Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Bottlenose Dolphin (Tursiops truncatus) espermatozoides: recolha, criopreservação e heterólogo fertilização In Vitro

doi: 10.3791/55237 Published: August 21, 2017

Summary

Aqui, apresentamos os protocolos que foram usados com sucesso para a coleta de espermatozoides de golfinho, criopreservação e desempenho de fertilização in vitro heterólogo usando oócitos bovinos.

Abstract

O uso de espermatozoides criopreservados golfinho facilita a troca de material genético entre parques aquáticos e torna espermatozoides acessível aos laboratórios para estudos aprofundar nossa compreensão da reprodução de mamíferos marinhos. Fertilização in vitro heterólogo, um substituto para fertilização in vitro homólogo, poderia fornecer um meio para testar a fertilidade do esperma potencial; para estudar a fisiologia de gametas e desenvolvimento precoce do embrião; e para evitar o uso de oócitos valioso golfinho, que são difíceis de obter. Aqui, apresentamos os protocolos que têm sido utilizados com sucesso para recolher e cryopreserve espermatozoides de golfinho. A colheita de sémen é executada pela estimulação manual sobre golfinhos treinados. Criopreservação é realizada usando um extensor de gema de ovo com base TRIS com glicerol. Além disso, apresentamos um protocolo que descreve a fertilização in vitro heterólogo usando espermatozoides golfinho e oócitos bovinos e que verifica a natureza híbrida do embrião resultante usando PCR. Fertilização heteróloga gera perguntas sobre fertilização e pode ser usada como uma ferramenta para estudar a fisiologia de gametas e desenvolvimento precoce do embrião. Além disso, o sucesso da fertilização in vitro heterólogo demonstra o potencial desta técnica para testar o esperma de golfinho fertilizando a capacidade, o que vale a pena o exame adicional.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tecnologias de reprodução assistida estão pouco desenvolvidas em animais selvagens, incluindo os mamíferos marinhos. A falta de métodos sensíveis para avaliar o sucesso de fertilização esperma contribui para o desenvolvimento de tecnologias de reprodução de espécies como o golfinho. Não era até recentemente que os parâmetros básicos seminais do golfinho-roaz (Tursiops truncatus) foram relatados1,2. No entanto, variáveis, tais como a motilidade e morfologia, embora amplamente utilizado, dar informações limitadas sobre a eficiência reprodutiva. O melhor indicador da qualidade do esperma é a avaliação do potencial de fertilização.

Recentemente, nosso grupo usou um método para avaliar esperma de golfinho fertilizando potencial, avaliando a formação pró-nuclear masculina e/ou formação de embrião híbrido depois da fertilização in vitro heteróloga usando oócitos bovinos intactos de zona3. O uso de fertilização in vitro heterólogo golfinho-bovinos tem vantagens importantes sobre fertilização in vitro homóloga, como ele supera a dificuldade de obtenção de oócitos de golfinho e facilita o uso do bem testado em vitro sistemas de maturação de ovócitos bovinos. Para evitar a especificidade da espécie, fecundação heteróloga é executada geralmente na ausência de ZP. Embora permite a avaliação da capacidade dos espermatozoides com acrossoma-reagiu se fundem com a membrana vitelínico, reduzes a avaliação de outras características relacionadas à fertilização. O procedimento descrito usa a zona de oócitos intacta e permite a avaliação dos seguintes parâmetros: vinculação de zona de esperma e fixação, penetração, poliespermia, formação pró-nuclear e clivagem de embriões híbridos.

Aqui, apresentamos vários protocolos para coleta de esperma, esperma básico análise, congelamento de espermatozoides, bem como a avaliação da funcionalidade do esperma de golfinho, avaliando a formação de embrião pró-nuclear e/ou híbrido masculina após a fertilização in vitro heteróloga usando zona intacta oócitos bovinos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

declaração de ética: todos os procedimentos experimentais foram revistos e aprovados pelo Comitê de uso do Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA) e institucionais Cuidado Animal. Todos os experimentos foram realizados de acordo com o guia para o cuidado e o uso de animais de laboratório, tal como adoptadas pela sociedade para o estudo da reprodução e para o Animal Welfare Act para cuidar dos mamíferos marinhos.

1. coleção de esperma de golfinho e criopreservação

  1. preparação
    1. fazer FERT médio (heparina e hypotaurine-livre). Preparar suplementado FERT-TALP com bicarbonato de 25mm, lactato de sódio 22mm, piruvato de sódio 1 mM, 6 mg/mL ácido graxo livre BSA e heparina 10 mg/mL (pH 7,4).
      Nota: Preparar este meio no dia do uso e mantê-lo a 38,5 ° C, sob uma atmosfera de 5% de CO 2 e no ar com umidade máxima pelo menos 2 h antes do uso.
    2. Preparar ovo gema com base em tampão TRIS. Dissolver 30,28 g/L Tris, 16,75 g/L ácido cítrico, frutose 12,5 g/L e estreptomicina 0,5 g/L em água ultrapura (pH 7.3, osmolalidade = 310 mOsm/kg). Adicione a gema de ovo de 20% (v/v).
  2. Treinar um golfinho masculino reprodução comprovada para deitar em decúbito dorsal, perto da borda da piscina para coleta de sêmen voluntário.
    Nota: O golfinho masculino deve ser treinado mais de 6 meses pelo reforço positivo, conforme descrito anteriormente 4.
  3. Executar várias estimulações táteis pressionando suavemente na área craniana do sulco genital do golfinho para eliciar voluntária da extrusão do pênis do sulco genital.
  4. Depois de alcançar uma ereção completa, direcionar a ponta do pênis em um recipiente estéril para obter a ejaculação.
  5. Manter a amostra de esperma a 37 ° C, até a análise. Repita as etapas de 1.3 e 1.4 para coleções de ejacular sucessivas, usando um vidro de propileno de novo cada vez que.
  6. Imediatamente após a colheita, determinar o volume usando um cilindro de vidro graduado, previamente aquecido a 37 ° C. avaliar a cor, pH e osmolaridade (usando um microaparelhos) do ejaculate.
  7. Para avaliar a concentração de espermatozoides na ejaculação, adicionar 10 µ l de suspensão de esperma para um tubo eppendorf contendo 90 µ l de água destilada. Determinar a concentração de espermatozoides, usando um esperma contagem câmara.
    Nota: Durante a avaliação, manter o resto da ejaculação em 37 ° C.
  8. Avaliar os parâmetros de motilidade.
    1. Tomar 10 µ l da amostra de esperma e colocá-lo em uma câmara de esperma pré-aquecido.
    2. Avaliar a motilidade usando um sistema de análise de esperma assistida por computador, previamente validado para o golfinho, para avaliar objetivamente a motilidade de espermatozoides 2.
      Nota: Se necessário, dilua a amostra de esperma com meio FERT (heparina e hypotaurine-livre) para a visualização adequada da motilidade do esperma. Durante a avaliação, manter a amostra a 37 ° C em um palco de microscópio aquecida.
  9. Dar 20 µ l de amostra de esperma e avaliar a viabilidade e esperma morfologia como descrito anteriormente 5.
  10. Transferir a amostra de esperma para um tubo de centrifugação. Centrifugar a amostra de esperma a 250 x g por 5 min. Após determinar a concentração de espermatozoides, utilizando uma câmara de contagem, ajustar a concentração de esperma para 400 x 10 6 espermatozoides/mL.
    Nota: Se necessário, dilua a pelota de ejacula a concentrado com plasma seminal isolado de um volume em excesso da ejaculação mesmo por centrifugação (250 x g, 10 min).
    1. Ao longo de 5 min, lentamente diluído o esperma da amostra 1:1 (v/v) com um ovo gema com base em tampão TRIS contendo 1,5% de glicerol. Colocar o tubo contendo a suspensão de esperma a 5 ° C, durante 1 h 30 min.
    2. Realizar uma segunda diluição da suspensão de esperma com um TRIS egg buffer de gema contendo glicerol para obter uma concentração final de glicerol de 3% e uma concentração final de 200 x 10 6 espermatozoides/mL. Manter a suspensão de esperma a 5 ° C por 10 min.
  11. Carregar a suspensão de esperma em palhetas de 0,25 mL. Soldadura térmica o palitinho. Lugar, as palhas em um rack de 4,5 cm acima do nitrogênio líquido durante 10 min. mergulham o nitrogênio líquido o palitinho e armazenam até avaliação.

2. Heteróloga In Vitro fertilização usando Zona intacta oócitos bovinos

  1. preparação
    1. preparar a coloração de uma solução e o meio de montagem.
      1. Hoechst preparar solução dissolvendo-se 1 mg de Hoechst em 1 mL de água destilada. Faça 30 alíquotas µ l e mantê-los no escuro a-20 º C até o uso. Prepare a solução de coloração adicionando 25 µ l de solução-mãe de Hoechst a 5 mL de tampão fosfato salino (PBS) suplementado com 1 g/L de PVA. Misture bem e deixe no escuro a 4 ° C até o uso.
      2. Meio de montagem de
      3. preparar misturando 6,25 mL de PBS com 6,25 mL de glicerol e 6,25 µ l de solução-mãe de Hoechst. Misture bem e deixe no escuro a 4 ° C até o uso.
    2. Prepare o suporte para a fertilização de coleção e in vitro de oócitos.
      1. Preparar solução salina 0,9% NaCl destilada água adicionando 0,5 mL de gentamicina.
      2. Preparar o meio de maturação das ações adicionando 10 ng/mL fator de crescimento epidérmico (EGF) e 10% de soro fetal bezerro (FCS) para 10 mL de TCM-199. Manter ambos os meios a 38,5 ° C, sob uma atmosfera de 5% de CO 2 e no ar com umidade máxima pelo menos 2 h antes do uso.
  2. Coletar os ovários no matadouro em solução salina a 33-35 ° C e transportá-los para o laboratório dentro de 4 h de coleção.
  3. Uma vez no laboratório, lave os ovários três vezes para remover os escombros e sangue utilizando solução salina, previamente aquecida a 37 ° C. manter os ovários em solução salina a 37 ° C durante o processo.
  4. Aspirado de folículos de 2 a 8 mm com 18G de um agulha e uma seringa de 10 mL. Recolher o líquido folicular aspirado em tubos de 50 mL.
  5. Permitem que o fluido folicular que contêm os oócitos repousar durante cerca de 15 min a 37 ° C, até que o sedimento de células. Remover o sobrenadante do tubo com uma pipeta Pasteur e ressuspender o sedimento em PBS.
  6. Recuperar os complexos cumulus-oócito (COCs) em pratos 90mm sob um estereomicroscópio.
  7. Lavar o COCs três vezes em PBS e uma vez no meio de maturação.
  8. Transferência COCs morfologicamente normal para poço de 4 pratos, cada um bem contendo 500 mL do meio de maturação, em grupos de 50 COCs por alvéolo.
    Nota: Aqui, três poços – um poço para fertilização in vitro heteróloga, um controle bem para fertilização in vitro homólogo e aquele bem que contém apenas amadureceu COCs como um controle partenogenéticas – foram usados.
  9. Incubar o COCs por 24 h a 38,5 ° C, sob uma atmosfera de 5% de CO 2 e no ar com umidade máxima.
  10. Preparar o meio e o gradiente de densidade.
    1. Para preparar meio de fertilização (FERT), suplemento médio FERT-TALP com bicarbonato de 25mm, lactato de sódio de 22 mM, piruvato de sódio 1 mM, 6 mg/mL ácido graxo livre BSA e heparina 10 mg/mL. Manter a 38,5 ° C, sob uma atmosfera de 5% de CO 2 e no ar com umidade máxima pelo menos 2 h antes do uso.
    2. Preparar o gradiente de densidade, adicionando 1 mL de meio de gradiente de densidade para um tubo de 15 mL e 3 mL de solução para um tubo de 15 mL de lavagem. Mantê-las a 38,5 ° C, durante pelo menos 1 h.
  11. Lavar o em vitro amadureceu oócitos duas vezes no meio de FERT.
  12. Transferir os oócitos para poço de 4 pratos, cada um contendo bem 50 COCs em 250 mL de FERT. Manter os pratos 4-bem a 38,5 ° C, sob uma atmosfera de 5% de CO 2 e no ar com umidade máxima enquanto se prepara o esperma para fertilização.
  13. Descongelar uma palha congelada contendo espermatozoides golfinho em banho-maria a 37 ° C por 50 s.
    Nota: Sémen de bovino para a fertilização in vitro homólogo deve ser processado em paralelo, seguindo o protocolo padrão para FIV bovina homóloga.
  14. Tomar 10 µ l do esperma da amostra e coloque-o em um esperma previamente aquecido contando a câmara. Avalie a motilidade usando um sistema de análise de esperma assistida por computador, previamente validado para a espécie, para avaliar objetivamente a mobilidade do esperma. Durante este tempo, manter a amostra de esperma em 38,5 ° C.
  15. Adicionar a amostra de esperma ao tubo gradiente de densidade (etapa 2.10.2). Centrifugar durante 10 minutos a 250 g. x
  16. Remover cuidadosamente o sobrenadante com uma pipeta Pasteur. Adicione 3 mL de solução de lavagem para o tubo contendo a pelota. Ressuspender o sedimento, misturando delicadamente.
  17. Centrifugar durante 5 min à 250 g. x remover o sobrenadante com uma pipeta Pasteur para um volume de esperma de 300 µ l.
  18. Adicionar 5 µ l de suspensão de esperma para microcentrifuga contendo 95 µ l de água destilada. Manter a suspensão de esperma 38,5 ° C. Fill a contagem de células de câmara com 10 µ l da 01:20 diluição de esperma e medida a concentração. Calcular a quantidade de meio FERT que deve ser adicionado a 100 µ l do esperma para obter 2 x 10 6 espermatozoides/mL.
  19. Adicionar o volume calculado de FERT e esperma para um tubo de 15 mL e misture suavemente com uma pipeta Pasteur.
  20. Adicionar 250 µ l de suspensão de esperma-FERT a cada poço do poço 4 prato contendo o meio de FERT com oócitos amadurecidos para obter uma concentração final de 1 x 10 6 espermatozoides/mL.
  21. Co incubar os gâmetas por 18 h a 38,5 ° C, sob uma atmosfera de 5% de CO 2 e no ar com umidade máxima.
  22. Preparar o meio de cultura que baseia o fluido sintético ovidutária suplementado com 5% de FCS. Prepare 25 µ l de gotículas de cultura fluido ovidutária sintético nos pratos 35mm cobertas com 3 mL de óleo mineral. Manter a 38,5 ° C, sob uma atmosfera de 5% de CO 2 e no ar com umidade máxima pelo menos 2 h antes do uso.
  23. Em incubação co do post 2,5 h, retire o prato 20 oócitos; manter os oócitos restantes na incubadora nas mesmas condições.
    1. Remover os espermatozoides vagamente anexados pipetando vigorosamente metade dos oócitos através de uma pipeta de Pasteur estreito-calibre 10 vezes.
    2. Corrigir 20 oócitos em 50 µ l de 0,5% de glutaraldeído por 30 min. lavagem de oócitos em PBS durante 5 min. Transfira os oócitos de 50 µ l de solução de coloração Hoechst por 15 min e lave os oócitos em PBS durante 5 min.
    3. Transferência de oócitos individualmente para 2 gotas de µ l de meio de montagem a uma taxa de 10 ovócitos por slide. Delicadamente, cobrir com uma lamela e selar com esmaltes.
    4. Contar o número de espermatozoides anexado para os oócitos bovinos usando um microscópio de contraste de fase, equipado com ótica epifluorescente e um filtro de excitação 361 nm na ampliação de 40 x.
  24. Após 12 h de incubação co, retire os pratos 4-bem 10 presuntivas zigotos; manter zigotos presuntivas restantes na incubadora nas mesmas condições.
    1. Transferência a 10 zigotos presuntivas para uma centrífuga de 15 mL tubo contendo 2 mL de PBS e vórtice suavemente durante 2 min para remover as células do cumulus. Lave duas vezes em PBS, correção e mancha, conforme descrito anteriormente (passo 2.23.2.)
  25. Depois de 18, 20, 22 e 24 h de incubação co, removem 10 zigotos presuntivas do poço 4 pratos e vórtice, corrigir e manchá-las conforme descrito anteriormente (etapa 2.23.2). Manter o resto de zigotos presuntivas na incubadora nas mesmas condições.
    1. Avaliar a formação pró-nuclear e poliespermia sob um microscópio de epifluorescente/fase-contraste em ambos os grupos homólogos e heterólogos FIV pela coloração com Hoechst.
    2. Avaliar pró-nuclear formação em 10 zigotos híbrido presuntivo escolhidos aleatoriamente por amostra. Confirmar a formação pró-nuclear sob um microscópio na excitação do laser de argônio 488 nm e 515 para 530 nm deteção de exploração do laser confocal.
    3. Opticamente seção zigotos presuntivas sequencialmente (2 mm) e coletar imagens usando um software de imagem. Visualizar usando um pacote de software de análise 3D.
    4. Após 24 h de incubação co, lavar 50 zigotos presuntivas quatro vezes em PBS e duas vezes em meio de cultura.
  26. Transferi-los em grupos de 25 para microdroplets do meio de cultura previamente preparado e incubado.
  27. Manter a 38,5 ° C, sob uma atmosfera de 5% O 2 / 5% de CO 2 e no ar com umidade máxima.
  28. Após 26 e 28 h de incubação co, retire os pratos e vórtice, fix 10 zigotos presuntivas e manchá-las, como descrito anteriormente (etapa 2.23.2).
  29. Após 48 h de cultura, observar a clivagem sob um estereomicroscópio.
  30. Remover a zona pelúcida (ZP) ao transferir os embriões para uma solução de protease de 5 mg/mL.
  31. Lavar individualmente cada embrião três vezes em PBS. Snap-congele-os em nitrogênio líquido em tubos de microcentrifuga de 0,2 mL. Armazená-los a-80 ° C até análise.

3. PCR

  1. materiais e reagentes
    Nota: os reagentes, materiais e equipamentos utilizados para executar o protocolo PCR são detalhadas na tabela de materiais e incluir uma cremalheira do tubo do PCR e um conjunto de micropipetas (P2, P20, P200, P1000), 1,5 mL microcentrifuge tubos, tubos PCR e bonés, um termociclador, um iluminador UV, gel de agarose e tampão (Tris borato EDTA (TBE)).
    1. Suavemente descongelar todos os reagentes no gelo. Mantê-los no gelo durante todo o experimento. Use deoxynucleotides (dNTPs; dATP, dCTP, dTTP e dGTP), alvo de cartilhas sobre a referência gene que codifica para a proteína ribosomal de S de golfinho 18 (DQ404537.1); R1: TTGGACACACCCACGGTGCGG e F2: CAGAAGGACGTGAAGGATGGA), DNA polimerase, 5 X buffer, para a DNA-polimerase, DNA modelo, água estéril e cloreto de magnésio (MgCl 2 em uma concentração final de 5, 0mm).
    2. Preparação de gel e amostra de
    3. Agarose.
      1. DNA, esperma de golfinho e bovina preparar amostras. S.
        1. thaw um canudo congelado de cada espécie em banho-maria a 37 ° C por 50 adicionar 3 mL de solução de lavagem. Centrifugar a 250 x g por 10 min. Retire o sobrenadante. Adicionar 30 µ l de tampão de Lise STES (50 mM Tris-HCl, pH 8; 20 mM NaCl; e SDS 0,1% de 1 mM), 2 µ l de proteinase K (20 mg/mL) e 5 µ l de ditiotreitol (DTT); concentração final: 150 mM. Manter-se durante a noite a 55 ° C. Adicionar 200 µ l membros de água ultrapura. Centrifugar a 250 x g por 5 min. manter o sobrenadante. Medir a concentração de DNA usando um spectrophotometer.
      2. Realizar diluições em série do DNA de espermatozoides de golfinho (ou seja, 40, 4 e 0,4 ng/mL) com água ultrapura para verificar que as condições PCR são capazes de detectar uma pequena quantidade de golfinho DNA.
      3. Realizar diluições em série de esperma bovina DNA (isto é, 4.000, 400, 40 e 4 ng/mL) com água ultrapura para verificar que as condições PCR são capazes de detectar uma pequena quantidade de DNA bovino.
      4. Preparar os embriões de golfinhos e bovina. Descongele os embriões no gelo. Adicione 8 µ l de proteinase de µ g/mL 100 K e manter-se durante a noite a 55 ° C. Para parar a reação, coloque as amostras a 96 ° C por 5 min.
      5. Preparar amortecedor TBE de gel de agarose 2% e adicionar 20 µ l de ácido nucleico mancha usando as técnicas padrão.
    4. Preparação de PCR.
      1. Tubos de PCR de rótulo: diluições em série dos golfinhos (40, 4 e 0,4 ng/mL), as diluições de série bovina (4.000, 400, 40 e 4 ng/mL), homóloga bovina embrião de duas câmaras, duas câmaras presuntivas heterólogos embriões e controle negativo.
      2. Prepare uma mistura de mestre em um tubo estéril microcentrifuga de 1,5 mL para um volume final de 25 µ l por reação.
        1. Adicionar 5 µ l debuffer 5 X DNA polimerase flexi, 0,5 µ l de dNTPs (10 mM) 1,5 µ l de MgCl 2 (25 mM), 0,5 µ l de frente e verso da primeira demão (10 µM), 1,5 µ l do molde de ADN (esperma) ou 8 µ l do molde de ADN (embriões de duas câmaras) , 0,07 µ l da Taq polimerase e estéril destilada água até um volume final de 25 µ l. Misture bem.
  2. Protocolo de amplificação
    1. Coloque os tubos no termociclador. Selecione o programa a seguir: 94 ° C por 3 min; 40 ciclos de 94 ° C por 15 s, 59 ° C para 25 s, 72 ° C por 20 s; e 72 ° C por 5 min. iniciar o programa.
    2. Armazenar os tubos em 4 ° C. adicionar 2,5 μL, de carregando buffer para cada produto PCR em 4 ° C e carga 15 µ l da mistura nos poços do gel do agarose 2%. Use um marcador de escada de DNA para a estimativa do tamanho exato de fragmentos do PCR.
    3. Executar eletroforese por 15 min permitir a migração do DNA. Visualizado bandas usando um iluminador UV.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos os resultados, tabelas e figuras (1 e 2) aqui apresentadas foram reproduzidas com permissão3.

Espermatozoides de golfinho tem alta mobilidade após congelação e descongelação

A golfinho congelado-descongelar ejacula mostrou percentagens (% ± DP) de 84.5 ± 5,3 total motile e 69,1 ± 5,1 espermatozoides móveis progressivos. Em termos de mobilidade, estes números são representativos de espermatozoides criopreservados de alta qualidade.

Espermatozoides de golfinho são capazes de penetrar zona de ovócitos bovinos intactos e produzir embriões híbridos

Figura 1A e a tabela 1 mostram golfinho espermatozoides anexados para a ZP bovina após 2,5 h de incubação co. Espermatozoides de golfinho estavam presos em um percentual maior do que o espermatozoide bovino (figura 1B e tabela 1). Com efeito, microscopia de fluorescência mostra que espermatozoides golfinho são capazes de penetrar a zona intacta bovina espermatozoides (Figura 1), levando à formação pró-nuclear e clivagem (Figura 1E e tabela 1). Isto foi confirmado pela microscopia confocal (Figura 1 e Figura 1F). Não poliespermia foi observada em oócitos do grupo de fertilização in vitro heterólogo após 12 h de incubação co (tabela 1). Formação pró-nuclear na fertilização in vitro heteróloga alcançou o maior percentual em 24h, mais tempo do que no grupo homólogo, que ocorreu às 18 h de incubação co (tabela 1). A taxa de clivagem a 48 h após a incubação foi inferior na heteróloga a fertilização in vitro homóloga (tabela 1). Observou-se uma taxa de ativação partenogenéticas espontânea de 8,0% em bovinos oócitos não fertilizados amadurecidos a 48 h (tabela 1).

Finalmente, os resultados PCR confirmaram a presença de material genético de golfinho nos embriões híbridos (Figura 3), avaliando a presença de um golfinho referência gene que codifica para o 18 ribosomal S proteína (Figura 2).

Figure 1
Figura 1: espermatozoides golfinho anexado para a espécie bovina zona pelúcida (ZP). Golfinho anexado (A) e bovinos (B) espermatozoides após 2,5 h de incubação co com zona de ovócitos bovinos intactos. Gâmetas foram coradas com a Hoechst e visualizadas sob microscópio de contraste de fase (ampliação de 40 X). Um espermatozoide de golfinho no espaço de um oócito bovino (C e D) e uma cabeça de esperma de golfinho decondensing no citoplasma de ovócitos bovinos (E) periviteline. Imagens foram capturadas com um microscópio confocal e correspondem ao plano equatorial do zigoto presuntivo (Hoechst coloração; ampliação de X 40). Dois pró-núcleos (F) observados sob um microscópio de contraste de fase após 24h de fertilização in vitro heterólogo, consistindo a incubação co de espermatozoides de golfinho com zona intacta oócitos bovinos (Hoechst coloração; ampliação de X 40; Barra de escala = 25 µm). A figura foi reproduzida de referência3 , com permissão. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: representante eletroforese (agarose 2% gel de brometo de etídio manchado) mostrando os resultados de amplificação do PCR para o gene de golfinho 18 S. Faixas 1 a mostrar 30 embriões de híbrido de presuntivo golfinho/bovina; pistas de S1 e S2 apresentam 4 ng/mL e esperma de golfinho de 0,4 ng/mL DNA, respectivamente; e pistas de C1 a C5 possuem duas células embriões de bovinos e H2O (água) (o controle em branco). A seta indica a banda 190-bp correspondente a 18 amplificada S rDNA. A figura foi reproduzida de referência3 , com permissão. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: imagens representativas de embriões híbridos. Imagem representativa de um embrião híbrido de duas câmaras (A) a 48 h de incubação (Hoechst coloração; ampliação de X 40). Embriões híbridos imaculado a 48 h de incubação, em diferentes fases de divisão, visualizado sob o microscópio estereoscópico (B). Clique aqui para ver uma versão maior desta figura.

Table 1
Tabela 1: taxas de clivagem após incubação co homóloga e heteróloga com oócitos bovinos e espermatozoides bovinos ou golfinho, respectivamente, poliespermia, formação pró-nuclear e acessório. As variáveis foram analisadas com ANOVA (teste de Kruskal-Wallis e Mann-Whitney). Os valores são expressos como a média ± SEM (intervalo) de doze repetições; n = número total de ovócitos ou zigotos presuntivas examinados. A tabela foi reproduzida de referência3 , com permissão. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Para muitas espécies diferentes de mamíferos, existem diversas vantagens em usar o esperma congelado-descongelar. Estes incluem a capacidade de transferir material genético valioso, o potencial para distribuição em todo o mundo, o baixo risco de contaminação e a capacidade de preservar os gametas masculinos por décadas. O uso de espermatozoides criopreservados é essencial para o golfinho, porque esta espécie está protegida sob o apêndice II da CITES, que limita o transporte e o intercâmbio de animais entre diferentes parques aquáticos. Transporte de golfinhos é uma atividade que cria problemas logísticos e perigosos riscos. No entanto, abster-se de transportar os animais também tem consequências, tais como o risco de introdução de consanguinidade para uma população em cativeiro de animais. Uma solução é a criopreservação de esperma. Alguns autores têm criopreservado muito golfinho esperma5,7,8,9, com resultados encorajadores. Além disso, em 2005, o primeiro nascimento de um bezerro de golfinho concebido por inseminação artificial com esperma de Shipper foi relatado10. Alguns anos mais tarde, isto foi feito usando espermatozoides sexo-classificados de11.

Esperma de golfinho tem sido criopreservadas usando diferentes técnicas, de métodos sofisticados, tais como um congelador programável5, para métodos comuns, tais como vapores de gelo seco12 ou líquido nitrogênio2,9, 13. A principal vantagem do uso de gelo seco ou nitrogênio líquido vapores é a possibilidade de cryopreserve no mesmo local onde o esperma é extraído, sem o uso de equipamentos altamente especializados. Esperma congelada em canudos em poliestireno em vapores de nitrogênio líquido é um método simples, rápido e barato de13. Na prática, quando esta metodologia tem sido utilizada em golfinhos, motilidade espermática foi 65%. No entanto, é importante considerar o quanto é difícil estabelecer um método padronizado: a técnica pode ser influenciada por fatores externos, tais como temperatura, umidade, tamanho de poliestireno, etc. Portanto, mais estudos são necessários para otimizar e padronizar o procedimento a fim de melhorar o sucesso do uso de esperma congelada com o método de vapor de nitrogênio líquido.

A fim de otimizar um protocolo de congelamento, é importante desenvolver um método confiável para a avaliação funcional dos espermatozoides. Fertilização in vitro é um bom meio de testar o potencial para a fertilização de esperma. Idealmente, oócitos golfinho devem ser usados para fertilização in vitro, mas os difícil e laboriosos procedimentos necessários para obter os ovócitos das fêmeas representam uma restrição importante. Portanto, a possibilidade de utilizar a fertilização in vitro heterólogo abre um novo meio para testar a eficiência de fertilização no dolphin. Oócitos de outras espécies podem ser usados para o golfinho heterólogo FIV. Os resultados mostram que a fertilização in vitro heterólogo entre oócitos bovinos e espermatozoides golfinho pode ser executado. Espermatozoides congelados e descongelados golfinho podem penetrar o oócito bovino intacta de zona e gerar um embrião híbrido.

A combinação apresentada de protocolos para a coleta, congelamento-descongelamento e realização de fertilização in vitro heterólogo com oócitos bovinos tem sido demonstrada com sucesso e representa um passo inicial para a otimização de criopreservação e a avaliação de esperma de golfinho. É importante notar que existem ainda muitas incógnitas nestes procedimentos. No entanto, a capacidade de cryopreserve sémen golfinho torna-o acessível e permite que ele seja mantido em laboratórios. Isto irá facilitar estudos científicos e pode levar a uma melhor compreensão da fisiologia, composição e do comportamento dos espermatozoides.

A avaliação de esperma por fertilização in vitro heteróloga pode facilitar a otimização dos protocolos de congelamento, mas também pode ser usado no futuro para testar e selecionar os machos para eficiência de fertilidade. Uma consideração importante é a relação entre os números reais de fertilização e valores de fertilização in vitro heterólogos. Além disso e devido a novidade de fertilização in vitro heteróloga entre estas duas espécies filogeneticamente distantes, bovina e golfinho, novas hipóteses biológicas podem ser construídas. No total, estes protocolos de abrir um novo espaço para a pesquisa sobre a reprodução dos golfinhos e outros mamíferos marinhos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

seu trabalho foi financiado pelo Ministério da economia e competitividade (AGL2015-70140-R a D. Rizos), AGL2015-66145R A. Gutierrez-Adan e J. F. Pérez-Gutiérrez e Seneca Fundação de Murcia (Grant 20040/GERM/16 para F. García-Vázquez) espanhol

Materials

Name Company Catalog Number Comments
FERT-TALP medium Merck
TCM-199 Sigma M-4530
Hoechst 33342 Sigma B-2261
4-well dishes Nunc 176740
Density gradient BoviPure Nidacon International BP-100
Washing solution Boviwash Nidacon International BW-100
Magnesium chloride Promega A35 1H
Sterile water Mili Q sintesis A10 Millipore A35 1H
Buffer Tris Borate EDTA Sigma T4415
MB agarose Biotools 20.012
5X GoTaq flexi buffer Mili Q sintesis A10 Millipore M 890 A
MB agarose Biotools 20.012
Taq polymerase Promega
SafeView NBS Biologicals Ltd. M 890 A
Makler counting chamber Sefi Medical
Thoma chamber Hecht-Assistant
pHmeter MicropH 2000 Crison Instruments
Osmometer Advanced micro osmometer 3300 Norwood
Computer assisted sperm analysis system Projectes y Serveis R+D
Stereomicroscope MZ 95 Leica
Epifluorescent optics Eclipse Te300 Nikon
Confocal assistant 4.02 software Bio-Rad 3D analysis software
Confocal laser scanning microscopy Bio-Rad
Micropippetes (P2. P20, P200, P1000) Gilson
Microcentrifuge tubes VWR
UV iluminator Bio-Rad
PCR Thermal cycler Primus 96 Plus MWG AG Biotech

DOWNLOAD MATERIALS LIST

References

  1. Montano, G. A., et al. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. Reproduction. 143, (6), 799-813 (2012).
  2. Sánchez-calabuig, M. J., et al. Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 49, (5), 761-768 (2014).
  3. Sánchez-calabuig, M. J., et al. Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa. Theriogenology. 84, (6), 983-994 (2015).
  4. Keller, K. V. Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination. IAAAM. 14, (22), 22-24 (1986).
  5. Robeck, T. R., O'brien, J. K. Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa. Biol Reprod. 70, (5), 1340-1348 (2004).
  6. Coy, P., et al. Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow. Reproduction. 135, (1), 19-27 (2008).
  7. Seager, S., W, G., Moore, L., Platz, C., Kirby, V. Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus). Proceedings of the American Association of Zoo Veterinarians. 136, (1981).
  8. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  9. Sánchez-Calabuig, M. J., et al. Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 50, (2), 227-235 (2015).
  10. Robeck, T. R., et al. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus). Reproduction. 129, (5), 659-674 (2005).
  11. Robeck, T. R., et al. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus). Anim Reprod Sci. 139, (1-4), 168-181 (2013).
  12. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  13. Madeddu, M., et al. Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen. Anim Reprod Sci. (2016).
Bottlenose Dolphin (<em>Tursiops truncatus</em>) espermatozoides: recolha, criopreservação e heterólogo fertilização <em>In Vitro</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).More

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter