Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Grand Dauphin (Tursiops truncatus) spermatozoïdes : Collection, cryoconservation et la fécondation In Vitro hétérologue

doi: 10.3791/55237 Published: August 21, 2017

Summary

Nous présentons ici les protocoles qui ont été utilisées avec succès pour la collection de spermatozoïdes de Dauphin, cryoconservation et les performances FIV hétérologue ovocytes bovines.

Abstract

L’utilisation de spermatozoïdes cryoconservés Dauphin facilite l’échange de matériel génétique entre les parcs aquatiques et rend les spermatozoïdes accessible aux laboratoires d’études afin d’améliorer nos connaissances de la reproduction des mammifères marins. FIV hétérologue, un remplacement pour une FIV homologue, pourrait fournir un moyen de tester la fertilité du sperme potentielle ; pour étudier la physiologie des gamètes et début du développement embryonnaire ; et d’éviter l’utilisation d’ovocytes Dauphin précieux, qui sont difficiles à obtenir. Nous présentons ici les protocoles qui ont été utilisées avec succès pour recueillir et cryopréserver des spermatozoïdes de Dauphin. La collecte de sperme s’effectue par stimulation manuelle des dauphins formés. Cryoconservation s’effectue à l’aide d’un extenseur de jaune d’oeuf-basée de TRIS avec le glycérol. En outre, nous présentons un protocole décrivant les FIV hétérologue utilisant Dauphin spermatozoïdes et les ovocytes bovines et qui vérifie la nature hybride de l’embryon qui en résulte, à l’aide de la PCR. La fécondation hétérologue soulève des questions sur la fécondation et peut servir comme un outil pour étudier la physiologie des gamètes et début du développement embryonnaire. En outre, le succès de la FIV hétérologue démontre le potentiel de cette technique pour tester le sperme Dauphin fertilisation de capacité, qui mérite un examen plus poussé.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Techniques de procréation assistée sont peu développés chez les animaux sauvages, y compris les mammifères marins. L’absence de méthodes sensibles pour évaluer la réussite fécondante du sperme contribue au développement lent des technologies de la reproduction chez les espèces comme les dauphins. Il n’était pas jusqu'à une date récente que les paramètres fondamentaux séminales du grand dauphin (Tursiops truncatus) ont été signalés1,2. Toutefois, des variables telles que la motilité et la morphologie, bien que largement utilisé, donnent des informations limitées sur l’efficacité reproductive. Le meilleur indicateur de la qualité du sperme est l’évaluation du potentiel fécondatrice des cultures.

Récemment, notre groupe a utilisé une méthode pour évaluer les spermatozoïdes Dauphin potentiel de la fertilisation en évaluant la formation pronucléaire mâle et/ou formation d’embryon hybride après FIV hétérologue utilisant zona intact ovocytes bovine3. L’utilisation de la FIV hétérologue Dauphin-bovin a des avantages importants par rapport aux homologues FIV, car il permet de surmonter la difficulté d’obtenir des ovocytes de Dauphin et facilite l’utilisation de bien testé in vitro bovine oocyte maturation des systèmes. Afin d’éviter la spécificité d’espèce, la fécondation hétérologue est généralement réalisée en l’absence de ZP. Même si elle permet l’évaluation de la capacité des spermatozoïdes acrosome-réagi à fusionner avec la membrane vitelline, elle porte atteinte à l’évaluation d’autres fonctionnalités liées à la fertilisation. La procédure décrite utilise zona ovocytes intacts et permet l’évaluation des paramètres suivants : liaison de zona de sperme et attachement, pénétration, polyspermie, formation pronucléaire et clivage embryon hybride.

Nous présentons ici plusieurs protocoles de prélèvement du sperme, base spermogramme, congélation de spermatozoïdes ainsi que l’évaluation de la fonctionnalité de sperme Dauphin en évaluant mâle pronucléaire et/ou hybrides formation des embryons après FIV hétérologue utilisant zona intact ovocytes bovines.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

déclaration d’éthique : toutes les procédures expérimentales ont été examinés et approuvés par le Comité de l’utilisation de l’Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA) et d’institutionnels animalier. Toutes les expériences ont été effectuées conformément au Guide pour le soin et l’utilisation des animaux de laboratoire, tel qu’adopté par la société pour l’étude de la Reproduction et à la Loi sur le bien-être Animal pour les soins des mammifères marins.

1. dolphin prélèvement du sperme et la cryoconservation

  1. préparation
    1. FERT rendre médium (héparine - et hypotaurine-libre). Préparer un milieu FERT-TALP additionné de bicarbonate de 25 mM, lactate de sodium 22 mM, pyruvate de sodium 1 mM, 6 mg/mL sans acides gras BSA et l’héparine de 10 mg/mL (pH 7,4).
      NOTE : Préparer ce moyen de communication le jour d’utilisation et conservez-le à 38,5 ° C, sous une atmosphère de 5 % de CO 2 et dans l’air avec une humidité maximale pendant au moins 2 h avant utilisation.
    2. Préparer oeuf jaune d’oeuf-basée un tampon TRIS. Dissoudre 30,28 g/L Tris, 16,75 g/L d’acide citrique, fructose 12,5 g/L et la streptomycine 0,5 g/L dans l’eau ultrapure (pH 7,3, osmolalité = 310 mOsm/kg). Ajouter le jaune de œuf 20 % (v/v).
  2. Former un dauphin mâle éprouvée de reproduction se situe dans la dorsale recumbence près du bord de la piscine pour la collecte de sperme bénévole.
    Remarque : Les dauphins mâles devraient être formés pendant 6 mois par renforcement positif, comme décrit plus haut 4.
  3. Effectuer diverses stimulations tactiles en appuyant doucement sur la zone crânienne du sillon génital du Dauphin pour susciter l’extrusion volontaire du pénis de l’encoche du génital.
  4. Après avoir atteint une érection complète, diriger la pointe du pénis dans un contenant stérile pour obtenir l’éjaculat.
  5. Conserver l’échantillon de sperme à 37 ° C jusqu'à l’analyse. Répétez les étapes 1.3 et 1.4 pour les collections de l’éjaculat successifs, utilisant à chaque fois un nouveau verre de propylène.
  6. Immédiatement après le prélèvement, déterminer le volume à l’aide d’un cylindre de verre gradué, préalablement chauffé à 37 ° C. évaluer la couleur, le pH et osmolarité (à l’aide d’un micro-osmomètre) de l’éjaculat.
  7. Pour évaluer la concentration de spermatozoïdes dans l’éjaculat, ajouter 10 µL de la suspension de sperme dans un tube eppendorf contenant 90 µL d’eau distillée. Déterminer la concentration de spermatozoïdes à l’aide d’un spermatozoïde comptant chambre.
    Remarque : Lors de l’évaluation, garder le reste de l’éjaculat à 37 ° C.
  8. Évaluer les paramètres de motilité.
    1. Prenez 10 µL de l’échantillon de sperme et placez-le dans une chambre de sperme préchauffé.
    2. Évaluer la motilité en utilisant un système d’analyse de sperme assistée par ordinateur, déjà validé pour le grand dauphin, à évaluer objectivement la motilité de sperme 2.
      Remarque : Si nécessaire, diluer l’échantillon de sperme avec milieu FERT (héparine - et hypotaurine-libre) pour la visualisation adéquate de la motilité des spermatozoïdes. Lors de l’évaluation, conserver l’échantillon à 37 ° C sur une platine du microscope chauffée.
  9. Prendre 20 µL de l’échantillon de sperme et d’évaluer la viabilité et le sperme morphologie comme précédemment décrit 5.
  10. Transférer l’échantillon de sperme dans un tube à centrifuger. Centrifuger l’échantillon de sperme à 250 x g pendant 5 min. Après, déterminer la concentration de spermatozoïdes à l’aide d’une chambre de comptage, ajuster la concentration en spermatozoïdes à 400 x 10 6 spermatozoïdes/mL.
    Remarque : Si nécessaire, diluer le culot des éjaculats concentrés avec le plasma séminal isolé d’un excès de volume de l’éjaculat même par centrifugation (250 x g, 10 min).
    1. Au cours de 5 min, lentement dilué le sperme exemple 1:1 (v/v) avec un tampon TRIS oeuf jaune d’oeuf contenant 1,5 % de glycérol. Placer le tube contenant le sperme en suspension à 5 ° C pendant 1 h 30 min.
    2. Effectue une deuxième dilution de la suspension de sperme avec une TRIS oeuf tampon jaune contenant du glycérol pour obtenir une concentration finale de glycérol de 3 % et une concentration finale de 200 x 10 6 spermatozoïdes/mL. Maintenir la suspension de sperme à 5 ° C pendant 10 min.
  11. Charger la suspension de sperme dans les paillettes 0,25 mL. Soudure à chaud les pailles. Place les pailles dans un rack 4,5 cm au-dessus de l’azote liquide pour 10 min. plongent les paillettes dans l’azote liquide et conservent jusqu'à l’évaluation.

2. Hétérologue In Vitro Fertilization utilisant Zona intacte Bovine ovocytes

solution
  1. préparation
    1. Prepare la coloration et le milieu de montage.
      1. Solution mère préparer Hoechst en dissolvant 1 mg de Hoechst dans 1 mL d’eau distillée. Faire 30 µL d’extraits et gardez-les dans l’obscurité à-20 ° C jusqu'à l’utilisation. Préparer la solution colorante en ajoutant 25 µL de la solution mère de Hoechst à 5 mL d’une solution saline tamponnée au phosphate (PBS) additionnée de 1 g/L PVA. Bien mélanger et conserver à l’obscurité à 4 ° C jusqu'à l’utilisation.
      2. Milieu de montage
      3. Prepare en mélangeant 6,25 mL de PBS avec 6,25 mL de glycérol et 6,25 µL de la solution mère de Hoechst. Bien mélanger et conserver à l’obscurité à 4 ° C jusqu'à l’utilisation.
    2. Préparer le milieu pour la fécondation collection et in vitro d’ovocytes.
      1. Préparer une solution saline en ajoutant 0,5 mL de gentamicine à 0,9 % NaCl eau distillée eau.
      2. Préparer le milieu de maturation stock en ajoutant 10 ng/mL facteur de croissance épidermique (EGF) et 10 % de sérum de veau foetal (FCS) à 10 mL de TCM-199. Maintenir les deux milieux à 38,5 ° C, sous une atmosphère de 5 % de CO 2 et dans l’air avec une humidité maximale pendant au moins 2 h avant utilisation.
  2. Recueillir les ovaires à l’abattoir dans une solution saline à 33-35 ° C et les transportent au laboratoire dans les 4 h de la collection.
  3. Une fois dans le laboratoire, laver les ovaires trois fois pour enlever les débris et le sang à l’aide d’une solution saline préalablement chauffée à 37 ° C. maintenir les ovaires dans une solution saline à 37 ° C au cours du processus.
  4. Aspiration follicules de 2 à 8 mm avec un G 18 aiguille et une seringue de 10 mL. Recueillir le liquide folliculaire aspiré en tubes de 50 mL.
  5. Laisser le liquide folliculaire contenant les ovocytes au repos pendant environ 15 min à 37 ° C, jusqu'à ce que les sédiments de cellules. Retirez le surnageant du tube avec une pipette Pasteur et Resuspendre le culot dans du PBS.
  6. Récupérer les complexes cumulus-ovocytes (COC) dans les plats de 90 mm sous un stéréomicroscope.
  7. Laver les COC trois fois dans du PBS et une fois en milieu de maturation.
  8. Transfert COC morphologiquement normaux à 4 paraboloïdes, chaque cupule contenant 500 mL de milieu de maturation, en groupes de 50 COC / puits.
    NOTE : Ici, trois puits – un puits pour FIV hétérologue, un contrôle bien pour FIV homologue et une cupule contenant seulement mûri COC sous forme parthénogénétique de contrôle – ont été utilisées.
  9. Incuber le COC à 38,5 ° C, sous une atmosphère de 5 % de CO 2 et dans l’air avec une humidité maximale pendant 24 h.
  10. Préparer le support et le gradient de densité.
    1. Pour préparer la fécondation milieu (FERT), Supplément moyen FERT-TALP avec bicarbonate de 25 mM, lactate de sodium 22 mM, pyruvate de sodium 1 mM, 6 mg/mL sans acides gras BSA et l’héparine 10 mg/mL. Maintenir à 38,5 ° C, sous une atmosphère de 5 % de CO 2 et dans l’air avec une humidité maximale pendant au moins 2 h avant utilisation.
    2. Préparer le gradient de densité en ajoutant 1 mL de milieu de gradient de densité dans un tube de 15 mL et 3 mL de solution dans un tube de 15 mL de lavage. Maintenir à 38,5 ° C pendant au moins 1 h.
  11. Lavage l' in vitro est arrivée à échéance des ovocytes deux fois dans un milieu FERT.
  12. Transférez les ovocytes dans des plats de 4 puits, chaque cupule contenant 50 COC dans 250 mL de FERT. Maintenir les paraboloïdes 4 à 38,5 ° C, sous une atmosphère de 5 % de CO 2 et dans l’air avec une humidité maximale tout en préparant le sperme pour la fécondation.
  13. Décongeler une paille congelée contenant les spermatozoïdes de Dauphin dans un bain-marie à 37 ° C pendant 50 s.
    NOTE : Sperme pour FIV homologue doit être traitée en parallèle, selon le protocole standard pour l’homologue bovine FIV.
  14. Prendre 10 µL du sperme l’échantillon et le place dans un spermatozoïde préchauffé chambre de comptage. Évaluer la motilité en utilisant un système d’analyse de sperme assistée par ordinateur, déjà validé pour les espèces, à évaluer objectivement la motilité des spermatozoïdes. Pendant ce temps, conserver l’échantillon de sperme à 38,5 ° C.
  15. Ajouter l’échantillon de sperme dans le tube de gradient de densité (étape 2.10.2). Centrifugation pendant 10 min à 250 x g.
  16. Retirer délicatement le surnageant à l’aide d’une pipette Pasteur. Ajouter 3 mL de la solution de lavage dans le tube contenant le culot. Resuspendre le culot en mélangeant doucement.
  17. Centrifuger pendant 5 min à 250 x g. éliminer le surnageant avec une pipette Pasteur à un volume de sperme de 300 µL.
  18. Ajouter 5 µL de la suspension de sperme pour une micro-centrifugeuse contenant 95 µL d’eau distillée. Maintenir la suspension de sperme à 38,5 ° C. remplissage du comptage de cellules de chambre avec 10 µL de la 01:20 mesure la concentration et dilution de sperme. Calculer le montant du milieu FERT qui doit être ajouté à 100 µL du sperme pour obtenir 2 x 10 6 spermatozoïdes/mL.
  19. Ajouter le volume calculé de FERT et le sperme dans un tube de 15 mL et mélanger délicatement à l’aide d’une pipette Pasteur.
  20. Ajouter 250 µL de la suspension de sperme-FERT à chaque alvéole du godet 4 puits contenant le milieu FERT avec les ovocytes ayant subi une maturation pour obtenir une concentration finale de 1 x 10 6 spermatozoïdes/mL.
  21. Co Incuber les gamètes pendant 18 h à 38,5 ° C, sous une atmosphère de 5 % de CO 2 et dans l’air avec une humidité maximale.
  22. Préparer le milieu de culture basé sur le synthétique liquide tubaire additionné de 5 % FCS. Préparer 25 µL de gouttelettes de liquide tubaire synthétique de culture dans les mets 35 mm recouverts de 3 mL d’huile minérale. Maintenir à 38,5 ° C, sous une atmosphère de 5 % de CO 2 et dans l’air avec une humidité maximale pendant au moins 2 h avant utilisation.
  23. à 2,5 h post co d’incubation, retirer le plat de 20 ovocytes ; maintenir les ovocytes restants dans l’incubateur dans les mêmes conditions.
    1. Enlever les spermatozoïdes lâchement attachés par la moitié des ovocytes par une pipette Pasteur étroit pipetage vigoureusement 10 fois.
    2. Difficulté les 20 ovocytes dans 50 µL de glutaraldéhyde à 0,5 % pour 30 min. laver les ovocytes dans du PBS pendant 5 min. de transférer les ovocytes à 50 µL de solution colorante Hoechst pendant 15 minutes et laver les ovocytes dans du PBS pendant 5 min.
    3. Transfert individuellement les ovocytes à 2 gouttes µL de milieu de montage à raison de 10 ovocytes par diapositive. Doucement, recouvrir d’un lamelle couvre-objet et sceller avec du vernis à ongles.
    4. Compter le nombre de spermatozoïdes attaché aux ovocytes bovines à l’aide d’un microscope à contraste de phase avec épifluorescente optique et un filtre d’excitation 361 nm à un grossissement de 40 x.
  24. Après 12 h d’incubation Co, enlever 10 zygotes présumées de la vaisselle de 4 puits ; maintenir les zygotes présomptives restants dans l’incubateur dans les mêmes conditions.
    1. Transfert le 10 zygotes présumées à une centrifugeuse 15 mL tube contenant 2 mL de PBS et vortex doucement pendant 2 min pour éliminer les cellules du cumulus. Laver deux fois dans du PBS, fix et tache, comme décrit précédemment (étape 2.23.2.)
  25. Après 18, 20, 22 et 24 h d’incubation Co, enlèvent 10 zygotes présomptifs du puits 4 plats et vortex, difficulté et tacher les comme décrit précédemment (étape 2.23.2). Conserver le reste des zygotes présumés dans l’incubateur dans les mêmes conditions.
    1. Évaluer la formation pronucléaire et polyspermie sous un microscope à épifluorescence-contraste/phase dans les deux groupes de FIV homologues et hétérologues par coloration avec Hoechst.
    2. Évaluer la formation pronucléaire dans 10 zygotes hybrides présumés choisis au hasard par exemple. Confirmer la formation pronucléaire sous un confocal laser scanning microscope à excitation de laser argon 488 nm et détection de 515 à 530 nm.
    3. Section optiquement zygotes présomptives séquentiellement (2 mm) et de recueillir des images à l’aide d’un logiciel d’imagerie. Visualiser à l’aide d’un progiciel d’analyse 3D.
    4. Après 24 h d’incubation Co, laver 50 zygotes présomptives quatre fois dans du PBS et deux fois dans le milieu de culture.
  26. Transférer dans les groupes de 25 à gouttelettes de milieu de culture précédemment préparé et équilibré.
  27. Maintenir à 38,5 ° C sous une atmosphère de 5 % O 2 / 5 % de CO 2 et dans l’air avec une humidité maximale.
  28. Après 26 et 28 h d’incubation Co, retirer 10 zygotes présumées de la vaisselle et le vortex, le fix et tacher les, comme décrit précédemment (étape 2.23.2).
  29. Après 48 h de culture, observer le clivage sous un stéréomicroscope.
  30. Supprimer la zone pellucide (ZP) par transfert des embryons à une solution de protéase de 5 mg/mL.
  31. Laver individuellement chaque embryon trois fois dans du PBS. Clin d’oeil-gel eux dans l’azote liquide dans des tubes de microcentrifuge de 0,2 mL. Les conserver à-80 ° C jusqu'à l’analyse.

3. PCR

  1. matériels et réactifs
    Remarque : les réactifs, matériaux et équipements utilisés pour effectuer le protocole PCR sont détaillées dans le tableau des matériaux et incluent un support de tubes PCR et un ensemble de micropipettes (P2, P20, P200, P1000), 1,5 mL tubes de microcentrifuge, tubes PCR et casquettes, un thermocycleur, un éclairage UV gel d’agarose et tampon (Tris Borate EDTA (TBE)).
    1. Décongeler doucement tous les réactifs sur la glace. Les maintenir dans la glace tout au long de l’expérience. Utilisez désoxynucléotides (dNTPs ; dATP, dCTP, dTTP et dGTP), cibler les amorces sur la référence gène codant pour la protéine ribosomique de Dauphin 18 S (DQ404537.1) ; R1 : TTGGACACACCCACGGTGCGG et F2 : CAGAAGGACGTGAAGGATGGA), l’ADN polymérase, zone tampon de 5 X pour l’ADN polymérase ADN modèle, eau stérile et le chlorure de magnésium (MgCl 2 à une concentration finale de 5,0 mM).
    2. Préparation de gel et échantillon de
    3. d’Agarose.
      1. Prepare dolphin et bovine sperme ADN des échantillons.
        1. Dégel une paille congelée de chaque espèce dans un bain-marie à 37 ° C pour 50 s. Ajouter 3 mL de solution de lavage. Centrifuger à 250 x g pendant 10 min. Retirez le surnageant. Ajouter 30 µL de tampon de lyse STES (50 mM Tris-HCl, pH 8 ; 20 mM NaCl ; et SDS 0,1 % 1 mM), 2 µL de protéinase K (20 mg/mL) et 5 µL de dithiothréitol (DTT) ; concentration finale : 150 mM. Maintenir toute la nuit à 55 ° C. Ajouter 200 µL d’eau ultrapure. Centrifuger à 250 x g pendant 5 min. Gardez le surnageant. Mesurer la concentration d’ADN à l’aide d’un spectrophotomètre.
      2. Effectuer des dilutions successives de l’ADN des spermatozoïdes de Dauphin (c.-à-d., 40, 4 et 0,4 ng/mL) avec de l’eau ultrapure pour vérifier que les conditions de la PCR sont capables de détecter une petite quantité d’ADN des dauphins.
      3. Effectuer des dilutions successives de sperme bovin ADN (c.-à-d., 4 000, 400, 40 et 4 ng/mL) avec de l’eau ultrapure pour vérifier que les conditions de la PCR sont capables de détecter une petite quantité d’ADN bovin.
      4. Préparer les embryons des dauphins et des bovins. Décongeler les embryons sur la glace. Ajouter 8 µL de protéinase de µg/mL 100 K et maintenir toute la nuit à 55 ° C. Pour arrêter la réaction, placer les échantillons à 96 ° C pendant 5 min.
      5. Préparer 2 % d’agarose gel tampon TBE et ajouter 20 µL de tache acide nucléique utilisant les techniques standard.
    4. PCR préparation.
      1. Tubes PCR label : dilutions sérielles Dauphin (40, 4 et 0,4 ng/mL), des dilutions sériées bovines (4 000, 400, 40 et 4 ng/mL), homologue bovine deux cellules embryon, embryons hétérologues présumées de deux cellules et le contrôle négatif.
      2. Préparer un mélange maître dans un tube stérile microtubes de 1,5 mL pour un volume final de 25 µL par réaction.
        1. Ajouter 5 µL de tampon flexi de 5 X ADN polymérase, 0,5 µL des dNTPs (10 mM) 1,5 µL de MgCl 2 (25 mM), 0,5 µL d’apprêt avant et arrière (10 µM), 1,5 µL de matrice d’ADN (sperme) ou 8 µL de matrice d’ADN (deux cellules des embryons) , 0,07 µL de la Taq polymérase et stérile distillée jusqu'à un volume final de 25 µL. Bien mélanger.
  2. Amplification Protocol
    1. Placer les tubes dans le thermocycleur. Sélectionnez le programme suivant : 94 ° C pendant 3 min ; 40 cycles de 94 ° C pendant 15 s, 59 ° C pour 25 s, 72 ° C pendant 20 s ; et 72 ° C pendant 5 min. démarrer le programme.
    2. Stocker les tubes à 4 ° C. Ajouter 2,5 µL de tampon pour chaque produit PCR à 4 ° C et charge 15 µL du mélange de chargement dans les puits du gel d’agarose à 2 %. Utilisez un marqueur d’échelle de l’ADN pour l’estimation de la taille précise de fragments PCR.
    3. Perform électrophorèse pendant 15 minutes permettre la migration de l’ADN. Visualiser les bandes à l’aide d’un illuminateur UV.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Toutes les résultats, les tables et les figures (1 et 2) présentées ici ont été reproduites avec la permission de3.

Les spermatozoïdes des dauphins ont grande motilité après congélation-décongélation

Les éjaculats congelé-décongelé Dauphin a montré les pourcentages (% ± SD) 84.5 ± 5,3 total motile et 69,1 ± 5.1 progressive spermatozoïdes. En termes de mobilité, ces chiffres sont représentatifs des spermatozoïdes cryoconservés de haute qualité.

Les spermatozoïdes de dauphins sont capables de pénétrant zona intacte bovine ovocytes et produisant des embryons hybrides

Figure 1 a et tableau 1 montrent Dauphin spermatozoïdes attachées à la ZP bovine après 2,5 h d’incubation Co. Les spermatozoïdes des dauphins étaient fixés à un pourcentage plus élevé que les spermatozoïdes bovines (Figure 1 b et tableau 1). En effet, la microscopie en fluorescence montre que les spermatozoïdes de dauphins sont capables de pénétrer le zona spermatozoïdes intacts bovine (Figure 1), menant à la formation pronucléaire et le clivage (Figure 1E et tableau 1). Cela a été confirmé par microscopie confocale (Figure 1 et Figure 1F). Aucun polyspermie a été observée dans les ovocytes du groupe FIV hétérologue après 12 h d’incubation Co (tableau 1). Formation de pronucléaire dans la FIV hétérologue atteint le pourcentage le plus élevé après 24 h, un temps plus long que dans le groupe homologue, qui a eu lieu à 18 h d’incubation Co (tableau 1). Le taux de clivage à 48 h après l’incubation était inférieur dans l’hétérologue la FIV homologue (tableau 1). Un taux d’activation parthénogénèse spontanée de 8,0 % a été observé dans les ovocytes non fécondés mûris bovines après 48 h (tableau 1).

Enfin, les résultats PCR ont confirmé la présence de matériel génétique de dauphins dans les embryons hybrides (Figure 3) en évaluant la présence d’un gène de référence de dauphin qui encode les ribosomique 18 S protéine (Figure 2).

Figure 1
Figure 1 : les spermatozoïdes Dolphin attaché à la bovine zone pellucide (ZP). Dolphin ci-joint (A) et bovins (B) les spermatozoïdes après 2,5 h d’incubation Co avec zona intacte bovine ovocytes. Gamètes ont été souillés avec Hoechst et visualisées au microscope à contraste de phase (grossissement de 40 X). Un spermatozoïde de Dauphin en l’espace de periviteline d’un ovocyte bovin (C et D) et un decondensing tête dauphin du spermatozoïde dans le cytoplasme de l’ovocyte bovin (E). Images capturés sous un microscope confocal, correspondent au plan équatorial du zygote présomptive (coloration de Hoechst, un grossissement de 40 X). Deux pronuclei (F) observé sous un microscope à contraste de phase après 24 h de FIV hétérologue consistant en l’incubation co des spermatozoïdes de Dauphin avec zona intacte bovine ovocytes (coloration de Hoechst ; 40 X grossissement ; Echelle = 25 µm). La figure a été reproduite de référence3 avec permission. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : électrophorèse représentatif (2 % d’agarose gel du bromure d’éthidium teinté) montrant les résultats d’amplification PCR pour le gène de Dauphin 18 S. Voies de 1 à 30 montrent des embryons hybrides présumés Dauphin/bovine ; voies de S1 et S2 disposent de 4 ng/mL et le sperme de Dauphin de 0,4 ng/mL ADN, respectivement ; et voies C1 à C5 disposent d’embryons de bovins de deux cellules et H2O (eau) (le témoin). La flèche indique la bande de 190-bp correspond à l’amplification 18 S rADN. La figure a été reproduite de référence3 avec permission. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : images représentatives des embryons hybrides. Image représentative d’un embryon de deux cellules hybrides (A) à 48 h d’incubation (coloration de Hoechst, un grossissement de 40 X). Embryons hybrides non colorés après 48 h d’incubation, à différents stades de division, visualisés sous le stéréomicroscope (B). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Table 1
Tableau 1 : taux de fixation, polyspermie, formation pronucléaire et clivage après incubation co homologue et hétérologue bovines ovocytes et spermatozoïdes bovins ou dauphin, respectivement. Les variables ont été analysés avec analyse de la variance (test de Kruskal-Wallis et de Mann-Whitney). Les valeurs sont exprimées en la moyenne ± SEM (plage) de douze répétitions ; n = le nombre total d’ovocytes ou présumés zygotes examinés. Le tableau a été reproduit de référence3 avec permission. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Pour de nombreuses espèces de mammifères différents, il y a divers avantages à l’utilisation de sperme congelé-décongelé. Celles-ci comprennent la possibilité de transférer le matériel génétique précieux, le potentiel de distribution dans le monde entier, le faible risque de contamination et la capacité de préserver des gamètes mâles pendant des décennies. L’utilisation de spermatozoïdes cryoconservés est essentielle pour le grand dauphin, parce que cette espèce est protégée en vertu de l’annexe II de la CITES, qui limite le transport et les échanges d’animaux entre les différents parcs aquatiques. Transport des dauphins est une activité qui crée des problèmes logistiques et des risques dangereux. Cependant, en s’abstenant de transporter les animaux a aussi des conséquences telles que le risque d’introduction de consanguinité à une population en captivité des animaux. Une solution est la cryoconservation du sperme. Certains auteurs ont cryopréservé Dauphin sperme5,7,8,9, avec très des résultats encourageants. En outre, en 2005, la première naissance d’un veau de Dauphin conçu par insémination artificielle avec sperme cryoconservés a rapporté10. Quelques années plus tard, cela a été fait à l’aide de sex-tri des spermatozoïdes,11.

Sperme de dauphins ont été cryoconservés utilisant différentes techniques, de méthodes sophistiquées, par exemple un congélateur programmable5, de méthodologies communes, telles que les vapeurs de la glace sèche12 ou liquide azote2,9, 13. Le principal avantage de l’utilisation de neige carbonique ou des vapeurs d’azote liquide est la possibilité de cryopréserver au même endroit où le sperme est extraite, sans l’utilisation d’équipements hautement spécialisés. Sperme congelé en paillettes sur du polystyrène dans des vapeurs d’azote liquide est une méthode simple, rapide et peu coûteux de13. Dans la pratique, lorsque cette méthodologie a été utilisée sur les dauphins, la motilité des spermatozoïdes était de 65 %. Toutefois, il est important de considérer combien il est difficile d’établir une méthode normalisée : la technique peut être influencée par des facteurs externes, tels que température, humidité, taille en polystyrène, etc.. Par conséquent, plus amples études sont nécessaires pour optimiser et uniformiser la procédure afin d’améliorer le succès de l’utilisation de sperme congelé avec la méthode de vapeur de l’azote liquide.

Afin d’optimiser un protocole de congélation, il est important de développer une méthode fiable pour l’évaluation fonctionnelle des spermatozoïdes. FIV est un bon moyen de tester le sperme potentiel pour la fécondation. Idéalement, les ovocytes de Dauphin doivent être utilisés pour la FIV, mais les procédures difficiles et laborieuses, nécessaires pour obtenir les ovocytes provenant de femelles représentent une contrainte importante. Par conséquent, la possibilité d’utiliser FIV hétérologue ouvre un nouveau moyen pour tester l’efficacité de la fécondation chez le Dauphin. Ovocytes d’autres espèces peuvent être utilisés pour des dauphins FIV hétérologue. Les résultats montrent que la FIV hétérologue entre bovines ovocytes et les spermatozoïdes des dauphins peut être effectuée. Les spermatozoïdes congelés et décongelés Dauphin peuvent pénétrer l’ovocyte bovin intact de zona et générer un embryon hybride.

La combinaison présentée des protocoles pour la collecte, gel-dégel et la réalisation de FIV hétérologue avec ovocytes bovines ont fait leur preuve et représente un premier pas pour l’optimisation de la cryoconservation et l’évaluation des sperme de Dauphin. Il est important de noter qu’il y a encore beaucoup d’inconnues dans ces procédures. Toutefois, la capacité de cryopréserver sperme de Dauphin, ce qui la rend accessible et lui permet d’être conservé dans les laboratoires. Cela facilitera les études scientifiques et peut conduire à une meilleure compréhension de la physiologie, la composition et le comportement des spermatozoïdes.

L’évaluation des spermatozoïdes par FIV hétérologue peut faciliter l’optimisation des protocoles de congélation, mais il peut également être utilisé à l’avenir pour tester et sélectionner les mâles pour l’efficacité de la fertilité. Un facteur important est la relation entre le nombre réel de la fertilisation et les valeurs de FIV hétérologues. En outre et en raison de la nouveauté de la FIV hétérologue entre ces deux espèces phylogénétiquement éloignées, les bovins et les dauphins, les nouvelles hypothèses biologiques peuvent être construits. Au total, ces protocoles ouvrent un nouvel espace pour la recherche sur la reproduction, les dauphins et autres mammifères marins.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

ses travaux ont été financés par le ministère espagnol de l’économie et la compétitivité (AGL2015-70140-R à D. Rizos), AGL2015-66145R A. Gutierrez-Adan et J. F. Pérez-Gutiérrez et Seneca Fondation de Murcie (Grant 20040/germe/16 à F. García-Vázquez)

Materials

Name Company Catalog Number Comments
FERT-TALP medium Merck
TCM-199 Sigma M-4530
Hoechst 33342 Sigma B-2261
4-well dishes Nunc 176740
Density gradient BoviPure Nidacon International BP-100
Washing solution Boviwash Nidacon International BW-100
Magnesium chloride Promega A35 1H
Sterile water Mili Q sintesis A10 Millipore A35 1H
Buffer Tris Borate EDTA Sigma T4415
MB agarose Biotools 20.012
5X GoTaq flexi buffer Mili Q sintesis A10 Millipore M 890 A
MB agarose Biotools 20.012
Taq polymerase Promega
SafeView NBS Biologicals Ltd. M 890 A
Makler counting chamber Sefi Medical
Thoma chamber Hecht-Assistant
pHmeter MicropH 2000 Crison Instruments
Osmometer Advanced micro osmometer 3300 Norwood
Computer assisted sperm analysis system Projectes y Serveis R+D
Stereomicroscope MZ 95 Leica
Epifluorescent optics Eclipse Te300 Nikon
Confocal assistant 4.02 software Bio-Rad 3D analysis software
Confocal laser scanning microscopy Bio-Rad
Micropippetes (P2. P20, P200, P1000) Gilson
Microcentrifuge tubes VWR
UV iluminator Bio-Rad
PCR Thermal cycler Primus 96 Plus MWG AG Biotech

DOWNLOAD MATERIALS LIST

References

  1. Montano, G. A., et al. Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation. Reproduction. 143, (6), 799-813 (2012).
  2. Sánchez-calabuig, M. J., et al. Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 49, (5), 761-768 (2014).
  3. Sánchez-calabuig, M. J., et al. Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa. Theriogenology. 84, (6), 983-994 (2015).
  4. Keller, K. V. Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination. IAAAM. 14, (22), 22-24 (1986).
  5. Robeck, T. R., O'brien, J. K. Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa. Biol Reprod. 70, (5), 1340-1348 (2004).
  6. Coy, P., et al. Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow. Reproduction. 135, (1), 19-27 (2008).
  7. Seager, S., W, G., Moore, L., Platz, C., Kirby, V. Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus). Proceedings of the American Association of Zoo Veterinarians. 136, (1981).
  8. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  9. Sánchez-Calabuig, M. J., et al. Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus). Reprod Domest Anim. 50, (2), 227-235 (2015).
  10. Robeck, T. R., et al. Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus). Reproduction. 129, (5), 659-674 (2005).
  11. Robeck, T. R., et al. Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus). Anim Reprod Sci. 139, (1-4), 168-181 (2013).
  12. Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. The Bottlenose dolphin. Leatherwood, S., Reeves, R. R. Academic Press. San Diego. 447-460 (1990).
  13. Madeddu, M., et al. Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen. Anim Reprod Sci. (2016).
Grand Dauphin (<em>Tursiops truncatus</em>) spermatozoïdes : Collection, cryoconservation et la fécondation <em>In Vitro</em> hétérologue
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).More

Sánchez-Calabuig, M. J., García-Vázquez, F. A., Laguna-Barraza, R., Barros-García, C., García-Parraga, D., Rizos, D., Gutiérrez Adan, A., Pérez-Gutíerrez, J. F. Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization. J. Vis. Exp. (126), e55237, doi:10.3791/55237 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter