Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Афалин (Tursiops truncatus) Дельфин сперматозоидов: сбор, криоконсервация и гетерологичных В экстракорпорального оплодотворения

doi: 10.3791/55237 Published: August 21, 2017

Summary

Здесь мы представляем протоколы, которые успешно использовались для сбора сперматозоидов Дельфин, криоконсервация и гетерологичных эко производительности с помощью бычьего ооцитов.

Abstract

Использование Дельфин Криоконсервированные сперматозоидов облегчает обмен генетического материала между водных парков и делает доступными для лаборатории для исследования для дальнейшего понимания воспроизводства морских млекопитающих сперматозоидов. Гетерологичных Эко, замена для гомологичных Эко, может служить средством для тестирования фертильности спермы потенциал; Изучение физиологии гамет и раннего развития эмбрионов; и чтобы избежать использования ценных Дельфин ооцитов, которые трудно получить. Здесь мы представляем протоколы, которые были успешно использованы для сбора и криоконсервировать Дельфин сперматозоидов. Коллекция спермы производится ручной стимуляции на подготовленных дельфинов. Криоконсервация осуществляется с помощью медиаприставки трис-желток яйца на основе с глицерином. Кроме того мы представляем протокол, который описывает гетерологичных ЭКО с использованием Дельфин сперматозоидов и говядину ооцитов и что проверяет гибридный характер полученный эмбрион с помощью ПЦР. Гетерологичных оплодотворение поднимает вопросы на оплодотворение и может использоваться в качестве инструмента для изучения физиологии гамет и раннего эмбрионального развития. Кроме того успех гетерологичных эко демонстрирует потенциал этой техники для тестирования Дельфин спермы подкормки потенциала, который заслуживает дальнейшего изучения.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Вспомогательные репродуктивные технологии слабо развиты в диких животных, включая морских млекопитающих. Отсутствие чувствительных методов оценки спермы подкормка успех способствует медленного развития репродуктивных технологий в таких видов, как дельфин. Он не был до недавнего времени основные параметры семенных афалины (Tursiops truncatus) были сообщил1,2. Однако такие переменные, как подвижность и морфологии, хотя широко используется, дают ограниченную информацию о репродуктивной эффективности. Лучшим показателем качества спермы является оценка возможностей внесения удобрений.

Недавно наша группа используется метод для оценки Дельфин спермы подкормки потенциал путем оценки мужской pronuclear формирования и/или гибридных формирование эмбриона после гетерологичных ЭКО с использованием zona нетронутыми говядину ооцитов3. Использование Дельфин говядину гетерологичных эко имеет важные преимущества над гомологичных Эко, как он преодолевает трудности получения Дельфин ооцитов и облегчает использование систем испытанный в vitro говядину яйцеклетка созревания. Во избежание видов специфика гетерологичных оплодотворение обычно выполняется в отсутствие ZP. Хотя это позволяет для оценки способности отреагировали Акросома сперматозоидов предохранитель с vitelline мембраной, он повреждает оценки других функций, связанных с оплодотворения. Процедура, описанная использует zona нетронутыми ооцитов и позволяет оценку следующих параметров: спермы zona привязки и привязанности, проникновения, polyspermy, pronuclear формирования и гибридные расщепления эмбрионов.

Здесь мы представляем несколько протоколов для сбора семени, анализ основных спермы, замораживание сперматозоидов, а также оценки Дельфин спермы функциональность путем оценки мужской pronuclear и/или гибридных формирование эмбриона после гетерологичных ЭКО с использованием zona нетронутыми говядину ооцитов.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

этика заявление: все экспериментальные процедуры были рассмотрены и одобрены институциональный уход животных и использование Комитета Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (МИС). Все эксперименты были проведены в соответствии с руководство по уходу и использованию лабораторных животных, принятые обществом для изучения воспроизводства и Закон о благосостоянии животных за заботу о морских млекопитающих.

1. Дельфин сбора спермы и криоконсервацию

среднего
  1. Подготовка
    1. сделать FERT (гепарин - и hypotaurine бесплатно). Подготовка среднего FERT-TALP, дополненный бикарбонат 25 мм, 22 мм натрия лактата, пируват натрия 1 мм, BSA свободных жирных кислот 6-мг/мл и 10 мг/мл гепарина (рН 7,4).
      Примечание: Подготовить это средство в день использования и держать его в 38,5 ° C под атмосферу 5% CO 2 и в воздухе с максимальной влажностью для по крайней мере 2 ч перед использованием.
    2. Подготовить трис яичный желток-буфера на основе. Распустить 30.28 г/Л трис, 16,75 г/Л лимонной кислоты, фруктоза 12,5 г/Л и 0,5 г/Л стрептомицина в ультрачистая вода (pH 7,3, осмоляльность = 310 мОсм/кг). Добавить яичный желток 20% (v/v).
  2. Поезд проверенные разведения мужской афалины лежат в спинной recumbence у края бассейна для сбора добровольных спермы.
    Примечание: Мужчин дельфин должны быть обучены более 6 месяцев, положительное подкрепление, как описано ранее 4.
  3. Выполнять различные тактильную стимуляцию, осторожно нажав на черепной области половых паз дельфина добиться добровольного экструзии пениса от половых groove.
  4. После достижения полной эрекции, прямые кончик пениса в стерильный контейнер для получения эякулята.
  5. Сохранить образец спермы при 37 ° C до анализа. Повторите шаги 1.3 и 1.4 для последовательных эякулята коллекции, используя новое стекло пропилена каждый раз.
  6. Сразу же после сбора, определить громкость с помощью градуированный стеклянный цилиндр, ранее прогреты до 37 ° C. Evaluate цвет, рН и осмолярности (с помощью микро осмометре) эякулята.
  7. Для оценки концентрации сперматозоидов в эякуляте, добавить 10 мкл суспензии спермы eppendorf тубы 90 мкл дистиллированной воды. Определение концентрации сперматозоидов, с использованием спермы, считая камеры.
    Примечание: В ходе оценки, держите остальная часть эякулята в 37 ° C.
  8. Оценки параметров подвижности.
    1. Взять 10 мкл пример спермы и поместить его в камере подогретым спермы.
    2. Оценки подвижности, используя систему анализа спермы, компьютерный, ранее проверены для афалины, объективно оценить подвижности спермы 2.
      Примечание: При необходимости разбавляют образца спермы с FERT среднего (гепарин - и hypotaurine бесплатно) для адекватной визуализации сперматозоидов. В ходе оценки, сохранить образец при 37 ° C подогревом микроскопа.
  9. Взять 20 мкл пример спермы и оценить жизнеспособность и спермы морфология как описано 5.
  10. Передача спермы для пластиковых пробирок. Центрифуга для образца спермы в 250 g x 5 мин. После определения концентрации сперматозоидов, с помощью Счетной палаты, отрегулировать концентрация сперматозоидов до 400 x 10 6 сперматозоидов/мл.
    Примечание: При необходимости разбавляют лепешка из концентрированной эякуляции с изолированной семенной плазмы от избыточного объема эякулята же центрифугированием (250 x g, 10 мин).
    1. В течение 5 мин, медленно разбавить сперму образец 1:1 (v/v) с трис яйцо желток буфера на основе содержащего 1,5% глицерина. Место трубка, содержащая спермы подвеска на 5 ° C в течение 1 ч 30 мин
    2. Выполнить второй разбавления спермы подвеска с трис яичный желток основе буфер, содержащий глицерин для получения окончательного глицерин концентрации 3% и конечная концентрация 200 x 10 6 сперматозоидов/мл. Поддерживать спермы подвеска на 5 ° C в течение 10 мин
  11. Загрузить подвеска спермы в 0,25 мл соломинки. Выпотрошенного соломинки. Место соломки в стойку 4,5 см выше жидкого азота для 10 минут окунуться соломинки в жидкий азот и хранить до оценки.

2. Гетерологичных In Vitro оплодотворение с помощью Zona нетронутыми говядину ооцитов

  1. Подготовка
    1. подготовить окрашивание раствора и монтажа среднего.
      1. Подготовить Hoechst Стоковый раствор путем растворения Hoechst 1 мг в 1 мл дистиллированной воды. Сделать 30 мкл аликвоты и держать их в темноте при температуре-20 ° C до использования. Подготовьте окрашивание раствора путем добавления 25 мкл Hoechst Стоковый раствор 5 мл фосфат амортизированное saline (PBS) дополнены 1 г/Л ПВА. Хорошо перемешать и хранить в темноте при температуре 4 ° C до использования.
      2. Подготовка монтажа среднего, смешивая 6,25 мл PBS с 6.25 мл глицерина и 6,25 мкл Hoechst Стоковый раствор. Хорошо перемешать и хранить в темноте при температуре 4 ° C до использования.
    2. Подготовить среды для сбора и в пробирке оплодотворения ооцитов.
      1. Подготовить физиологический раствор, добавив гентамицина 0,5 мл 0,9% NaCl дистиллированной воды.
      2. Подготовить складе созревания средний, добавив 10 нг/мл эпидермального фактора роста (EGF) и 10% плода телячьей сыворотки (FCS) до 10 мл TCM-199. Поддерживать оба СМИ на 38,5 ° C под атмосферу 5% CO 2 и в воздухе с максимальной влажностью для по крайней мере 2 ч перед использованием.
  2. Собирать яичников на бойню в солевой раствор на 33-35 ° C и транспортировки их в лабораторию в течение 4 ч от коллекции.
  3. Раз в лаборатории, мыть яичников три раза для удаления мусора и крови с помощью физиологический раствор, ранее прогреты до 37 ° C. поддерживать яичников в солевой раствор при 37 ° C во время процесса.
  4. 10-мл шприцев и
  5. фолликулов аспирата 2 до 8 мм с 18G. Собирать без наддува фолликулярной жидкости в 50 мл трубки.
  6. Позволяют фолликулярной жидкости, содержащие ооциты стоять около 15 минут при 37 ° C, до клетки отложений. Удалить супернатант трубку с пипетка Пастера и вновь приостановить гранулы в PBS.
  7. Восстановить кучевые ооцитов комплексы (КОК) в 90 мм блюда под стереомикроскопом.
  8. Мыть Кок три раза в PBS и один раз в среде созревания.
  9. Передачи морфологически нормальных Кок блюд 4-хорошо, хорошо содержащих 500 мл среднего созревания, группами по 50 Кок за хорошо.
    Примечание: Здесь, три скважины – одной скважиной для гетерологичных Эко, один элемент управления хорошо для гомологичных ЭКО и один, также содержащие только созрела Кок как элемент партеногенетических – были использованы.
  10. Инкубировать Кок для 24 ч составляет 38,5 ° C под атмосферу 5% CO 2 и в воздухе с максимальной влажностью.
  11. Подготовить среды и градиент плотности.
    1. Подготовить оплодотворение среднего (FERT), дополнение FERT-TALP среде с бикарбонат 25 мм, 22 мм натрия лактата, пируват натрия 1 мм, BSA свободных жирных кислот 6 мг/мл и 10 мг/мл гепарина. Сохранить на 38,5 ° C под атмосферу 5% CO 2 и в воздухе с максимальной влажностью для по крайней мере 2 ч перед использованием.
    2. Подготовить градиент плотности, добавив 1 мл раствора градиент средней плотности 15 мл и 3 мл моющего раствора до 15 мл. Поддерживать их на 38,5 ° C для по крайней мере 1 ч.
  12. Мыть в vitro созрел ооциты дважды в среде Г.Г.
  13. Передавать яйцеклеток блюд 4-хорошо, каждый хорошо содержит 50 Кок в 250 мл Г.Г. Поддерживать 4-ну блюда на 38,5 ° C под атмосферу 5% CO 2 и в воздухе с максимальной влажностью при подготовке спермы для оплодотворения.
  14. Оттепель замороженных соломы, содержащий Дельфин сперматозоидов в водяной бане при 37 ° C 50 s.
    Примечание: Говядину спермы для гомологичных эко должны обрабатываться параллельно, после стандартный протокол для гомологичных говядину IVF.
  15. Взять 10 мкл спермы образца и поместите его в подогретым спермы, считая камеры. Оценка подвижности, используя систему анализа спермы, компьютерный, ранее проверены для видов, чтобы объективно оценить сперматозоидов. В это время, сохранить образец спермы на 38,5 ° C.
  16. Добавить спермы в трубку градиента плотности (шаг 2.10.2). Центрифуги для 10 мин на 250 x г.
  17. Тщательно удалить супернатант с помощью пипетки Пастера. Добавьте 3 мл моющего раствора в пробирку, содержащую гранулы. Вновь приостановить гранулы, аккуратно смешивая.
  18. Центрифуги для 5 мин на 250 x g. удалить супернатант с пипетка Пастера спермы объемом 300 мкл.
  19. Добавить 5 мкл спермы подвески к microcentrifuge, содержащих 95 мкл дистиллированной воды. Поддерживать спермы подвеска на 38,5 ° C. Fill подсчета клеток камеры с 10 мкл в 1:20 разбавления спермы и измерения концентрации. Рассчитать количество FERT среды, которые должны быть добавлены к 100 мкл спермы для получения 2 х 10 6 сперматозоидов/мл.
  20. Добавить вычисляемый А.ФЕРОМ и спермы тома в 15 мл и осторожно перемешать с помощью пипетки Пастера.
  21. Добавить 250 мкл спермы FERT подвески для каждой скважины блюдо 4-хорошо, содержащие FERT средних с созрели яйцеклеток для получения конечной концентрации сперматозоидов/мл, 1 x 10-6.
  22. Совместного инкубировать гамет для 18 h на 38,5 ° C под атмосферу 5% CO 2 и в воздухе с максимальной влажностью.
  23. Подготовить питательной среды на основе синтетических oviductal жидкости, дополнена 5% FCS. Подготовка 25 мкл синтетических oviductal жидкости культуры капель в 35-мм блюда с 3 мл минерального масла. Сохранить на 38,5 ° C под атмосферу 5% CO 2 и в воздухе с максимальной влажностью для по крайней мере 2 ч перед использованием.
  24. На 2,5 ч пост совместного инкубации, удалить 20 яйцеклеток из блюдо; сохранить остальные ооциты в инкубаторе на тех же условиях.
    1. Удалить слабо прилагаемый сперматозоидов, энергично закупорить половина яйцеклеток через пипетку Pasteur УЗК родила 10 раз.
    2. Исправить 20 яйцеклеток в 50 мкл глютаральдегид 0,5% для 30 min. мыть яйцеклеток в PBS на 5 мин передачи яйцеклеток для 50-мкл Hoechst окрашивание раствора 15 мин и мыть яйцеклеток в PBS на 5 мин
    3. Яйцеклеток индивидуально передать 2 мкл капельки монтажа среды со скоростью 10 яйцеклеток на слайд. Аккуратно крышка с coverslip и уплотнение с лак.
    4. Количество сперматозоидов, придает говядину ооцитов, с помощью микроскопа фазово контрастной с epifluorescent оптикой и 361 Нм фильтра возбуждения на 40 кратном.
  25. После 12 h совместно инкубации, удалить 10 предполагаемого зигот из блюд 4-ну; сохранить оставшиеся предполагаемого зигот в инкубаторе на тех же условиях.
    1. Передачи 10 предполагаемого зигот на центрифугу 15 мл трубки содержащий 2 мл PBS и вихревой мягко в течение 2 мин, чтобы удалить кучевые клетки. Мыть дважды в PBS, исправить и пятно, как описано выше (шаг 2.23.2.)
  26. , После 18, 20, 22 и 24 h совместно инкубации, удалите 10 предполагаемого зигот от 4-ну блюда и вихря, исправить и выведение их как описано выше (шаг 2.23.2). Сохранить остальной части предполагаемого зигот в инкубаторе на тех же условиях.
    1. Оценить pronuclear формирования и polyspermy под микроскопом этап контраст/epifluorescent в гомологичных и гетерологичных эко групп путем пятнать с Hoechst.
    2. Оценить pronuclear формирование в 10 случайно выбранных предполагаемого гибрид зигот на сэмпл. Подтвердить pronuclear формирования под конфокальное лазерное сканирование Микроскоп на аргон 488 нм лазер возбуждения и 515 до 530 Нм обнаружения.
    3. Оптически раздел предполагаемого зигот последовательно (2 мм) и собирать изображения с помощью визуализации программного обеспечения. Визуализировать, используя пакет программного обеспечения 3D анализа.
    4. После 24 ч Сопредседатель инкубации, мыть 50 предполагаемого зигот четыре раза в PBS и дважды в среде культуры.
  27. Передать их в группы 25 microdroplets питательной среды ранее подготовленных и достижение равновесного уровня.
  28. Обслуживание на 38,5 ° C под атмосферу 5% O 2 / 5% CO 2 и в воздухе с максимальной влажностью.
  29. После 26 и 28 h совместно инкубации, удалите 10 предполагаемого зигот из блюда и вихревые, исправить и выведение их, как описано выше (шаг 2.23.2).
  30. После 48 ч культуры, наблюдать расщепление под стереомикроскопом.
  31. Удалить вителлинового (ZP), перенос эмбрионов до 5 мг/мл раствора протеазы.
  32. Индивидуально мыть каждый эмбрион три раза в PBS. Snap заморозить их в жидком азоте в 0,2 мл пробирок microcentrifuge. Хранить их при температуре-80 ° C до анализа.

3. ПЦР

  1. материалы и реагенты
    Примечание: Реагенты, материалы и оборудование, используемое для выполнения протокол PCR, подробно изложены в таблице материалов и включают в себя стойку трубки ПЦР и набор micropipettes (P2, P20, Р200, P1000), 1,5 мл Microcentrifuge трубы, трубы ПЦР и шапки, тепловая велосипедист, УФ осветитель, геля агарозы и буфера (Tris Борат ЭДТА (КЭ)).
    1. Нежно оттепель все реагенты на льду. Поддерживать их во льду на протяжении всего эксперимента. Используйте deoxynucleotides (дНТФ; dATP, дЦТФ, dTTP и dGTP), цель грунтовки на ссылку кодирования гена белка рибосомальной S Дельфин 18 (DQ404537.1); R1: TTGGACACACCCACGGTGCGG и F2: CAGAAGGACGTGAAGGATGGA), ДНК-полимеразы, 5 X буфер для ДНК-полимеразы, шаблон ДНК, стерильной воды и хлорида магния (2 MgCl в конечной концентрации 5,0 мм).
    2. Подготовка геля и образец
    3. агарозы.
      1. Подготовить Дельфин и бычьего спермы ДНК образцов.
        1. Оттепель замороженных соломы каждого вида в водяной бане при 37 ° C 50 s. Добавить 3 мл моющего раствора. Центрифуга на 250 x g 10 мин удалить супернатант. 30 мкл буфера lysis STES (50 мм трис-HCl, рН 8; 20 мм NaCl; и 0.1% SDS 1 мм), 2 мкл протеиназы K (20 мг/мл) и 5 мкл Дитиотреитол (DTT); конечная концентрация: 150 мм. На ночь поддерживать на 55 ° C. добавить 200 мкл ультрачистая вода. Центрифуга на 250 x g 5 мин держать супернатант. Измерение концентрации ДНК, используя спектрофотометр.
      2. Выполняют серийных разведений ДНК от Дельфин сперматозоидов (т.е., 40, 4 и 0,4 нг/мл) с ультрачистая вода для проверки, что условия PCR способны Обнаружение небольшое количество Дельфин ДНК.
      3. Выполнять серийных разведений говядину спермы ДНК (т.е., 4000, 400, 40 и 4 нг/мл) с ультрачистая вода для проверки, что условия PCR способны обнаруживать небольшое количество рогатого ДНК.
      4. Подготовить Дельфин и бычьего эмбрионов. Размораживание эмбрионов на льду. Мкл 8 100 µg/mL протеиназы K и поддерживать на ночь при 55 ° C. Чтобы остановить реакции, поместите образцы на 96 ° C за 5 мин
      5. Подготовить 2% гель агарозы КЭ буфера и 20 мкл пятен нуклеиновой кислоты, с использованием стандартных методик.
    4. Подготовка ПЦР.
      1. Label ПЦР трубки: Дельфин серийных разведений (40, 4 и 0,4 нг/мл), говядину серийных разведений (4000, 400, 40 и 4 нг/мл), гомологичных говядину двухкамерные эмбриона, двухкамерные предполагаемого гетерологичных эмбрионов и отрицательный контроль.
      2. Подготовка мастер смеси в стерильных microcentrifuge 1,5 мл трубку в окончательный объем 25 мкл в реакции.
        1. Добавить 5 мкл 5 X ДНК полимеразы flexi буфера, 0.5 мкл дНТФ (10 мм) 1.5 мкл MgCl 2 (25 мм), 0.5 мкл прямого и обратного праймера (10 мкм), 1,5 мкл ДНК шаблона (спермы) или 8 мкл ДНК шаблона (два клеток эмбрионов) , 0,07 мкл Taq-полимеразы и стерильной дистиллированной водой до 25 мкл окончательный объем. Хорошо перемешайте.
  2. Усилители протокол
    1. место трубы в тепловая велосипедист. Выберите следующую программу: 94 ° C 3 мин; 40 циклов 94 ° C 15 s, 59 ° C 25 s, 72 ° C для 20 s; и 72 ° C для 5 минут запустить программу.
    2. Хранить трубы на 4 ° C. добавить 2,5 мкл загрузки буфера для каждого продукта ПЦР на 4 ° C и нагрузке 15 мкл смеси в скважины 2% агарозном геле. Используйте маркер лестница ДНК для оценки точных размеров ПЦР фрагментов.
    3. Электрофорез выполнять за 15 минут, чтобы позволить ДНК миграции. Визуализируется полос с использованием УФ осветитель.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Все результаты, таблицы и цифры (1 и 2), представленные здесь, были воспроизведены с разрешением3.

Дельфин сперматозоидов имеют высокую подвижность после замораживания и оттаивания

Эякуляции деконсервированных Дельфин показал в процентах (% ± SD) 84,5 ± 5,3 всего подвижные и 69.1 ± 5.1 прогрессивного подвижных сперматозоидов. В терминах моторики эти цифры являются представитель высокого качества Криоконсервированные сперматозоидов.

Дельфин сперматозоиды способны проникающего zona нетронутыми говядину ооцитов и производство гибридных зародышей

Рисунок 1A и таблице 1 показать Дельфин сперматозоидов, придает говядину ZP после 2,5 ч. Сопредседатель инкубации. Дельфин сперматозоидов были прикреплены на более высокий процент, чем бычий сперматозоидов (рис. 1B и Таблица 1). Действительно флуоресцентной микроскопии показывает, что дельфин сперматозоиды способны проникать zona нетронутыми говядину сперматозоидов (рис. 1 c), ведущих к pronuclear формирования и расщепления (Рисунок 1E и Таблица 1). Это было подтверждено confocal микроскопии (рис. 1 d и Рисунок 1F). Не polyspermy наблюдалось в яйцеклеток из группы гетерологичных эко после 12 h совместно инкубации (Таблица 1). Pronuclear формирование в гетерологичных эко достигли самый высокий процент на 24 ч, больше времени, чем в группе гомологичных, которое произошло в 18 h совместно инкубации (Таблица 1). Скорость расщепления на 48 ч после инкубации была ниже в гетерологичных гомологичных Эко (Таблица 1). Спонтанное партеногенетических активации ставкой 8,0% наблюдался в бычий созрели неоплодотворенных яйцеклеток на 48 ч (Таблица 1).

Наконец, ПЦР результаты подтвердили наличие Дельфин генетического материала в гибридных зародышей (рис. 3), оценивая наличие Дельфин ссылка ген, который кодирует для рибосомальной 18 S белка (рис. 2).

Figure 1
Рисунок 1: Дельфин сперматозоидов придает говядину вителлинового (ZP). Прилагаемый Дельфин (A) и крупного рогатого скота (B) сперматозоидов после 2,5 ч Сопредседатель инкубации с zona нетронутыми говядину ооцитов. Гамет были окрашенных с Hoechst и визуализированы под микроскопом фазово контрастной (40 кратном). Дельфин сперматозоидов в periviteline пространстве говядину ооцитов (C и D) и decondensing Дельфин сперматозоида в цитоплазму говядину ооцитов (E). Изображения были захвачены в плен под конфокального микроскопа и соответствуют Экваториальная плоскость предполагаемого зиготы (Hoechst пятнать; 40 кратном). Два pronuclei (F) наблюдать под микроскопом контраст фазы после 24 ч гетерологичных Эко, состоящий из совместного инкубации Дельфин сперматозоидов с zona нетронутыми говядину ооцитов (Hoechst пятнать; 40 кратном; Шкалы бар = 25 мкм). Этот показатель был воспроизведен из3 ссылка с разрешения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: представитель электрофореза (агарозы 2% гель ethidium бромид витражи) показаны результаты амплификации PCR для 18 S Дельфин ген. 1 полосы до 30 Показать предполагаемого Дельфин/говядину гибридные эмбрионы; полос, S1 и S2 оснащены 4 нг/мл и 0,4 нг/мл спермы Дельфин ДНК, соответственно; и полос C1 к C5 двухкамерные Эмбрионы крупного рогатого скота и H2O (вода) (пустой элемент управления). Стрелка указывает соответствующую усиленные 18 S группа 190-ВР рДНК. Этот показатель был воспроизведен из3 ссылка с разрешения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: представитель изображения гибридных зародышей. Представитель изображения гибридных двухкамерные эмбриона (A) на 48 ч инкубации (Hoechst пятнать; 40 кратном). Безупречная гибридные эмбрионы в 48ч инкубации, на разных стадиях деления, визуализированы под стереомикроскопом (B). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Table 1
Таблица 1: показатели вложений, polyspermy, pronuclear формирования и расщепление после гомологичных и гетерологичных Сопредседатель инкубации с говядину яйцеклеток и сперматозоидов говядину или Дельфин, соответственно. Переменные были проанализированы с ANOVA (тест Крускала-Уоллиса и Манна-Уитни). Значения выражаются в виде среднее ± SEM (диапазон) двенадцати реплицирует; n = общее количество яйцеклеток или предполагаемого зигот изучены. Таблица воспроизводится от3 ссылка с разрешения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Для многих различных видов млекопитающих есть разнообразные преимущества использования деконсервированных спермы. К ним относятся возможность передачи ценный генетический материал, потенциал для распространения во всем мире, низкий риск загрязнения и возможность сохранения мужских гамет на протяжении десятилетий. Использование криоконсервированных спермы важно для афалины, потому что этот вид охраняется приложение II СИТЕС, который ограничивает транспорта и обмена животных между различных водных парков. Дельфины транспорт представляет собой деятельность, которая создает материально-технические проблемы и опасные риски. Однако воздерживаться от их транспортировки имеет также последствия, такие, как риск введения родства к неволе популяции животных. Одним из решений является криоконсервация спермы. Некоторые авторы криоконсервированных Дельфин спермы5,,78,9, с весьма обнадеживающие результаты. Кроме того в 2005 году, сообщил10был первый рождение дельфинов теленка, задуманный искусственного осеменения с использованием криоконсервированных спермы. Несколько лет спустя, это было сделано с помощью секс сортировка сперматозоидов11.

Дельфин спермы были криоконсервированных с использованием различных методов, от сложные методы, такие как программируемые морозильник5общих методов, таких, как сухой лед12 или жидкого азота паров,2,9 13. Основным преимуществом использования сухой лед или жидкий азот паров является возможность криоконсервировать в том же месте, где добывается спермы, без использования высоко специализированного оборудования. Сперма, замороженные в соломинки на полистирол в жидком азоте паров является простой, быстрый и недорогой метод13. На практике когда эта методология была использована на дельфинов, сперматозоидов был 65%. Однако, важно рассмотреть, как это трудно разработать стандартизированный метод: техника может быть под влиянием внешних факторов, таких как температура, влажность, полистирола размер и т.д. Таким образом необходимы дальнейшие исследования для оптимизации и стандартизировать процедуры для того, чтобы улучшить успех с использованием спермы, замороженные с методом пара жидкого азота.

Чтобы оптимизировать замораживания протокол, важно разработать надежный метод для оценки функциональных сперматозоидов. Эко-хорошее средство тестирования спермы, потенциал для оплодотворения. В идеале Дельфин ооциты должны использоваться для проведения ЭКО, но сложной и трудоемкой процедуры, необходимые для получения ооцитов от женщин представляют собой важные ограничения. Таким образом возможность использования гетерологичных эко открывает новые средства для тестирования эффективности удобрений в дельфина. Ооциты от других видов может использоваться для гетерологичных Дельфин Эко. Результаты показывают, что гетерологичных эко между говядину яйцеклеток и сперматозоидов Дельфин может быть выполнена. Замороженные и талой Дельфин сперматозоидов проникают zona нетронутыми говядину ооцитов и создавать гибридные эмбриона.

Представлены комбинации протоколов для сбора, замораживания оттаивания, гетерологичных ЭКО с бычьим ооциты успешно продемонстрировали и представляет собой начальный шаг для оптимизации криоконсервирования и оценки Дельфин спермы. Важно отметить, что есть еще много неизвестного в этих процедурах. Однако способность к криоконсервации спермы Дельфин делает его доступным и позволяет ему находиться в лабораториях. Это будет способствовать научные исследования и может привести к глубокому пониманию физиологии, композиции и поведения сперматозоидов.

При оценке спермы, гетерологичных ЭКО может облегчить оптимизации замораживания протоколов, но он может также использоваться в будущем для тестирования и выберите мужчины для плодородия эффективности. Одним важным соображением является связь между реальной оплодотворение чисел и гетерологичных эко значений. Кроме того и из-за новизны гетерологичных эко между этими двумя видами филогенетически далеких, говядину и Дельфин новых биологических гипотезы могут быть построены. Вообще эти протоколы открыть новое пространство для исследований на воспроизводство дельфинов и других морских млекопитающих.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

его работа финансировалась министерством экономики и конкурентоспособности (AGL2015-70140-R для D. Rizos), AGL2015-66145R A. Гутьеррес-Адан и J. F. Перес-Гутьеррес и Сенека фонд Мурсия (20040 Грант/ЗАРОДЫШЕЙ/16 до F. Гарсия-Васкес)

Materials

Name Company Catalog Number Comments
FERT-TALP medium Merck
TCM-199 Sigma M-4530
Hoechst 33342 Sigma B-2261
4-well dishes Nunc 176740
Density gradient BoviPure Nidacon International BP-100
Washing solution Boviwash Nidacon International BW-100
Magnesium chloride Promega A35 1H
Sterile water Mili Q sintesis A10 Millipore A35 1H
Buffer Tris Borate EDTA Sigma T4415
MB agarose Biotools 20.012
5X GoTaq flexi buffer Mili Q sintesis A10 Millipore M 890 A
MB agarose Biotools 20.012
Taq polymerase Promega
SafeView NBS Biologicals Ltd. M 890 A
Makler counting chamber Sefi Medical
Thoma chamber Hecht-Assistant
pHmeter MicropH 2000 Crison Instruments
Osmometer Advanced micro osmometer 3300 Norwood
Computer assisted sperm analysis system Projectes y Serveis R+D
Stereomicroscope MZ 95 Leica
Epifluorescent optics Eclipse Te300 Nikon
Confocal assistant 4.02 software Bio-Rad 3D analysis software
Confocal laser scanning microscopy Bio-Rad
Micropippetes (P2. P20, P200, P1000) Gilson
Microcentrifuge tubes VWR
UV iluminator Bio-Rad
PCR Thermal cycler Primus 96 Plus MWG AG Biotech

DOWNLOAD MATERIALS LIST

References

  1. Montano, G. A., et al. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. Reproduction. 143, (6), 799-813 (2012).
  2. Sánchez-calabuig, M. J., et al. Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 49, (5), 761-768 (2014).
  3. Sánchez-calabuig, M. J., et al. Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa. Theriogenology. 84, (6), 983-994 (2015).
  4. Keller, K. V. Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination. IAAAM. 14, (22), 22-24 (1986).
  5. Robeck, T. R., O'brien, J. K. Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa. Biol Reprod. 70, (5), 1340-1348 (2004).
  6. Coy, P., et al. Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow. Reproduction. 135, (1), 19-27 (2008).
  7. Seager, S., W, G., Moore, L., Platz, C., Kirby, V. Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus). Proceedings of the American Association of Zoo Veterinarians. 136, (1981).
  8. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  9. Sánchez-Calabuig, M. J., et al. Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 50, (2), 227-235 (2015).
  10. Robeck, T. R., et al. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus). Reproduction. 129, (5), 659-674 (2005).
  11. Robeck, T. R., et al. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus). Anim Reprod Sci. 139, (1-4), 168-181 (2013).
  12. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  13. Madeddu, M., et al. Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen. Anim Reprod Sci. (2016).
Афалин (<em>Tursiops truncatus</em>) Дельфин сперматозоидов: сбор, криоконсервация и гетерологичных <em>В экстракорпорального</em> оплодотворения
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).More

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter