Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Environment

Empírica, Metagenomic e técnicas computacionais iluminam os mecanismos pelos quais fungicidas compromisso abelha saúde

doi: 10.3791/54631 Published: October 9, 2017

Summary

Consórcios microbianos dentro bumble colmeias enriquecem e preservar o pólen para larvas de abelha. Usando o sequenciamento de próxima geração, juntamente com o laboratório e experiências no terreno, este manuscrito descreve protocolos usados para testar a hipótese de que resíduos do fungicida alteram o pólen microbiome e demografia de colônia, finalmente levando à colônia perda.

Abstract

Os cultivadores costumam usam sprays de fungicida durante a flor para proteger as culturas contra a doença, que expõe as abelhas a resíduos do fungicida. Embora considerado "abelha-cofre", há evidência de montagem que resíduos do fungicida no pólen são associados com declínios de abelha (para espécies de tanto mel e bumble bee). Enquanto os mecanismos permanecem relativamente desconhecidos, pesquisadores têm especulado que a simbiose de abelha-micróbio está envolvidos. Micróbios desempenham um papel fundamental na preservação e/ou processamento de pólen, que serve como nutrição para abelhas larvas. Alterando a comunidade microbiana, é provável que os fungicidas interrompem esses serviços de micróbio-mediada e, assim, comprometem a saúde das abelhas. Este manuscrito descreve os protocolos usados para investigar o mecanismo (s) indireto pelo qual fungicidas podem estar causando declínio da colônia. Experimentos de gaiola, expondo as abelhas para flores tratada com fungicida já forneceram a primeira evidência que fungicidas causam perdas de colônias profunda em uma abelha nativa (Bombus impatiens). Utilizando doses de campo relevantes de fungicidas, uma série de experimentos foram desenvolvidos para fornecer uma descrição mais fina da dinâmica da comunidade microbiana de pólen fungicida-expostos. Mudanças na composição estrutural de assemblages fúngicas e bacterianas dentro o pólen microbiome são investigadas pela próxima geração sequenciamento e análise metagenomic. Experimentos desenvolvidos neste documento foram projetados para fornecer uma compreensão mecanicista dos como fungicidas afetam a microbiome de pólen-disposições. Em última análise, estas conclusões devem lançar luz sobre a via indirecta, através dos quais fungicidas podem estar causando declínios de colônia.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Gerenciado e espécie de abelha selvagem está experimentando o declínio generalizado, com implicações importantes para ambos os sistemas naturais e agrícolas1. Apesar de esforços concertados para compreender as causas deste problema, os fatores que levam mel abelha declínios ainda não estão bem compreendidas2,3,4. Para certas espécies de abelhas selvagens, nativas, a situação tornou-se terríveis5,6. Se as populações de abelhas não podem ser sustentadas quando eles se cruzam com a agricultura industrial, as suas populações continuará a cair e as culturas que exigem polinizadores (35% da produção mundial7) irão perdurar reduziram das colheitas.

Enquanto muitos potenciais fatores tais como a exposição de pesticidas, doenças e habitat perda1,4,8,9,10 têm sido implicados em declínio de abelha do mel, relativamente pouco é conhecido sobre o efeito interativo desses estressores na saúde de abelhas nativas, dentro ou perto de sistemas agrícolas. Muitos esforços de pesquisa atual continuam a concentrar-se em inseticidas, (por exemplo,11,de neonicotinoides12), embora a pesquisa última indica que fungicidas podem também desempenhar um papel em declínio de abelha por prejudicando a formação da memória, recepção olfativa13, ninho reconhecimento14, atividade enzimática e funções metabólicas15,16,17. Globalmente, fungicidas continuam a ser aplicados nas culturas de floração durante a flor. Estudos recentes têm documentado que as abelhas comumente trazem resíduos do fungicida volta para a colmeia18, de fato, estudos têm demonstrado uma grande proporção de colmeias testadas contidas fungicida resíduos19,20. Continuação dos trabalhos revelou aquele resíduo de fungicida é associado com altas taxas de mel de abelha mortalidade larval21,22,23 e a presença de "sepultado pólen" dentro de colônias, que embora não-tóxico, é desprovida de atividade microbiana e é nutricionalmente comprometido24. Apesar do fato de que fungicidas tem sido consideradas "abelha-cofre", agora há evidência que a exposição ao fungicida sozinha pode causar perdas severas de colônia em uma espécie de abelha nativa bumble, Bombus impatiens25.

Para estabelecer o nexo de causalidade entre a exposição de fungicida e colônia mortalidade, o modus operandi destes produtos químicos precisa ser determinado. Como evidenciado em solos26e sedimentos27ambientes aquáticos28, alvejando os fungos, os fungicidas mais prováveis alteram abundância de fungos e diversidade dentro de pólen-disposições, invocando, assim, uma grande comunidade mudar isso fortemente pode favorecer as bactérias. Sem fungos competidores ou antagonistas, certas bactérias patogênicas podem proliferar relativamente desmarcada, facilitando a deterioração de pólen-disposições. Passado a pesquisa demonstrou que os microorganismos, particularmente leveduras e fungos filamentosos, servir como simbiontes nutricionais para abelhas29,30,31, proteger contra parasitas e patógenos32 ,33e fornecer a preservação a longo prazo das lojas de pólen. Fungicidas, portanto, podem indiretamente prejudicar as abelhas imaturas por perturbar a comunidade microbiana que é necessário para fornecer estes serviços e/ou pelo aumento da suscetibilidade a de parasitas e patógenos oportunistas12. Com o aumento da demanda na produção de alimentos, culturas em todo o mundo estão sendo pulverizadas cada ano com fungicidas durante flor, ressaltando a necessidade de compreender a magnitude de tais efeitos fungicida-induzida.

Até à data, as lacunas de conhecimento primário relacionados com abelhas nativas microbiana ecologia pode ser representada pelas seguintes perguntas: em que medida fungicida muda a comunidade microbiana dentro de pólen de abelha-disposições? Quais são os impactos a jusante de consumir pólen com uma comunidade microbiana profundamente alterada? De acordo com estas perguntas ecologicamente relevantes, experimentos foram desenvolvidos com os principais objetivos de revelar 1) desse resíduo de fungicida sozinho pode causar declínio grave colônia em uma espécie de abelha nativa; 2) o grau a que as comunidades microbianas em pólen-disposições são alteradas por fungicidas e 3) como a saúde das abelhas é afetado por uma comunidade microbiana severamente alterada. Os objetivos experimentais foram definidos para abordar as questões acima, usando uma combinação de experimentos baseados em laboratório e campo. Usando metagenomic de estado-da-arte e técnicas moleculares ao lado dos métodos tradicionais de observações de campo, esta pesquisa tem como objetivo reunir os potenciais efeitos dos fungicidas sobre a saúde das abelhas.

O primeiro objectivo deste estudo é demonstrar que a exposição de fungicida sozinho pode causar perdas de colônias significativas entre as espécies de abelhas nativas. Um estudo envolvendo gaiolas de campo grande foi usado para investigar os efeitos da exposição de fungicida sobre o crescimento da colônia de Bombus impatiens, uma abelha nativa onipresente, abundante nos Estados Unidos (Figura 1, Figura 2, Figura 3). Foi hipotetisado que urticária tratada com fungicida apresentaria menor aptidão e demografia atípica comparado a urticária não-expostos. Dados obtidos neste experimento com suporte a esta hipótese, demonstrando que os resíduos do fungicida dentro de pólen podem ser a única causa de perdas de colônias profunda em um nativo bumble bee espécie25. O segundo objectivo deste estudo é investigar a resposta do pólen microbiome para exposição de fungicida. A hipótese é de que a composição da comunidade de micróbios dentro de pólen-disposições expostos aos fungicidas será diferente do pólen não tratada. Enquanto a diversidade e abundância de fungos são esperados para diminuir significativamente, bactérias e/ou uma única espécie fúngica dominante provavelmente crescerá desmarcada na ausência de outros fungos concorrentes. Através de uma série de ensaios in vivo , estas mudanças na composição da comunidade microbiana serão analisadas usando metagenômica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. examinar o efeito de fungicida de exposição na Bumble Bee Colony sucesso usando gaiola experimentos de campo

  1. Set até dez gaiolas de malha em um campo plantaram com aveia. Cavar uma trincheira ao redor de cada gaiola e todas as quatro bordas da gaiola malha cavar o solo para garantir que as abelhas não podem escapar. Estocar as gaiolas com plantas em vasos, que são conhecidas por ser atrativo para as abelhas (por exemplo, trigo mourisco, borragem, alyssum, cosmos e girassóis) ( Figura 2).
  2. Complementar as gaiolas com uma única bandeja (36 cm x 42 cm) no-flor trevo. Cluster de recursos florais dentro de um canto da gaiola, ocupando um espaço de aproximadamente 2,5 m x 1 m. vegetar a área restante da gaiola pelas aveias.
  3. Atribuir aleatoriamente a abelha colônias e cada trabalho que contém uma única rainha, um tratamento (fungicida presente/ausente, N = 5 colónias por tratamento, totais 10 colônias), em seguida, colocá-los dentro de uma gaiola de campo (N = 1/gaiola) por 29 dias (23 de junho -21 de julho de 2014).
  4. Orientar as caixas de colônia tal que a colônia ' aberturas s apontam para o sul para fornecer as abelhas com óptimas condições de navegação. Subsidiar as colônias com bexigas de água de açúcar, colocadas dentro das caixas de colmeia para complementar a disponibilidade de néctar.
  5. Aplicar fungicida chlorothalonil-baseado em um nível de campo relevantes (20 g/L) para as gaiolas de tratamento cinco fungicida plantas, usar uma mão realizada pulverizador de pesticidas, duas vezes durante o estudo (dia 0 e 13). Revestir as flores uniformemente tal que nenhum líquido adicional adere às superfícies florais ( Figura 3).
  6. Na conclusão do estudo de gaiola de campo, remover as colônias de b. impatiens das jaulas à mão, cool as colmeias, colocando no congelador -20 ° C por 20 min.
  7. Remover abelhas usando Pinças esterilizadas e registrar o número de larvas, pupas, fêmeas adultas (eu. e. forrageiras) e os machos adultos. Usando uma balança analítica gravar o peso seco da rainha mãe, larvas, pupas, fêmeas adultas (ou seja, forrageiras) e machos adultos.

2. Examinar os efeitos da exposição fungicida nas comunidades microbianas no pólen-disposições do Bumble Bee ninhos usando laboratório baseado os ensaios In Vivo

  1. Pulverize adquirido comercialmente pólen de um pó fino, usando um padrão moinho de esfera do laboratório. Esterilize o pólen em pó por imersão em etanol a 70%, permitindo que evapora-se durante a noite sob a luz UV. Verificar a esterilidade do pólen por chapeamento ~0.5 mg em meios de ágar de uso geral.
    1. Para o seco, pólen esterilizado, usando pipetas esterilizadas, adicionar dosagem relevantes do campo do fungicida: propiconazol em 14,3%; azoxistrobina em 22,9% para tratamentos (0,74 µ l e 0,65 µ l respectivamente / dia / colmeia). Misture bem, usando varas de madeira esterilizadas.
  2. 6 lugar de colmeias experimentais (n = 3 cada para controle e tratamento) em uma bancada de laboratório limpo, higiênico, mantida à temperatura ambiente. Cada dia pesar 4,27 g de pólen 34 , 35, misturado com água estéril (para controle) dentro de uma capa usando técnica asséptica padrão ou fungicidas (para os tratamentos).
    1. Usando os alçapões fornecidos pelo lado da caixa de papelão encerram as colmeias, introduzir o pólen dentro das colmeias. Suplemento das colmeias com solução de açúcar esterilizado a cada semana. Continue alimentando o regime por quatro semanas.
  3. Na conclusão do estudo em laboratório, esfriar as colmeias colocando no congelador-20 ° C por 20 min. raspar o pólen-disposições contidas dentro de câmaras ninhadas usando Pinças esterilizadas e espátulas e lugar em tubos de armazenamento estéril. Loja a-80 ° C. contagem e registar o peso dos trabalhadores e rainha mãe no início e no final do experimento (passo 1.7).
  4. Kits de isolar DNA da amostra de pólen-provisão usando o isolamento de DNA comercialmente disponível (ver tabela de materiais para obter detalhes).
    1. Adicionar 0,25 g de pólen-provisão para extração de tubos, brevemente vórtice misturar.
    2. Fazer um 200 mg/mL solução de lisozima em água destilada deionizada, suficiente para 50 µ l/amostra. Agitar vigorosamente a solução de forma completamente.
    3. Adicionar 50 µ l da solução de lisozima para os tubos de extração com amostra nele e misture bem várias vezes por inversão. Incube o tubo por 10 min a 37 ° C em banho-maria. Se formou o precipitado, aquecer a solução a 60 ° C até dissolver antes de usar.
    4. Adicionar 70 µ l de solução aquosa de Lise para os tubos de extração, secure horizontalmente sobre uma almofada de vórtice do leito com fita, e tubos de vórtice de 10 min. centrifugar a 10.000 x g, durante 30 s, à temperatura ambiente.
    5. Transferir o sobrenadante para um tubo de coleta limpa 2 mL. Adicionar 250 µ l de solução de precipitação de proteínas e o vórtice para 5 s. Incubar a 4 ° C por 5 min em um banho de gelo.
      Nota: Espere entre µ l 400 a 500 µ l do sobrenadante. Sobrenadante pode ainda conter algumas partículas.
    6. Centrifugar os tubos à temperatura ambiente por 1 min a 10.000 x g e transferir até 600 µ l do sobrenadante para um tubo de coleta limpa 2 mL. Adicionar 200 µ l de solução de remoção do inibidor aquosa, vórtice brevemente e incubar a 4 ° C por 5 min. centrifugar os tubos à temperatura ambiente por 1 min em 10.000 x g. transferir até 750 µ l do sobrenadante num tubo de colheita limpa 2 mL.
    7. S.
    8. Adicionar 1200 µ l de solução aquosa de vincular ao sobrenadante e vórtice para 5 carregar aproximadamente 675 µ l do sobrenadante para um filtro de rotação e centrifugar 10.000 x g por 1 min à temperatura ambiente. Descartar o fluxo através de.
    9. Repetir 2.4.7. duas vezes.
      Nota: Um total de três cargas para cada amostra processada são necessários.
    10. Adicionar 500 µ l etanol e centrifugar a temperatura ambiente por 30 s a 10.000 g. x descartar o fluxo através de e centrifugar novamente a temperatura ambiente por 1 min em 10.000 x g. colocar girar o filtro em um tubo de coleta limpa 2 mL.
    11. Adicione 100 µ l de eluição buffer para o centro da membrana do filtro. Centrifugar a temperatura ambiente por 30 s a 10.000 g. x descarte o filtro de rotação. Loja coletou DNA entre-20 ° C e -80 ° C
  5. uso isolado DNA para sequenciação.
    1. Quantify e normalizar o DNA isolado a 2 ng / µ l por análise fluorométrica. Reações de
      1. preparar em triplicado para cada amostra coletada comparar a quantidade relativa de 28S (planta), analisar sua (fungos) e 16S (bacteriana) componentes de cada amostra de pólen-provisão 36. Certifique-se de que cada reação contém 10 ng de DNA total e 2x de mix de mestre tintura com base assimétrica cianina µ l 2.5 cada de primers para diante e reverso pares 28KJ/28B 37 em planta e ITS1/ITS5.8R de DNA fúngico 38 .
    2. Amplificar DNA usando os seguintes parâmetros: pre-desnaturação de 2 min a 50 ° C, 2 min desnaturação inicial a 95 ° C, 40 ciclos de (15 s a 98 ° C, 15 s a 58 ° C, 60 s a 72 ° C), seguido por uma curva de derretimento.
    3. Preparar um protocolo PCR 2-passo, aninhado usando bibliotecas de sequenciamento de próxima geração como alvo o 16S rRNA região variável V3/V4 e ITS / 5.8s região de espaçador do rRNA.
      1. Adicionar 12,5 µ l de DNA para 5 pmol de cada primer e 2 x mestre mistura. Faça reações separadas para cada região (16S ou ITS; ver tabela 1). Modificar os iniciadores específicos de região como descrito anteriormente 39 , 40 para adicionar sequências de nucleotídeos específicas do Sequenciador adaptador saliência para as sequências do gene-específico.
      2. Realizar a amplificação inicial usando os seguintes parâmetros: 3 min desnaturação inicial a 95 ° C, 25 ciclos de (30 s a 95 ° C, 30 s a 55 ° C, 30 s a 72 ° C), 5 min extensão final a 72 ° C.
      3. Seguinte inicial de amplificação, verifique se o tamanho da biblioteca e a quantidade por mobilidade electrophoretic e limpar usando um 1 x volume sólido fase reversível immgrânulos de obilization para remover primers residuais e os reagentes da reação. Pool de 16S e sua amplicons quantitativamente para criar um pool de amplicons único para cada amostra.
      4. Adicionar adaptadores específicos sequenciador e amostra específicas índices duplas usando os seguintes primers (ver tabela 1). Adicione 2,5 µ l de DNA amplificado para 5 pmol de cada primer e 2 x mestre mistura. Executar a amplificação de biblioteca usando os seguintes parâmetros: 3 min desnaturação inicial a 95 ° C, 8 ciclos de (30 s a 95 ° C, 30 s a 55 ° C, 30 s a 72 ° C), 5 min extensão final a 72 ° C.
    4. Seguir PCR, limpo terminadas bibliotecas usando um volume 1 x dos grânulos de imobilização reversível de fase sólida. Avalie a qualidade e quantidade das bibliotecas terminadas usando mobilidade electrophoretic e fluorometry, respectivamente. Padronizar a bibliotecas de 2 µM e piscina antes da sequenciação.
    5. Executar sequenciamento de nova geração em uma plataforma análoga aos adaptadores adicionado em PCR secundária, com um comprimento adequado para cobrir o amplicon inteira 41.
  6. Sequência de anotação e análise da composição microbiana.
    1. Combinar par-final sequenciamento dados (R1 e R2) em contigs único para bibliotecas tudo sequenciadas. Depois de mesclar arquivos tanto R1 e R2, é produzido um arquivo fasta único para cada uma das bibliotecas.
      Nota: Este passo e os processos descritos abaixo (salvo indicação em contrário) são executados em Mothur versão 1.38.0 38.
    2. Cada arquivo fasta para remover bases ambíguas, inesperadas sequências longas e longos homopolímeros de tela
    3. .
      Nota: Os parâmetros para seleção e remoção de sequência são maxambig = 0, maxlength = 600 e maxhomop = 8 para ambos os genes. Remover sequências idênticas, mas manter uma tabela de contingência separadamente para todas as bibliotecas (também conhecido como tabela de contagem em Mothur).
    4. Alinhar sequências originais da biblioteca gene 16S contra a versão do banco de dados SILVA 123 e a biblioteca ITS genética contra o banco de dados se unem seus 42.
      Nota: As sequências devem ser anotadas do nível do Reino para o nível de gênero.
      1. Posteriormente, cluster alinhado sequências com o pre.cluster de função usando o diff = 5 e remover quimeras.
    5. Classificar sequências usando o método Wang 43 baseado no UNITE ITS (para gene ITS) arquivos de taxonomia (valor de corte de 80%) e SILVA (para gene 16S).
    6. Carregar no R 44 as tabelas de contingência (um por gene) geradas durante o processo de classificação em Mothur. Em cada nível taxonômico, obter abundância relativa por biblioteca para posterior análise das mudanças da comunidade microbiana.
      Nota: Em cada nível taxonômico, mesclam grupos taxonômicos quando abundância relativa é inferior a 2% para todas as repetições experimentais.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Estudo de gaiola de campo:

Dados obtidos a partir das experiências de gaiola mostram que as colônias de abelhas bumble tinham uma resposta significativa à exposição de fungicida. As colmeias tratada com fungicida produziram significativamente menos trabalhadores (12,2 ± 3,8, média ± SE) do que as colmeias de controle (43,2 ± 11,2, F1,9= 6.8, p = 0,03) (Figura 4). Além disso, a biomassa de abelhas das colmeias tratada com fungicida (0,91 g ± 0,15) foi significativamente menor do que as colmeias de controle (2,36 g ± 0,55; F 1,9 = 8.3, p = 0,02). Este padrão de biomassa baixou em colmeias tratada com fungicida também foi observada entre as rainhas de mãe. As rainhas das colmeias tratada com fungicida apresentadas com uma biomassa significativamente menor (0,14 g ± 0,04) do que as rainhas das colmeias controle (0,27 g ± 0,01; Z = 2,5, p = 0,01). No entanto, exposição de fungicida não afetou o número de larvas, pupas e os machos entre os tratamentos. A biomassa das fases de vida discreta (larvas, pupas, os trabalhadores e os machos adultos) e pesos individuais para as larvas, pupas e trabalhadores não mostrou qualquer diferença entre tratados com fungicida e controle hives.

Estudo em laboratório:

Dados obtidos de experimentos baseados em laboratório indicaram que, antes da exposição do fungicida, controle e tratados com fungicida colmeias tinham contagem de trabalhador média estatisticamente comparáveis (controlar urticária = 28,0 ± 3,1; urticária tratada com fungicida = 31.67 ± 2.0; n = 3 cada) e rainha peso (controle de colmeias = 0,77 g ± 0,04; urticária tratada com fungicida = 0,74 g ± 0,01). No entanto, no final do estudo, contagem de trabalhador foi significativamente maior em colmeias de controle (67.67 ± 4.3), em comparação com colmeias tratada com fungicida (45.33 ± 3,8) (t4 = 3,89, p = 0,01). População de trabalhador aumentada ~ 150% em colmeias de controle em relação ao ~ 45% nas colmeias tratada com fungicida. Da mesma forma, o peso final da rainha mãe permaneceu relativamente inalterado no controle urticária (0,76 g ± 0,02) em comparação com um ~ 35% diminuir em colmeias tratada com fungicida (0,49 g ± 0,16). Tomados em conjunto, estes resultados são consistentes com os resultados publicados anteriormente25 e indicam exposição fungicida afetados aptidão de colônia, como evidenciado pelo menos números de trabalhador e reduziu a rainha-mãe pesos (Figura 5).

Metagenomic análise de pólen-disposições indicou diferenças distintas entre as comunidades microbianas coletadas de trataram com fungicidam e controlam urticária (Figura 6). Houve uma redução (> 95%) na abundância relativa de Streptomycetales comumente isoladas, Enterobacteriales em colmeias tratada com fungicida. Curiosamente, ambos esses grupos são conhecidos por sua atividade antifúngica e papel na preservação de pólen30,45 dentro de ambientes de colmeia de abelha. Bacterianos membros da ordem Rickettsiales, que inclui patógenos comuns de artrópodes46, mostraram muito maior abundância nas colmeias fungicida tratada. Tratada com fungicida colmeias tinham uma baixa abundância de fungos pertencentes às ordens Eurotiales e Sordariales e uma maior abundância de ordens Capnodiales e Ascosphaerales em comparação com colmeias de controle (Figura 7). Como esperado, para bactérias e fungos, de Shannon índice de diversidade (H) e equitabilidade (E) foi menor em colmeias tratada com fungicida, comparadas aos controles, embora estas diferenças não foram estatisticamente significativas (bactérias: H controlar a urticária =1,25 ± 0,3, Hurticária tratada com fungicida = 0,82 ± 0,2, Ecolmeias de controle = 0,46 ± 0,1; Etratada com fungicida urticária = 0,31 ± 0,1; fungos: Hcontrole urticária =0,99 ± 0,3, Hurticária tratada com fungicida = 0,72 ± 0,4, Ecolmeias de controle = 0,57 ± 0,2; Etratada com fungicida urticária = 0,42 ± 0,2). Embora detalhar as implicações metabólicas e funcionais de tal comunidade muda foi além do escopo deste estudo, combinado com a contagem de colônia e dados de peso, estes resultados sugerem que a exposição de fungicida pode afetar declínio na saúde de colônia por interromper a simbiose entre as abelhas e o pólen microbiome. Outras investigações sobre o papel dos grupos microbianos específicos que afectam a sobrevivência larval é recomendada para avaliar melhor o papel do pólen microbiome na manutenção de populações de abelhas saudáveis.

Figure 1
Figura 1: dentro de um ninho de Bombus impatiens . Imagem de alta resolução dos trabalhadores tende a ninhada células. Células ninhadas podem conter vários ovos e larvas em um determinado momento. Desenvolver as larvas se alimentam de pólen-disposições periodicamente introduzidas na câmara. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: gaiolas de campo grande erigido para abrigar as colônias de abelhas. Cada gaiola de malha (N = 10) foi abastecido com uma comercialmente comprei Bombus impatiens colmeia, bem como em-flor plantar espécies conhecidas para atrair abelhas. As flores foram estocadas em um canto da gaiola e a área restante foi vegetada com grama de aveia. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: resíduos do fungicida em um girassol recentemente pulverizado. Doses relevantes do campo do fungicida foram pulverizados no dia 0 e 13 do experimento. Usando um pulverizador de pesticidas, as flores eram uniformemente revestidas com uma solução de fungicida no entardecer/noite para evitar o contato direto com as abelhas operárias. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: impactos de resíduo fungicida Bombus no experimento gaiola. Colônias de abelhas Bumble que foram expostas a resíduos de fungicida no pólen exibiram declínios significativos em tamanho de Colônia (reductíons em abundância feminina adulta) ao longo de um único mês. Barras de erro representam ± 1SE; p < 0,05. Esta figura foi modificada de Bernauer et al 25. clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: impactos de resíduo fungicida bumble abelhas em um experimento de laboratório-com base. Colônias de abelhas Bumble que foram expostas ao pólen tratada com fungicida exibiram declínios significativos em tamanho de Colônia (reduções em abundância de trabalhador adulto) e diminuição do peso da mãe rainha ao longo de um único mês. Barras de erro representam ± 1SE; p = 0,03. Clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6: gráfico de pizza de metagenomic classificação da diversidade fúngica e bacteriana em ordem do rank. Análises baseadas em (um) 16S e (b) ITS baseado classificação das amostras de pólen-provisão coletados de controle e tratados com fungicida urticária. Colmeias de controle demonstraram maior diversidade e uniformidade na distribuição microbiana. Clique aqui para ver uma versão maior desta figura.

Figure 7
Figura 7: variação percentual em ordem classificação relativa de abundância de bactérias e fungos em resposta à exposição fungicida. Metagenomic classificação microbiana comunidades usando (um) 16S e (b), ITS baseiam cartilhas clique aqui para ver uma versão maior desta figura.

Par de primer Tipo de cartilha Sequência da primeira demão
28KJ/28B Planta GGC GGT AAA TTC CGT CC /
CGT CCG TGT TTC AAG ACG
ITS1 / ITS5.8 Fúngicas TCC GTA GGT GAA CCT GCG G /
MORDAÇA ATC CGT TGT TGA AAG TT
16s para diante / reverso Bacteriano aninhado 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3'/
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3'
Cartilha de ITS1F / ITS4 Aninhados fúngica 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCGTAGGTGAACCTGCGG - 3'
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC - 3'
Primeiras demão do adaptador 5'-AATGATACGGCGACCACCGAGATCTACAC [55555555]
ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
5'-CAAGCAGAAGACGGCATACGAGAT [77777777]
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3 '

Tabela 1: lista de pares da primeira demão e sequências da primeira demão, utilizadas na amplificação de DNA. Ver texto para referências.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Investigações sobre os efeitos dos fungicidas na saúde das abelhas permaneceram um aspecto pouco estudado de estratégias de manejo de pragas. Nosso estudo visa colmatar esta lacuna de conhecimento por meio de um conjunto de técnicas complementares que explicitamente isolar os fatores potenciais abelha declínios de condução. O planejamento, lógica e processamento dessas experiências são detalhados abaixo.

É importante garantir que não há abelhas podem escapar da malha das experiências gaiola, desde que isto comprometeria a análise da demografia. Também é importante que os ninhos artificiais têm isolamento suficiente para proteger da chuva e luz solar direta. Tenha cuidado para que os fungicidas não são pulverizadas diretamente sobre os ninhos. As colônias devem ser fornecidas com bexigas de água açúcar para completar a néctar reuniram-se e evitar a desidratação.

Para o laboratório baseados em ensaios de alimentação, condições assépticas rigorosas devem ser mantidas para evitar a contaminação ao preparar as refeições de pólen. Adquiridos comercialmente pólen deve ser pulverizada e UV esterilizados antes da utilização. Higiene da colmeia deve ser mantida para evitar a infestação de parasitas externas, tais como despensa traças e baratas. Bexigas de fluidos devem ser complementadas com solução de açúcar esterilizado para evitar a desidratação. Para pré-tratamento de censo, tenha cuidado para o stress, não as abelhas por manuseio excessivo e mantê-los fora da hived para uma prolongada períodos.

Como rendimento de DNA depende da idade e tipo de material começar, apenas amostras frescas ou congeladas bem devem ser usadas em amplificação e extração de DNA. Massa para extração de DNA da amostra não deve exceder 0,25 gm, como isso irá diminuir o rendimento do ADN. Rendimentos de DNA devem ser quantificados usando electroforese em gel. Upfront quantificação eletroforética de DNA isolado é fundamental antes de prosseguir para reações de qPCR para assegurar eficiente amplificação47.

Para a análise de metagenomic, uma análise mais abrangente da dinâmica microbiana pode ser obtida ao limitar a quantidade de sequências anotadas (relaxando a fração do toleráveis diferenças entre sequências) e reduzindo o número de grupos taxonômicos, como bem como aqueles para os quais a abundância relativa é consideravelmente baixa fusão (< 2%).

O tamanho da amostra conservador (N = 5 para ambos fungicida tratada e não tratada colmeias de estudo gaiola) pode inflar os desvios nos dados, que serão minimizados em estudos futuros, usando replicação maior. Para adicionar maior resolução e poder estatístico para os resultados, as colônias de abelhas serão contadas e pesadas antes e após a exposição do fungicida. O experimento de gaiola por períodos mais longos em execução permitirá a produção de novas rainhas, o que pode servir como uma variável de resposta adicional. Com essas modificações no protocolo atual, estudos futuros irão fornecer maiores detalhes sobre a dinâmica populacional de colmeia.

A natureza hidrofóbica do pólen desencoraja sua eficiente mistura com água. Pulverização e peneirar os grãos de pólen de um pó fino, auxilia no processo de mistura. A quantidade de pó o pólen pode ser ajustada para atingir a consistência desejada. Tenha cuidado para homogeneizar completamente o fluido (água ou fungicida) para alcançar uma distribuição homogênea de ingredientes ativos e entrega mesmo para as operárias.

Como o DNA em excesso pode inibir as reações de PCR, é recomendável que a amostra não deve pesar mais do que num Vortex excessiva de 0.25 g. deve ser evitados como esta tesoura DNA, reduzindo o rendimento. Rendimento do ADN de baixa também pode ser um resultado de uma exposição prolongada para a Lise. Primeiras demão bacterianas devem ser escolhidas de preferência da região de 16S rRNA V7-V9 para minimizar específico de amplificação de DNA de cloroplasto48. Além disso, o sequenciamento de outros genes, como o gene do RNA ribossomal 18S pode fornecer uma melhor compreensão da diversidade microbiana em pólen, bem como as mudanças de população mediante utilização de fungicida.

Dada a quantidade de bibliotecas para processar com Mothur, tempo de computação pode ser consideravelmente elevado. Removendo os solteiros quando comparando sequências uns contra os outros (se computar os recursos são limitados, removê-los antes da filtragem de Quimera) consideravelmente pode diminuir o tempo necessário para a computação unidades taxonômicas operacionais.

Os experimentos de gaiola confinar o intervalo natural de voo das abelhas (ao contrário de permitindo-lhes forragem amplamente através da paisagem), e não está claro o grau em que tais restrições podem influenciar as variáveis de resposta. Embora os controle e tratamento de gaiolas de experiência a mesma gama de variáveis abióticas e bióticas, é logisticamente impossível de controle para o microambiente dentro de cada gaiola.

O verdadeiro escopo de interações microbianas dentro-Comunidade é demasiado complexo e intrincado para replicar através de ensaios experimentais. Enquanto nossos dados prováveis documentam um subconjunto de diversidade microbiana total dentro de pólen-disposições, é a primeira introspecção os efeitos interativos que possam existir entre as bactérias e fungos na presença/ausência de fungicidas.

Usando bancos de dados alternativos para o alinhamento de sequências49 ou prever funcionais Estados metabólicos baseados no pólen diversidade bacterianas50 pode fornecer uma visão mais ampla de microbiome o pólen. Eventualmente, para melhor caracteriza a dinâmica metabólica e funcional de comunidades microbianas após a aplicação de fungicida, sequenciamento de genoma de pólen microbiome é necessário.

Experimentos de gaiola usando colmeias adquiridas comercialmente proporcionam um dos melhores quadros para medir as variáveis de resposta em um ambiente controlado semi. Causando alteração mínima a ecologia natural das abelhas (eficiência de forrageamento, estrutura social, cuidados de prole), experiências de gaiola minimizam o artifício e stress, introduzido pelo ambiente artificial e movimentação durante baseados em laboratório manual experimentos.

O melhor de nosso conhecimento, nenhum estudo ainda foi conduzido para avaliar os efeitos dos fungicidas na dinâmica da comunidade microbiana dentro o pólen-provisão de Bombus. Exposição aos fungicidas pode eliminar uma ou mais espécies sensíveis, perturbando a trégua ecológica entre fungos e bactérias. Usando o campo e em laboratório de ensaios como um cadinho para jogar fora essas interações, este estudo pretende demonstrar que o extermínio da espécie microbiana residente pode perverter o equilíbrio ecológico de microbiome o pólen, o que pode por sua vez a saúde das abelhas de compromisso.

Técnicas de cultura dependente como diluição e chapeamento na captura de mídia padrãoapenas uma fração da microflora de um determinado ambiente. Isso pode levar a uma péssima representação da diversidade microbiana e micróbios unculturable podem ir sem ser detectado51. Para estudar a amplitude de microorganismos, os cientistas devem contar com técnicas de independente de cultura, que são mais inclusiva e abrangente, por exemplo, análise de metagenomic e sequenciamento de próxima geração. Desenho pesadamente destas poderosas técnicas moleculares, este estudo visa obter maior resolução para o pólen microbiome que previsto tradicionais técnicas baseadas em cultura sozinhos.

Os resultados deste estudo revelaram profundas perdas no número de trabalhadores dentro de colônias de abelhas bumble expostos ao fungicida. Para uma colônia de abelhas bumble ser bem sucedido, os trabalhadores precisam de fornecer recursos suficientes e conta para a mãe-rainha e particularmente para o desenvolvimento de larvas. Em última análise, o objetivo da colônia é maximizar a captação de recursos (pólen e néctar) tal que a filha-rainhas como muitos como possível podem ser produzidos até o final do verão. Filha-queens saudáveis são a medida da aptidão para uma colônia. Grandes reduções nos trabalhadores, então, efetivamente enfraquece a capacidade da colônia para produzir rainhas para o ano seguinte. Neste estudo, não só eram números trabalhador diminuiu significativamente, mas as rainhas-mãe do fungicida trataram apresentadas com biomassa menor, presumivelmente como resultado de alimentação insuficiente pelas operárias de colmeias. Dada a complexidade das interações microbianas dentro de pólen-disposições, é difícil de discernir os efeitos interativos exatos entre fungos e bactérias que contribuem para esses padrões. No entanto, resultados derivados de experiências repetidas e replicadas como descrito aqui, irão fornecer insights vitais sobre a comutação simbiose entre estes dois grupos microbianos (seja competitiva, mutualistas ou comensais) em resposta ao estresse de xenobióticos, e os seus efeitos a jusante na microbiome pólen.

Através do uso de poderosas ferramentas moleculares, a complexidade ecológica de microbiome o pólen pode ser melhor resolvida. O entendimento preliminar revela uma infinidade de natural de bactérias e fungos, coletivamente contribuir para manter a forma de colônia. Em particular, as leveduras que foram isoladas a partir do pólen-disposições são conhecidas por conter propriedades bactericidas e fermentativa, ambos os quais são cruciais para o desenvolvimento das abelhas larvas. Tais associações ecológicas são sugestivas de um grau elevado de mutualismo entre abelhas e seu microbiome de pólen. Pólen-disposições, portanto, representam um efeito de diversidade emergente, provocado pelo cultivo de uma comunidade microbiana composta de papéis-chave funcionais. Na ausência desses simbiontes chaves, o pólen-disposição parece ser comprometida a graus desconhecidos. Continuou trabalhando nesta direção, provavelmente irá explicar a diversidade funcional destes micróbios e desmascarar seu papel como simbiontes de abelha.

Pesquisas recentes tem desmascarado a noção de fungicidas como sendo inofensivo para abelhas19,24,52,53,54. O objetivo desta pesquisa é isolar os mecanismos de condução fungicida impactos sobre as abelhas, iluminando, assim, a relação de causa-efeito entre fungicida declínios de uso e da abelha. O centro de hipóteses em torno do conceito que simbiose de abelha-micróbio está sendo alteradas significativamente por resíduos do fungicida em pólen. Em última análise, este trabalho será re-frame como fungicidas são vistas e usadas na agricultura e ambientes urbanos. À luz da atual crise global de polinizadores, a investigação proposta gera novos conhecimentos sobre ecologia de abelhas nativas, no que se refere às práticas de produção agrícola. Fungicidas continuam a ser o último grupo o agrichemical efetivamente isentar regulamentos limitando aplicações para as culturas durante a flor. Como resultado, abelhas selvagens e não gerenciados são consistentemente expostas aos fungicidas. Um crescente corpo de literatura sugere que, embora os fungicidas não são letais para as abelhas em contato, em doses elevadas, exposição é bastante prejudicial, levando a maior mortalidade larval21 e alterou o comportamento de forrageira. Espera-se que este trabalho irá iluminar o mecanismo (s) pelos quais fungicidas estão prejudicando os polinizadores. Além disso, esta pesquisa será formam a base da política de gestão de pragas mais sábia e informar os produtores das melhores práticas de gestão. Este trabalho também será fundamental no fornecimento de orientações para a pulverização de pesticidas melhorado, que podem influenciar o pesticida as leis e regulamentos. Mais amplamente, esses achados será relevantes para qualquer ecossistema gerenciada em que plantas são visitadas pelo pólen-coletando insetos. Com estimativas globais de abelha específicos serviços de polinização ser extraordinariamente alta55,,56, se esse trabalho pode atenuar o declínio das populações de abelhas, os impactos potenciais serão substanciais.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

O autor (es) graças a instalação de sequenciamento de Universidade de Wisconsin biotecnologia centro DNA para fornecer amplificação e instalações de sequenciamento e serviços, Caitlin Carlson, Jennifer Knack, Jake Otto e Max Haase para prestação de assistência técnica com análise molecular. Este trabalho foi financiado por fundos do USDA-Agricultural Research Service, que se apropriou (atual Research Information System #3655-21220-001). Apoio adicional foi fornecido pela National Science Foundation (sob Grant no. Deb-1442148), o centro de pesquisa de bioenergia do DOE grandes lagos (DOE escritório de ciência DE BER-FC02-07ER64494) e o USDA National Institute of Food e agricultura (projeto 1003258 do Hatch). C.T.H. é um estudioso do Pew em ciências biomédicas e Fellow Alfred Toepfer faculdade, suportado pelo Pew Charitable Trusts e a Fundação Alexander von Humboldt, respectivamente.

Materials

Name Company Catalog Number Comments
Natupol Beehive Koppert USRESM1 16 hives
Propiconazole 14.3 Quali-Ppro 60207-90-1 Propiconazole 14.3%
Abound Syngenta 4033540 Azoxystrobin 22.9%
Chlorothalonil Syngenta 3452 Fungicide used for trials
Pollen granules Bee rescued B004D5650C 3X 16oz bottles, pollen for trials
Bacterial strains for inoculation Currie Lab
Yeast strains for inoculation Hittinger lab
Primer pairs UW Biotech Center
DNA Isolation Kit Mo Bio 12830-50 Commercial DNA isolation kit
Qubit dsDNA HS Assay Kit Thermo Fisher Q32851 DNA quantification tool
Select Master Mix for CFX Thermo Fisher 4472952 Used to perform real-time PCR using SYBR GreenER dye.
Real-Time PCR Detection System Bio Rad 1855196 Instrument used for PCR amplification
PCR Clean-Up Kit, Axygen 10159-696 Used for efficient removal of unincorporated dNTPs, salts and enzymes
DNA 1000 Kit Agilent 5067-1504 Used for sizing and analysis of DNA fragments
MiSeq Sequencer Illumina Used for next-generation sequencing
Assorted glassware (beaker, flasks, pipettes, test tubes, repietters) VWR

DOWNLOAD MATERIALS LIST

References

  1. Potts, S. G., Biesmeijer, J. C., Kremen, C., Neumann, P., Schweiger, O., Kunin, W. E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evolut. 25, (6), 345-353 (2010).
  2. Vanengelsdorp, D., Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J Invertebr Pathol. 103, Suppl 1. S80-S95 (2010).
  3. Ellis, J. D., Evans, J. D., Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, (1), 134-136 (2010).
  4. Vanbergen, A. J. Insect Pollinators Initiative. Threats to an ecosystem service: pressures on pollinators. Front Ecol Environ. 11, (5), 251-259 (2013).
  5. Cameron, S. A., et al. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. U.S.A. 108, (2), 662-667 (2011).
  6. Szabo, N. D., Colla, S. R., Wagner, D. L., Gall, L. F., Kerr, J. T. Do pathogen spillover, pesticide use, or habitat loss explain recent North American bumblebee declines? Conser Lett. 5, (3), 232-239 (2012).
  7. Klein, A. -M., et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol]. 274, (1608), 303-313 (2007).
  8. Sánchez-Bayo, F., Goulson, D., Pennacchio, F., Nazzi, F., Goka, K., Desneux, N. Are bee diseases linked to pesticides? - A brief review. Environ Int. 89, 7-11 (2016).
  9. Kwong, W. K., Moran, N. A. Gut microbial communities of social bees. Nature Rev. Microbiol. 14, (6), 374-384 (2016).
  10. Engel, P., et al. The Bee Microbiome: Impact on Bee Health and Model for Evolution and Ecology of Host-Microbe Interactions. mBio. 7, (2), e02164-e02115 (2016).
  11. Henry, M., et al. A common pesticide decreases foraging success and survival in honey bees. Science. 336, (6079), New York, N.Y. 348-350 (2012).
  12. Pettis, J. S., vanEngelsdorp, D., Johnson, J., Dively, G. Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Die Naturwissenschaften. 99, (2), 153-158 (2012).
  13. Williamson, S. M., Wright, G. A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, (10), 1799-1807 (2013).
  14. Artz, D. R., Pitts-Singer, T. L. Effects of fungicide and adjuvant sprays on nesting behavior in two managed solitary bees, Osmia lignaria and Megachile rotundata. PLoS ONE. 10, (8), (2015).
  15. Johnson, R. M., Wen, Z., Schuler, M. A., Berenbaum, M. R. Mediation of Pyrethroid Insecticide Toxicity to Honey Bees (Hymenoptera: Apidae) by Cytochrome P450 Monooxygenases. J. Econ. Entomol. 99, (994), 1046-1050 (2006).
  16. Pilling, E. D., Bromleychallenor, K. A. C., Walker, C. H., Jepson, P. C. Mechanism of synergism between the pyrethroid insecticide lambda-cyhalothrin and the imidazole fungicide prochloraz, in the honeybee (Apis mellifera L). Pest Biochem Physiol. 51, (1), 1-11 (1995).
  17. Iwasa, T., Motoyama, N., Ambrose, J. T., Roe, R. M. Mechanism for the Differential Toxicity of Neonicotinoid Insecticides in the Honey Bee Mechanism for the differential toxicity of neonicotinoid insecticides in the honey bee, Apis mellifera. Crop Protection. (2016).
  18. Mullin, C. A., et al. High levels of miticides and agrochemicals in North American apiaries: implications for honey bee health. PLoS One. 5, (3), e9754 (2010).
  19. Pettis, J. S., Lichtenberg, E. M., Andree, M., Stitzinger, J., Rose, R., Vanengelsdorp, D. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS One. 8, (7), e70182 (2013).
  20. David, A., et al. Widespread contamination of wildflower and bee-collected pollen with complex mixtures of neonicotinoids and fungicides commonly applied to crops. Environ Int. 88, 169-178 (2016).
  21. Zhu, W., Schmehl, D. R., Mullin, C. A., Frazier, J. L. Four common pesticides, their mixtures and a formulation solvent in the hive environment have high oral toxicity to honey bee larvae. PLoS One. 9, (1), e77547 (2014).
  22. Simon-Delso, N., Martin, G. S., Bruneau, E., Minsart, L. A., Mouret, C., Hautier, L. Honeybee colony disorder in crop areas: The role of pesticides and viruses. PLoS ONE. 9, (7), (2014).
  23. Park, M. G., Blitzer, E. J., Gibbs, J., Losey, J. E., Danforth, B. N. Negative effects of pesticides on wild bee communities can be buffered by landscape context. Proc R Soc Lond [Biol]. 282, (1809), (2015).
  24. van Engelsdorp, D., et al. "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J Invertebr Pathol. 101, (2), 147-149 (2009).
  25. Bernauer, O. M., Gaines-Day, H. R., Steffan, S. A. Colonies of bumble bees (Bombus impatiens) produce fewer workers, less bee biomass, and have smaller mother queens following fungicide exposure. Insects. 6, (2), 478-488 (2015).
  26. Tu, C. M. Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Health B. 28, (B28), 67-80 (1993).
  27. Huang, C. -Y., Ho, C. -H., Lin, C. -J., Lo, C. -C. Exposure effect of fungicide kasugamycin on bacterial community in natural river sediment. J Environ Sci Health B. 45, (5), 485-491 (2010).
  28. Artigas, J., et al. Effects of the fungicide tebuconazole on microbial capacities for litter breakdown in streams. Aquat. Toxicol. 122, 197-205 (2012).
  29. Goerzen, D. W. Microflora associated with the alfalfa leafcutting bee, Megachile rotundata (Fab) (Hymenoptera: Megachilidae) in Saskatchewan, Canada. Apidologie. 22, (5), 553-561 (1991).
  30. Anderson, K. E., Sheehan, T. H., Eckholm, B. J., Mott, B. M., DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux. 58, (4), 431-444 (2011).
  31. Crotti, E., et al. Microbial symbionts of honeybees: a promising tool to improve honeybee health. N. Biotechnol. 30, (6), 716-722 (2013).
  32. Koch, H., Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. U.S.A. 108, (48), 19288-19292 (2011).
  33. Anderson, K. E., et al. Microbial ecology of the hive and pollination landscape: bacterial associates from floral nectar, the alimentary tract and stored food of honey bees (Apis mellifera). PloS One. 8, (12), e83125 (2013).
  34. Evans, E. C., Spivak, M. Effects of Honey Bee (Hymenoptera: Apidae) and Bumble Bee (Hymenoptera: Apidae) Presence on Cranberry (Ericales: Ericaceae) Pollination. J Econ Entomol. 99, (3), 614-620 (2006).
  35. Goulson, D., et al. Can alloethism in workers of the bumblebee, Bombus terrestris, be explained in terms of foraging efficiency? Anim. Behav. 64, (1), 123-130 (2002).
  36. ThermoFisher Scientific. User Guide: Qubit dsDNA HS Assay Kits. Available from: https://tools.thermofisher.com/content/sfs/manuals/Qubit_dsDNA_HS_Assay_UG.pdf 3-6 (2010).
  37. Khadempour, L., LeMay, V., Jack, D., Bohlmann, J., Breuil, C. The Relative Abundance of Mountain Pine Beetle Fungal Associates Through the Beetle Life Cycle in Pine Trees. Microbial Ecol. 64, (4), 909-917 (2012).
  38. Dorn-In, S., Hölzel, C. S., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J. PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products. Int J Food Microbiol. 162, (1), 71-81 (2013).
  39. Klindworth, A., et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, (1), (2013).
  40. White, T., Bruns, T., Lee, S., Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18, (1), 315-322 (1990).
  41. Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Available from: http://ngs.biodiv.tw/NGSCore/wp-content/uploads/Documents/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  42. Kõljalg, U., et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 22, (21), 5271-5277 (2013).
  43. Wang, Q., Garrity, G. M., Tiedje, J. M., Cole, J. R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 73, (16), 5261-5267 (2007).
  44. Team, R. C. R: A language and environment for statistical computing [Computer software]. R Foundation for Statistical Computing. Vienna, Austria. (2015).
  45. Kaltenpoth, M., Engl, T. Defensive microbial symbionts in Hymenoptera. Funct Ecol. 28, (2), 315-327 (2014).
  46. Gerth, M., Saeed, A., White, J. A., Bleidorn, C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 91, (6), (2015).
  47. Smith, C. J., Osborn, A. M. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 67, (1), 6-20 (2009).
  48. Kim, M., Morrison, M., Yu, Z. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods. 84, (1), 81-87 (2011).
  49. DeSantis, T. Z., et al. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, (7), 5069-5072 (2006).
  50. Langille, M. G. I., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature Biotechnol. 31, (9), 814-821 (2013).
  51. Malik, S., Beer, M., Megharaj, M., Naidu, R. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environ Int. 34, (2), 265-276 (2008).
  52. Ladurner, E., Bosch, J., Kemp, W. P., Maini, S. Assessing delayed and acute toxicity of five formulated fungicides to Osmia lignaria and Apis mellifera. Apidologie. 36, (3), 449-460 (2005).
  53. Huntzinger, C. I., James, R. R., Bosch, J., Kemp, W. P. Fungicide Tests on Adult Alfalfa Leafcutting Bees (Hymenoptera: Megachilidae). J Econ Entomol. 101, (4), 1088-1094 (2008).
  54. Gradish, A. E., Scott-Dupree, C. D., Shipp, L., Harris, C. R., Ferguson, G. Effect of reduced risk pesticides for use in greenhouse vegetable production on Bombus impatiens (Hymenoptera: Apidae). Pest Manag. Sci. 66, (2), 142-146 (2010).
  55. Calderone, N. W. Insect pollinated crops, insect pollinators and US agriculture: trend analysis of aggregate data for the period 1992-2009. PloS One. 7, (5), e37235 (2012).
  56. Ollerton, J., Winfree, R., Tarrant, S. How many flowering plants are pollinated by animals? Oikos. 120, (3), 321-326 (2011).
Empírica, Metagenomic e técnicas computacionais iluminam os mecanismos pelos quais fungicidas compromisso abelha saúde
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).More

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter