hücrelere DNase I ile tedavi edilen virüs aşı maddesi, uygun bir miktarda eklenir ve yavaşça pipetleme ile iyice karıştırın. 80 x 10 6 hücre için, DNase I ile tedavi edilen virüs (P24 eşdeğer virüsün 50 ug), 30 mL kullanımı.
    Not: Fonksiyonel PIC izolasyonu enfeksiyonun yüksek çokluklar ile (MOI) hedef hücreleri enfekte gerektirir.
  3. Eşit, yani iki adet 6 oyuklu doku kültür plakaları (12 x 2.5 ml alikotları arasındaki karışım dağıtın, Infect başına 2 tabak kullanıniyon).
  4. spinoculation için, sallanan bir kova 480 xg'de rotor ve 2 saat 25 ° C ile plakası taşıyıcılar ve santrifüj kültür plakaları yerleştirin.
  5. 5 saat boyunca CO2 37 ° C'de spinoculated hücreleri inkübe ve% 5.

Enfekte Hücre 3. Hasat ve Lizis (BSL3 lab)

  1. 50 ml konik santrifüj tüpüne kültür plakalarından her enfeksiyona karşı gelen hücreler (~ toplam 30 mL) havuz.
  2. 300 x g'de santrifüj ile hücreler hasat edilir ve 10 dakika için 25 ° C. Dikkatle tüpten aspire (alternatif, bir pipet kullanın).
  3. Herhangi bir artık viral partikülleri çıkarmak için, tampon K 2 mL eklenerek her bir hücre pelletini yıkama - / - (150 mM KCI, 20 mM HEPES, pH 7.6, 5 mM MgCI2) ve 300 x g hızında numune ve 25 ° C sıcaklıkta santrifüj 10 dakika. Sonra, pelet bozmadan özenle aspirasyon veya bir pipet kullanarak süpernatant kaldırmak.
  4. Repeat adım 3.3.
  5. Dikkatlice mikropipet kullanarak herhangi bir kalıntı tampon kaldırmak. Buz soğukluğunda parçalama tamponu K 2 mL her bir hücre pelletini + / + (Tampon K - / -% 0.025 digitonin, 1 mM DTT, 20 ug / ml aprotinin ile takviye edilmiş), nazik bir pipetleme ile karıştırın ve transfer 2 ml mikrosantrifüj tüpü.

Sitoplazmik PIC 4. Hazırlama (BSL3 lab)

  1. 10 dakika boyunca oda sıcaklığında bir döner çalkalayıcıda örnekleri sallayın.
  2. 1.500 x g'de 4 ° C'ye soğutulmuş, rotor, numuneler santrifüj ve 4 dakika için 4 ° C.
  3. pelet bozmadan, dikkatli bir şekilde 16,000 xg'de taze mikrosantrifüj tüpü ve santrifüj süpernatantı transfer ve 1 dakika boyunca 4 ° C.
  4. Dikkatle taze mikrosantrifüj tüp süpernatantı aktarın. 30 dakika (Resim sallanan), oda sıcaklığında ve içeriği 20 mg / ml (PIC 2 mL 2 uL) bir son konsantrasyona kadar, RNaz A (20 mg / ml) ilave edin ve inkübe edilir. </ Li>
  5. % 7 oranında bir nihai konsantrasyona kadar ve yumuşak pipetle iyice karıştırın - (- / tampon K 60 w% / hac) sakroz ekleyin. Sıvı nitrojen içinde flaş dondurma ve yer -80 uzun süreli depolama için ° C derin dondurucuda, mikrosantrifüj tüplerinde PIC hacimde (örneğin, 200 uL) hazırlayın.

In Vitro Entegrasyon 5. (IVI) Tahliller, HIV-1 pics kullanma

  1. ölçüye primerler phiX174-F phiX174-R kullanılarak PCR ile phiX174 plazmid DNA'sından 2.0 kb bölgenin amplifikasyonuyla IVI deneyinde kullanılan hedef DNA hazırlamak.
    1. Tablo 1 'de tarif edildiği gibi PCR karışımı bir araya getirin. Tablo 2'de önerilen termal döngü koşulları kullanılarak, bir termal döngü PCR gerçekleştirin. (Üretici tarafından tavsiye edilen protokole göre) bir jel saflaştırma kiti kullanılarak PCR ürünü jelle saflaştırılması, ve kullanılana kadar -80 ° C 'de parçalar olarak saflaştırılmış bir hedef DNA saklayın.
  2. 200 hedef DNA'nın 600 ng ekleyin - & #181; PIC L tümböleni, iyice karıştırın ve 45 dakika boyunca 37 ° C'de inkübe edin.
    Not: Bir integraz inhibitörü (örn Raltegravir) hedef DNA atlama da dahil IVI reaksiyonları kontrol reaksiyonları tavsiye edilir.
  3. % 0.5, 8 mM, sırasıyla 0.5 mg / mL, nihai konsantrasyonları SDS, EDTA, ve proteinaz K eklenerek IVI reaksiyonu durdurun. İyice reaksiyon içeriğini karıştırın ve gece boyunca 56 ° C kuluçkaya yatmaktadır.
  4. Sonraki gün, fenol / kloroform ekstraksiyonu ve etanol çökeltmesiyle IVI reaksiyonu toplam DNA arındırmak. 16.000 xg ve oda sıcaklığında bütün santrifüj adımları uygulayın.
  5. 2 dakika boyunca, deproteinize örnek fenol eşit hacmi ekleme vorteks ile kuvvetli bir şekilde karıştırın ve santrifüjlenir. Dikkatle üst sulu faz kaldırmak ve yeni bir tüp aktarın.
  6. Adımı tekrarlayın 5.5. yeni bir tüp, üst sulu faz transfer.
  7. , Kloroform karışımı vorteks ile kuvvetlice karıştırın ve santrifüj fo: 1 fenol: 1 eşit hacimde ekleR 2 dak. yeni bir tüp, üst sulu faz transfer.
  8. Kloroform eşit hacmi ekleme vorteks ile kuvvetli bir şekilde karıştırın ve 2 dakika boyunca santrifüj. yeni bir tüp, üst sulu faz transfer.
  9. DNA çökeltilmesi 0.3 M bir son konsantrasyona kadar 0.1 mg / ml, sodyum asetat 3 M nihai konsantrasyona glikojen ekleyin ve% 100 etanol (buz soğukluğunda) 2.5 hacim için. Vortex içeriğini toplamak için, santrifüj kısaca karıştırın ve -80 ° CO / N tüp yerleştirmek için.
  10. Sonraki gün, 16,000 x g'de 30 dakika boyunca örnek santrifüj ve 30 dakika boyunca 4 ° C. Dikkatle pelet bozmadan süpernatant kaldırmak.
  11. 16.000 x g'de topak ve santrifüj% 80 etanol (buz soğukluğunda) 500 uL ilave edin ve 10 dakika boyunca 4 ° C. Oda sıcaklığında, DNA topağı hava-kurutun ve iyice nükleaz içermeyen su, 50 uL yeniden süspanse edin. -20 ° C'de DNA örnekleri saklayın.

Ükler PIC Aktivitesi 6. PCR tahlilleri

  1. Entegre HIV-1 DNA kavşaklar çoğaltmak için (sırasıyla LTR ve phiX174 astar,), viral LTR ve phiX174 DNA hedefleyen primerler kullanılarak ilk turda geleneksel PCR gerçekleştirin.
    1. Tablo 3 de tarif edildiği gibi birinci fasıl PCR karışımı bir araya getirin. Şablon DNA hariç bütün bileşenlerin bir ana karışımı birleştirin, ayrı PCR tüpleri içine 45-uL'lik dağıtmak ve şablon DNA veya nükleaz içermeyen su (kontrol) 5 mcL ekleyin.
    2. Tablo 4 'de tavsiye edilen termal döngü koşulları kullanılarak, bir termal döngü PCR gerçekleştirin.
  2. seçici olarak birinci ro entegre vDNA dizilerini amplifiye etmek için virüs LTR (LTR-R ve LTR-U primerler) kısa bir bölgeye yanaşan primerler kullanılarak ikinci tur qPCR gerçekleştirmekund PCR ürünleri. Entegre vDNA numara kopyalamak belirlemek için, bilinen kopya numaralarının 10x seri dilüsyonları kullanılarak standart bir eğri oluşturmak (örneğin, 10 0-10 8), HIV-1, moleküler klon.
    1. Tablo 5'te tarif edildiği gibi ikincil qPCR karışımı bir araya getirin. 96 oyuklu bir PCR reaksiyonu plaka kuyuları uygun sayıda 25. uL'lik tevzi dikkatle, şablon DNA hariç bütün bileşenlerin bir ana karışımı monte ve saflaştırılmamış birinci tur PCR ürünleri ya nükleaz içermeyen su 5 mcL (kontrol). üç kez tüm qPCR reaksiyonları gerçekleştirmek.
    2. Real-time PCR aracı haline PCR plakasını yükleyin ve Tablo 6'da tavsiye edilen bisiklet koşulları kullanılarak qPCR gerçekleştirin.
    3. Uygun bir yazılım kullanarak verileri analiz edin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1 PIC bölgesinin izolasyonu

Akut enfekte Sup-T1 hücreleri, HIV-1 PIC bölgesinin izolasyonu için kullanılan protokolün bir şeması, Şekil 1 'de tasvir edilmiştir. Bu protokol, Engelman ve ark anlatılan yöntemlerle elde edilir. 19, 20. HIV-1 PIC enfekte olmuş hücreler toplandı ve ters-transkribe vDNA oluşmaktadır nükleoprotein kompleksleri, viral proteinler, ve hücresel faktörler 19, 20 vardır. Bu raporda tarif edilen yöntem PIC ilişkili entegrasyon aktivite kaynağı olarak, HIV-1 ile enfekte olan hücrelerin sitoplazmik özler kullanılır.

HIV-1 PIC in vitro entegrasyon etkinlikte

Şekil 2 'de gösterilmiştir. Bu yöntem, PIC ilişkili IVI aktivitesini ölçmek için bir iç içe qPCR dayalı strateji kullanır ve prosedürler Engelman laboratuarda 19, 20, 21 tarafından yayınlanan protokollerden, modifikasyonlarla, adapte edilir. Bu yöntemde PIC ilişkili entegrasyon aktivitesi bir heterolog doğrusal hedef DNA 21 ile sağlanmaktadır ve bu uyum reaksiyonundan elde edilen DNA ürünleri saflaştırılmış ve daha sonra, PCR tabanlı bir miktar tayini için başlangıç malzemesi olarak kullanılmaktadır. Birinci turda, geleneksel PCR, viral hedef DNA, kavşaklar, uygun primerler kullanılarak yükseltilir. ikinci turda qPCR, LTR-özel primerler, özellikle ilk tur PCR ürünlerinden vDNA popülasyonu ettirecek kullanılır. protokol s bakınızBu yöntemin ayrıntılı bir açıklama için ection.

Bir IVI testte Örnek sonuçlar, HIV-1 PIC Şekil 3'te gösterilmiştir kullanılarak gerçekleştirildi. Sup-T1 hücreleri (80 x 10 6 hücre / enfeksiyonu) DNase 1 ile tedavi edilmiş HIV-1, 30 mL spinoculated edildi (~ p24 eşdeğer, 50 ug) 480 ya da yokluğunda önleyicisi Raltegravir 1 uM, HIV-1 mevcudiyetinde xg ve 2 saat boyunca 25 ° C. Hücreler, 37 ° C de 5 saat ve% 5 CO2 için, daha sonra kültüre edildi. Protokol bölümünde tarif edildiği gibi PIC izole edilmiştir. IVI reaksiyonlar 45 dakika süreyle 37 ° C de, her biri kullanarak resimler 200 uL hedef DNA, 600 ng (PCR ile phiX174 DNA'dan amplifiye eden bir 2 kb DNA fragmanı), gerçekleştirilmiştir. Reaksiyonlar 56 ° CO / H SDS ve EDTA varlığında proteinaz K tedavisi proteinden edildi. kloroform (1: 1), reaksiyon ürünleri bir kez fenol, iki kez fenol ile ekstre edildi Karışım, bir kezkloroform ile. Daha sonra, DNA, etanol ile çökeltilmiş tuzu ve eş-çökeltme glikojen mevcudiyetinde, ve DNA topağı% 80 etanol ile bir kez yıkanmıştır. Saflaştırılmış DNA nükleaz içermeyen su, 50 uL içinde yeniden süspanse edilmiştir. Yuvalanmış qPCR stratejisi phiX174 DNA'sına entegre vDNA sayısını belirlemek için kullanılmıştır. Birinci turda, geleneksel PCR olarak, phiX174 hedef DNA ve viral LTR bölgeye dizilere tamamlayıcı primerleri, entegrasyon Reaksiyonu, DNA ürünleri 5 uL entegre viral hedef DNA kavşakları amplifiye etmek için kullanılmıştır. Ikinci turda qPCR, LTR kapsayan primerler özel birinci tur amplikon ürünleri 5 uL gelen ve HIV-spesifik DNA sekanslarını büyütmek için kullanılmıştır bilinen kopya sayılarının seri seyreltileri, 10 misli (10 8 -10 0) HIV-1 molekül klonu (Standartlar).

Tüm qPCR reaksiyonları üç kopya halinde gerçekleştirilmiştir ve veri wer edildiE ticari yazılımı kullanılarak analiz edildi. aykırı elde edilen değerler, entegre vDNA numaraları interpolasyon edilmiş kopya olan bir standart eğri oluşturmak için çizilmiştir. Hata çubukları standart sapmaları temsil etmektedir. Şekil 3'te gösterildiği gibi, HIV-1 PIC sağlam hedef DNA (Şerit 5) içine ilgili vDNA entegre olur. Önemli olarak, PIC bölgesinin IVI verimliliği büyük ölçüde inhibitör Raltegravir (Şerit 6) ile takviye edilmiş reaksiyonlarda indirgendi. Bu güçlü HIV-1 için bu deneyde ölçüldüğü entegrasyon aktivitesi ilişkilendirir. Bundan başka, enfekte edilmemiş hücrelerden sitoplazmik lizatları içeren kontrol reaksiyonları (Şerit 1) tek başına PIC (Şerit 2), tek başına DNA (Şerit 3), hedef ve entegrasyon aktivitesi göstermedi başına (şerit 4) tampon maddesi. Buna ek olarak, ilk tur PCR, Taq polimeraz dahil kontrolü (Şerit 7) entegrasyonu ürünleri büyütmemiştir. Özellikle, PIC-alone kontrol (Lane 2) elde edilen veriler göstermektedir ki iç içe geçmiş qPCR strateji specifiCally'nin entegre vDNA ancak PIC ilişkili vDNA ölçer. Topluca, bu veriler PIC ilişkili entegrasyon aktivitesinin ölçümü göstermektedir.

Şekil 1
Şekil 1: HIV-1 PIC Hazırlanması için Protokol şematik temsili. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

PICS içeren sitoplazmik özler, HIV-1 ile enfekte Sup-T1 hücrelerinden izole edilmiştir. Bu PIC bölgesindeki in vitro uyum tahlilinde uyum aktivite kaynağı olarak kullanılır.

şekil 2
Şekil 2: in vitro şematik olarak m>, HIV-1 PIC entegrasyonu Deneyi. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Entegrasyon deneyleri, HIV-1 resim ve heterolog hedef phiX174 DNA kullanılarak in vitro gerçekleştirilmiştir. Entegre HIV-1 DNA, ilk tur, geleneksel PCR vDNA özgü sekanslar, tercihen, bir ikinci tur qPCR amplifiye edildiği entegrasyon kavşakları güçlendirir olup, burada, bir iç içe PCR stratejisi ile ölçülmüştür.

Şekil 3,
Şekil 3: HIV-1 vDNA Entegrasyon Aktivite PIC-ilişkili. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

"Fo: keep-together.within-PAGE =" 1 "> entegre vDNA 10x seri dilüsyonları kullanılarak oluşturulan standart bir eğriden türetilen değerlerin konulması sureti ile tespit edilmiştir numara kopyalamak HIV-1 PIC ilişkili entegrasyon aktivitesi deneyinin Örnek sonuçlanır. bir HIV-1 moleküler klonun bilinen kopya sayısı. Tüm reaksiyonlar üç kopya halinde gerçekleştirilmiştir ve veriler ticari yazılım kullanılarak analiz edildi. Hata çubukları, standart sapmayı temsil ederler.

Bileşen Stok 50 uL reaksiyon için final hacmi
phiX174 plazmit DNA 10 ng / ml 5,0 uL
GoTaq reaksiyon tamponu 5x 10.0 uL
dNTP nükleotid karışımı 10 mm 1.0 mL
phiX174-F astar 10 uM 2.5 uL
phiX174-R astar 10 uM 2.5 uL
GoTaq DNA Polimeraz (5 U / ml) 0.25 uL
Nukleazsız damıtılmış su - 28.75 uL

Tablo 1.

= 2 dak 95 ° C
Döngü 34 tekrarlar arasında:
95 ° C'de 30 s =
53 ° C 30 s =
= 2 dakika, 72 ° C
72 ° C'de 10 dakika =
4 ° C = Tut

Tablo 2.

Bileşen Stok 50 uL reaksiyon için final hacmi
IVI reaksiyon DNA ürünü - 5,0 uL
GoTaq reaksiyon tamponu 5x 10.0 uL
dNTP nükleotid karışımı 10 mm 1.0 mL
LTR astar 10 uM 2.5 uL
phiX174 astar 10 uM 2.5 uL
GoTaq DNA Polimeraz (5 U / ml) 0.25 uL
Nukleazsız damıtılmış su - 28.75 uL

Tablo 3.

= 5 dak 95 ° C
Döngü 23 tekrarlar arasında:
94 ° C'de 30 s =
55 ° C'de 30 s =
= 4 dakika, 72 ° C
72 ° C'de 10 dakika =
4 ° C = Tut

Tablo 4.

<td> Taqman Probe
Bileşen Stok 30 uL reaksiyon için final hacmi
1. yuvarlak PCR ürünleri - 5,0 uL
LTR-R astar 10 uM 0.9 mL
LTR-U astar 10 uM 0.9 mL
10 uM 0.3 mL
iQ Supermix 2 kere 15.0 uL
Nukleazsız damıtılmış su - 7.9 mL

Tablo 5.

= 3 dk 95 ° C
Döngü 39 tekrarlar arasında:
94 ° C 15 sn =
58 ° C'de 30 s =
72 ° C'de 30 s =
plaka Okuma

Tablo 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

retroviral PIC biyokimyasal analizler retroviral DNA entegrasyonu mekanizması içine kritik bilgiler sağladı. Retroviral PIC entegrasyonu faaliyetinin ölçülmesi plak formasyonu deneyi, Güney benek analizi, ve iç içe geçmiş qPCR elde edilebilir. Plak deneyi deneysel strateji zahmetlidir ve entegrasyonu 6, 7, 18 ölçmek için dolaylı bir yöntem kullanmaktadır. Güney benek bazlı deneyler ölçer entegrasyonu doğrudan değil, PIC 6, 7, 18, nispeten yüksek miktarlarda gerektirir.

Bu rapor, in vitro HIV-1 PIC ilişkili entegrasyon aktivitesini ölçmek için bir iç içe qPCR stratejisi detayları. Önemli bir avantajı, bu yöntemin önemi reaksiyon başına 4 PIC hazırlanması nispeten düşük miktarlarda gereklilik, 5, 19. Bu yöntemin en önemli adımları enfeksiyonu için yüksek titre virüsün üretimi PIC hazırlama işleme. PCR ilk turda entegrasyonu kavşaklar üstel amplifikasyon içerdiğini burada belirtmek gerekir. Sonuç olarak, ikinci turda qPCR belirlenen entegre vDNA kopya sayıları, dolayısıyla PIC-ilişkili vDNA kopya ölçüsünü vermiyorum sınırlama var yarı-kantitatif ve. DNA, LTR-özgü primerler ile PIC saflaştırılan Bununla birlikte, PIC ilişkili vDNA qPCR belirlenebilir. Entegre vDNA oranı bir in vitro uyum reaksiyonu entegrasyon verimliliği hakkında bilgi verebilir gelen PIC-ilişkili vDNA numaralar kopyalayın. Bu yöntem, her iki yönde de entegre tespit etmek için bir seçim ve primerler başka heterolog hedef DNA eklenerek modifiye edilebilir. Özetle, yöntemBurada tarif edilen nicel HIV-1 PIC entegrasyonu aktivitesini ölçer ve retroviral entegrasyonu biyokimyasal ayrıntıları bir anlayış geliştirilmesi araştırma için benimsenebilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar hiçbir rakip mali ve mali olmayan çıkarları beyan ederim.

Acknowledgments

Bu çalışma kısmen CD NIDA / NIH hibe DA024558, DA30896, DA033892 ve DA021471 tarafından desteklenmektedir. Biz de RCMI hibe G12MD007586 kabul, Vanderbilt CTSA UL1RR024975 hibe, Meharry Translational Araştırma Merkezi NCRR / NIH, NIMHD / NIH U54 hibe MD007593 ve Tennessee CFAR hibe P30 AI110527 dan (MeTRC) CTSA hibe U54 RR026140.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Ölçümü<em&gt; İn Vitro</em&gt; HIV-1 Preintegration Kompleksleri Entegrasyon Etkinliği
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter