Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Analyse af kromosomsegregation, histonacetylering og spindelmorfologi i hesteococytter

doi: 10.3791/55242 Published: May 11, 2017

Summary

Dette manuskript beskriver en eksperimentel tilgang til morfologisk og biokemisk karakterisering af hesteocyter. Specifikt illustrerer det foreliggende arbejde, hvordan man opsamler umodne og modne hesteocyter ved hjælp af ultralydstyret ægoptagelse (OPU) og hvordan man undersøger kromosomsegregation, spindelmorfologi, global histonacetylering og mRNA-ekspression.

Abstract

Området for assisteret reproduktion er udviklet til behandling af infertilitet hos kvinder, ledsagere og truede arter. I hesten tillader assisteret reproduktion også produktion af embryoner fra højtydende uden at afbryde deres sports karriere og bidrager til en stigning i antallet af føl fra marer af høj genetisk værdi. Det nuværende manuskript beskriver de procedurer, der anvendes til at indsamle umodne og modne oocytter fra hestevacci ved anvendelse af ægoptagelse (OPU). Disse oocytter blev derefter brugt til at undersøge forekomsten af ​​aneuploidi ved at tilpasse en protokol, der tidligere var udviklet hos mus. Specifikt blev kromosomer og centromerer af metafase II (MII) oocytter mærket fluorescens og talt på sekventielle fokalplaner efter konfokal lasermikroskop scanning. Denne analyse afslørede en højere forekomst i aneuploiditetsfrekvensen, når umodne oocytter blev opsamlet fra folliklerne og modnet in vitro i forhold tilIn vivo. Immunostaining for tubulin og den acetylerede form af histon 4 ved specifikke lysinrester afslørede også forskelle i den meotiske spindels morfologi og i det globale mønster af histonacylering. Endelig blev ekspression af mRNA'er kodende for histon-deacetylaser (HDAC'er) og acetyltransferaser (HAT'er) undersøgt ved revers transkription og kvantitativ-PCR (q-PCR). Ingen forskelle i det relative ekspression af transkripter blev observeret mellem in vitro og in vivo modnede oocytter. I overensstemmelse med en generel afstødning af transkriptionsaktiviteten under oocytmodning kan analysen af ​​det totale transkriptionsbeløb kun afsløre mRNA-stabilitet eller nedbrydning. Disse resultater viser derfor, at andre oversættelses- og posttranslationelle bestemmelser kan påvirkes.

Samlet set beskriver den foreliggende undersøgelse en eksperimentel tilgang til morfologisk og biokemisk karakterisering af hesteocyten, en ceLl type, der er ekstremt udfordrende at studere på grund af lav sample tilgængelighed. Det kan dog udvide vores viden om reproduktiv biologi og infertilitet hos monovulatoriske arter.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En bred vifte af assisterede reproduktionsteknikker er blevet udviklet til behandling af infertilitet hos kvinder, ledsagere og truede arter. En af de mest almindelige procedurer i kliniske indstillinger er hentning af metafase II (MII) -stadieocytter fra ovariefolliklerne ved ultralydstyret transvaginal aspiration, opsamling af æg (OPU) 1 . Disse oocytter befrugtes derefter in vitro (IVF), med det resulterende embryo (er) implanteret i en recipient uterus. MII-stadie (modne) oocytter hentes efter administration af eksogene gonadotropiner. Denne behandling er imidlertid forbundet, hos nogle patienter, med udviklingen af ​​ovarie hyperstimulationssyndrom (OHSS) 2 .

At drage fordel af den egentlige evne hos fuldt dyrkede, umodne oocytter (GV-stadium) til spontant at genoptage meioser, når de er isoleret fra deres follikler, er det muligt at opnå modne oocytter uden administrationGonadotropin 3 . Denne procedure kaldes oocyt in vitro modning (IVM) og repræsenterer en mindre lægemiddelorienteret, billigere og mere patientvenlig tilgang til assisteret reproduktiv teknologi. Succesen med embryonudvikling med in vitro- modnede oocytter er imidlertid generelt lavere end hos in vivo modnede oocytter 4 , 5 . En mulig forklaring er, at in vitro- modnede oocytter påvirkes mere af fejl i kromosomsegregation, og den resulterende aneuploidi nedsætter normal embryonal udvikling 6 .

Forståelse af det molekylære grundlag for kromosom mis-segregering under IVM vil i sidste ende afsløre det fulde potentiale ved denne teknik. I denne vene anvendte den eksperimentelle tilgang til at undersøge de morfologiske og biokemiske egenskaber hos in vitro- modnede oocytter sammenlignet med in vivo modEd oocytter er her beskrevet 7 , 8 . Specifikt er procedurerne for OPU af umodne og modne oocytter og IVM af umodne oocytter illustreret under anvendelse af voksne og naturligt cykliske heste som en eksperimentel model. Derefter anvendes immunofluorescens og billedanalyse til at undersøge chromosomsegregation, spindelmorfologi og det globale mønster af histonacylering på disse gameter. Endelig beskrives en protokol for revers-transkription og kvantitativ PCR til analyse af mRNA-ekspression.

Sammenlignet med gnaverdyrmodeller tillader heste ikke genetisk manipulation, er det mindre let at manipulere og kræver dyr vedligeholdelse. Denne model får imidlertid stor interesse for undersøgelsen af ​​oocytmodning 9 , 10 på grund af ligheden med menneskelig ovariefysiologi 11 , 12 </ Sup>. Desuden har udviklingen af ​​pålidelige protokoller af IVM-IVF i hesten en væsentlig økonomisk interesse, da det ville muliggøre en forøgelse af antallet af føl fra marer af høj genetisk værdi.

En af begrænsningerne ved at udføre forsøg på oocytter, især i monovulatoriske arter, er den begrænsede prøve tilgængelighed. Denne grænse er blevet overvundet her ved at justere en fremgangsmåde, der tidligere er udviklet i mus, til hesteocyter 13 , 14 for at udføre kromosometælling, der minimerer prøveforløbet (se diskussionen for en sammenligning med andre tilgængelige teknikker). Desuden er en triple-fluorescensfarvningsprotokol optimeret til at udføre flere analyser på den samme prøve, og q-PCR-analyser blev kun udført på puljer med kun 2 oocytter.

Samlet set beskriver den foreliggende undersøgelse en eksperimentel tilgang, der har til formål at morfologisk og biokemisk chaRacterize hest oocyt, en celletype, der er ekstremt udfordrende at studere på grund af den lave prøve tilgængelighed. Det kan dog udvide vores viden om reproduktiv biologi og infertilitet hos monovulatoriske arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle procedurerne blev godkendt af Dyrepleje- og brugskomitéen CEEA Val de Loire nummer 19 og blev udført i overensstemmelse med de vejledende principper for pleje og brug af laboratoriedyr.

1. Oocytopsamling og In vitro modning

  1. Ovum pick-up
    1. Dagligt vurder ved ultralyd diameteren af ​​æggestokkene i en kohorte af voksne hopper. Ved fremkomsten af ​​en follikel ≥33 mm (dominerende follikel) injiceres hoppen med 1500 IE af humant choriongonadotropin (hCG) i den øvre del af jugularvenen (iv).
      1. Inden indsprøjtningen udføres, swab området med alkohol, find den jugulære fur, og læg tommelen 2-3 cm under injektionsstedet for at få vejen til at stige. Indsæt nålen næsten parallelt med nakken og aspirer for at sikre, at nålen er i vene (blodet kommer ind i sprøjten). På dette tidspunkt injicer; HCG vil fremkalde mAturation af oocyten i den dominerende follikel.
    2. 35 h efter hCG-injektionen seder mareen med detomidin (15 μg / kg, iv), butorphanoltartrat (10 μg / kg, iv) og butylscopolaminbrom (0,2-0,3 mg / kg, 15 ml / mare, iv).
    3. Tilslut nålen til ultralydssonden. Indsæt ultralydssonden vaginalt og hold ovnen transretalt til ansigt med ultralydssonden. Instruér en operatør til at manøvrere nålen og den anden for at holde æggestokken på plads med follikelet mod ultralydssonden . Start fra æggestokken med den dominerende follikel.
    4. Punktere vaginalvæggen og den dominerende follikels væg med nålen (ultralydsprober til OPU er udstyret med en kanal til nålen forbundet med et sugesystem); Theneedle vil være synlig i det echografiske billede.
    5. Aspirer follikulærvæsken i et 50 ml konisk rør forbundet med sugesystemet. Hæld indholdet af den koniskeRør ind i en stor petriskål og søg efter cumulus-oocytkomplekset (COC) ved hjælp af et stereomikroskop.
    6. Da COC'en ikke altid hentes med follikulærvæsken, skylles follikelet med Dulbecco's modificerede phosphatbufret saltvand (DPBS) indeholdende 5 IE / ml heparinat 37 ° C. Undersøg DPBS for COC-tilstedeværelse som tidligere beskrevet for follikelvæsken i trin 1.1.5. Skyl flere gange, indtil COC hentes.
    7. Når COC fra den dominerende follikel er hentet, punkteres og spyles folliklerne ≥5 og ≤25 mm som beskrevet for den dominerende follikel i trin 1.1.3-1.1.4; Follikler ≥5 og ≤25 udtrykker ikke luteiniserende hormon / choriogonadotropinreceptor (LHCGR), og derfor vil deres oocytter ikke modne som følge af hCG og vil blive indsamlet på GV-stadium (umodne). Hold kun COC'er med flere komplette lag cumulusceller og brun, fingranuleret åblasm. Kassér de andre.
    8. I slutningen af ​​OPU, iLæg mareen med benzyl-penicillin 15.000 IE / dyr for at forhindre infektion.
    9. Hus mareen i et stille, rent stald i mindst 2 timer. Kontrollér tegn på bevidsthed ved at bestemme ørernes stilling, reaktion på stimuli ( fx støj) og gang før du returnerer mare til selskab med andre dyr.
  2. In vitro modning
    1. Varm HEPES-bufferet TCM199 (20 mM Hepes) suppleret med 1,790 IE / L heparin, 0,4% bovint serumalbumin (BSA), penicillin og streptomycin til 37 ° C. Forbered dette medium på forhånd. Filtrer-steriliser og hold den ved 4 ° C i op til 6 måneder.
    2. Forbered IVM-mediumet ved at supplere NaHCO3-bufferet TCM199 (25 mM NaHC03) med 50 ng / ml epidermal vækstfaktor (EGF) og 20% ​​kalveserum 7 . Brug NaHCO 3- buffer TCM199 inden for 3 uger efter åbning af en ny flaske. Forbered EGF på forhånd som 100x lagre, frys det ved -20 ° C, Og brug det inden for 6 måneder. Dispense 500 μL i brøndene i en 4-brønds skål og inkuber i befugtet luft med 5% CO2 ved 38,5 ° C i mindst 2 timer.
    3. Efter hentning af COC'erne fra ≥5 og ≤25 mm folliklerne, sæt dem i en petriskål (3,5 cm diameter) fyldt med 2 ml HEPES-TCM199. Flyt COC'erne til forskellige områder af opvaskemaskinen for at vaske væksten fra det cellulære materiale.
    4. Overfør COC'erne til IVM-mediet og inkuber i 28 timer i befugtet luft med 5% CO2 ved 38,5 ° C.

2. Immunofluorescens og billedanalyse

  1. Kromosometælling
    1. Efter indsamling fra den dominerende follikel eller ved slutningen af ​​IVM inkuberes COC'erne med 100 μM monastrol i 1 time i befugtet luft med 5% CO2 ved 38,5 ° C. Forbered monastrol på forhånd som 100x lagre og opbevar den ved -20 ° C i op til 1 år.
    2. Fjern cumuluscellerneVed at behandle dem med 0,5% hyaluronidase eller ved forsigtig pipettering; Fjern zona pellucida ved at behandle det i 0,2% pronase. Forbered hyaluronidase og pronase i forvejen som 10x lagre og opbevar dem ved -20 ° C i op til 1 år.
    3. Fastgør oocytterne i 4% paraformaldehyd i DPBS i 15 minutter ved 38,5 ° C efterfulgt af yderligere 45 minutter ved 4 ° C.
      ADVARSEL! Brug personlige værnemidler, når du håndterer paraformaldehyd, og bortskaffer forurenede materialer i overensstemmelse med retningslinier for bortskaffelse af farligt affald.
    4. Vask oocytterne ved sekventielt at overføre i 3 brønde fyldt med 500 μl DPBS suppleret med 0,1% polyvinylalkohol (PVA). Permeabiliseres i 0,3% Triton X-100 i 10 minutter ved stuetemperatur (RT).
    5. Bloker ikke-specifik binding ved inkubation i DPBS suppleret med 1% bovint serumalbumin (DPBS-1% BSA) og 10% normalt æsel serum i mindst 30 minutter ved stuetemperatur. Prøver kan opbevares i blokerende opløsning ved 4 ° C i 3-4 dage.
    6. Til primær farvning inkuberes oocytterne i kanin-anti-Aurora B-phospho-Thr232 i DPBS suppleret med 1% BSA (fortynding 1:50) ved 4 ° C natten over.
    7. Vask oocytterne som beskrevet i trin 2.1.4. Inkuber oocytterne i en opløsning af tetra-methylrhodaminisothiocyanat (TRITC) -konjugeret æsel-anti-kanin-IgG (1: 100 i DPBS-1% BSA) i 1 time ved RT i mørke.
    8. Vask oocytterne som beskrevet i trin 2.1.4, og læg derefter 3-4 oocytter i en dråbe ikke-hærdet, fugtigt monteringsmedium suppleret med 20 μM YOPRO1 på en glasskinne. Gentag proceduren, indtil alle oocytterne er monteret (3-4 oocytter pr dias).
    9. Lad oocytterne aflejres i ca. 10 minutter i monteringsmediet, og dæksel dem med et dækslip. For at undgå at knuse oocytterne, anbring to striber dobbeltsidet tape, inden du lægger dækslet på glasskinnen.
      BEMÆRK: Denne forholdsregel vil også sikre, at alle prøverne er lige komprimeret mellem glassliDe og dækslet. Glasskinner kan frosne ved -20 ° C og afbildes i løbet af de følgende 2-3 dage.
    10. Billedprøverne på et konfokal laserscanningsmikroskop med et 60X objektiv ved hjælp af de røde (centromerer) og grønne (kromosomer) kanalerne 7 , 13 , 14 , 20 , 21 . Scan prøverne, der spænder over hele metafaspladen på z-aksen, med trin hver 0.35 μm. Gem de digitaliserede billeder af hver enkelt plan.
    11. Tæl centromererne i serielle konfokale sektioner ved hjælp af celletællingsfunktionen i NIH ImageJ-softwaren (tilgængelig på: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      BEMÆRK: Undgå et gentaget antal centromerer, der vises på tilstødende sektioner ved at identificere de centromerer, der vises, forbliver og forsvinder i sekventielle sektioner med en numerisk kode.
    12. Gentag det kromosomale coUnting i trin 2.1.11 med en uafhængig operatør.
      BEMÆRK: Klassificer oocytterne som euploid (32 kromosomer), hyperploid (> 32) eller hypoploid (<32).
  2. Spindelmorfologi og histonacetylering
    1. Efter indsamling fra den dominerende follikel eller ved afslutningen af ​​IVM fjerner cumuluscellerne ved behandling i 0,5% hyaluronidase eller ved forsigtig pipettering som beskrevet i trin 2.1.2.
    2. Vask oocytterne i DPBS-PVA, som i trin 2.1.4, og reparer dem i 2,5% paraformaldehyd i 20 minutter ved 38 ° C. Vask grundigt som beskrevet i trin 2.1.4 og permeabiliser i 0,1% Triton X-100 i 5 minutter ved stuetemperatur.
      BEMÆRK: Brug personlige værnemidler, når du håndterer paraformaldehyd og bortskaffer forurenede materialer i overensstemmelse med retningslinier for bortskaffelse af farligt affald.
    3. Bloker ikke-specifik binding ved inkubation i DPBS suppleret med 2% bovint serumalbumin (DPBS - 2% BSA), 0,05% saponin og 10% normalt æsel serum fo2 timer ved stuetemperatur.
      BEMÆRK: Prøver kan opbevares i blokerende opløsning ved 4 ° C i 3 - 4 dage.
    4. Til primær farvning inkuberes oocytterne i mus anti-alfa-tubulin (1: 150) og kanin anti-acH4K16 (1: 250) i DPBS-2% BSA med 0,05% saponin ved 4 ° C natten over.
    5. Vask oocytterne som i trin 2.1.4. Inkuber oocytterne i en opløsning af grønt fluorescerende farvestof-konjugeret æsel-anti-mus-IgG (1: 500) og TRITC-konjugeret æsel-anti-kanin-IgG (1: 100) i DPBS-2% BSA med 0,05% saponin i 1 time ved RT i mørket.
    6. Vask oocytterne som i trin 2.1.4, og læg derefter 3-4 oocytter i en dråbe af det ikke-hærdende, fugtige monteringsmedium suppleret med 1 μg / ml 4'-, 6-diamidino-2-phenylindol (DAPI) På en glasskinne.
    7. Monter oocytene på glasskinner som beskrevet i trin 2.1.8.
    8. Billedet prøverne på et konfokal laser scanningsmikroskop med et 60x objektiv ved hjælp af de røde (acH4K16), grønne (alfa-tubulin) og blå (DNA) kanaler.
      BEMÆRK: Hold laserindstillingerne for de røde og blå kanaler konstante under overtagelsen af ​​alle prøverne. Scan prøverne, der spænder over hele meiotisk spindel og metafasisk plade på z-aksen, med trin hver 0.35 μm. Gem de digitaliserede billeder (enkeltplaner og projiceret 3D-billede).
    9. Mål pole-til-polet spindelængde og spindeldiameteren ved den maksimale bredde på det projicerede billede ved hjælp af målefunktionen af ​​NIH ImageJ-softwaren (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Gentag hver 3 gange og beregne middelværdien.
    10. Kvantificer den relative fluorescens af acH4K16 ved hjælp af funktionen Integreret tæthed af NIH ImageJ-softwaren (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normaliser det for den integrerede tæthed af DAPI-farvningen.

3. Analyse af mRNA-ekspression

  1. Når COC'erne er hentet fra 5 til 25 mm folliklerne, saml granulosecellerneUspension, der forblev i petriskålen og vaskes to gange i kold DPBS ved centrifugering ved 10.600 xg i 2 min. Snapfryse i flydende nitrogen. Opbevar prøverne ved -80 ° C i op til 6 måneder; Cellerne vil tjene til standardkurven.
  2. Fjern forsigtigt alle cumuluscellerne, som beskrevet i trin 2.1.2, fra umodne (GV), in vitro modnede og in vivo modnede oocytter.
  3. Vask oocytterne som beskrevet i 2.1.4 i DPBS-PVA, saml dem enkeltvis i 1 μl volumener og læg 2 μL RNALater ovenpå. Snapfrysning i flydende nitrogen. Opbevar prøverne ved -80 ° C i op til 6 måneder.
  4. Tilsæt 2 pg Luciferase RNA til hver prøve som en spike-in. Pool oocytene 2 x 2 og ekstraher det samlede RNA ved anvendelse af et siliciumdembranfilterbaseret kit, der er egnet til at genvinde RNA fra små prøver.
  5. Omvendt transkriberer RNA'et i 10 μl med 0,25 μg tilfældige hexamere og mus-Moloney leukæmivirus omvendt transkriptase i 1 time ved 37 & # 176; C. Opbevar prøverne ved -20 ° C i op til 6 måneder.
  6. Fortynd cDNA fra granulosa cellerne i RNAse-frit vand til 50 ng / μl. Serielt fortynd denne opløsning 1:10 for at opnå 5 ng / μl, 0,5 ng / μl, 0,05 ng / μl og 0,005 ng / μl opløsninger.
  7. Sammensæt reaktioner i triplicat i et samlet volumen på 20 μl pr. Reaktion ved anvendelse af cDNA ækvivalent med 0,05 oocytter som substratet eller 5 μl af de serielle fortyndinger af granulosa celle cDNA, 10 μl SYBR grøn supermix og 0,3 μM af hver specifik primer Tabel 1 ).
  8. Kør reaktionen i en termisk cykler ved anvendelse af en 3-trinsprotokol: 95 ° C i 30 s, 60 ° C i 30 s og 72 ° C i 20 s, gentaget 40 gange. Til sidst erhverver smeltekurven fra 60 ° C og øger temperaturen med 0,5 ° C hver 20. s op til 95 ° C.
  9. Bedøm startmængden (SQ) for det specifikke mRNA i oocytprøverne ved hjælp af standardkurvenF "> 15 beregnet på basis af granulosecelleprøven. Udtryk dataene som forholdet mellem SQ'et af genet af interesse og SQ'en af ​​husholdningsgenerne.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De oprindelige fund af disse eksperimenter blev beskrevet i dybden tidligere 7 og er her beskrevet som et eksempel på resultater, som kan opnås under anvendelse af de beskrevne protokoller.

Modningshastighed

Af de 32 COC'er, der blev hentet af OPU fra dominerende follikler, var 28 (88%) på MII-stadiet. Fjorten af ​​de 58 COC'er opsamlet fra follikler 5-25 mm i størrelse blev straks frosset som umodne oocytter til mRNA ekspressionsundersøgelsen. De resterende 44 blev modnet in vitro , og 37 nåede MII-stadiet (85%). Effektiviteten af ​​modning var ikke signifikant forskellig i de to grupper (Fishers eksakte test P> 0,05).

Aneuploidy rate

For at studere om IVM ca.N forstyrrer den trofaste kromosomale opdeling mellem den sekundære oocyt og den første polære krop, blev antallet af kromosomer ved MII-stadiet talt, da det repræsenterer resultatet af chromosomsegregation under meios I. Som vist i figur 1A , blev anti-Aurora B Phospho-Thr232-antistof specifikt farvede det centromere område i hesteocyter, hvilket tillod en at tælle antallet af kromosomer. In vitro- modnede oocytter blev signifikant mere påvirket af aneuploidi (5/11) sammenlignet med in vivo modnede oocytter (0/12; Fishers eksakte test, P <0,05; Figur 1B ). De fleste af de aneuploide oocytter (4/5) var hyperploide; Derfor er aneuploiditetsraten ikke resultatet af artefakter i fremstillingen af ​​det prøvebestemmende kromosomale tab, som sker med kromosomale spredninger. Immunostaining af den centromere region blev også forsøgt med anti-CENPA- og anti-AURKB-antistofferne, men intet signal var visUaliseret i begge tilfælde (data ikke vist).

Spindelmorfologi og acetylering af H4K16

Pol-til-polet spindelængde og spindelens diameter ved den maksimale bredde blev målt som vist i figur 2 . Ifølge disse målinger var in vitro- modne oocytter signifikant længere (19,89 ± 1,15 μm) og bredere (17,28 ± 0,81 μm) sammenlignet med in vivo modnede oocytter (14,57 ± 1,7 μm i længden og 13,56 ± 0,91 μm i diameter; oppareret t Test, P <0,05). På samme prøver blev det globale acetyleringsniveau for H4K16 også målt, hvilket bekræfter at acetylering ved H4K16 var signifikant lavere i IVM-oocytter sammenlignet med deres in vivo- modstykker ( Figur 2 , rød).

Udtryk af tranScripts kodende for histon acetyltransferaser og deacetylaser

Hvorvidt ekspressionen af ​​gener involveret i histon-acetylerings-deacetyleringsprocessen blev ændret i in vitro- modnede oocytter blev undersøgt med q-PCR. Histonacetyltransferase 1 ( HAT1 ), K-acetyltransferase 8 (KAT8 ), histon-deacetylase 1 ( HDAC1 ) og NAD-afhængig protein deacetylase sirtuin 1 ( SIRT1 ) blev identificeret som formodede mål. Betydelige forskelle i ekspressionen af ​​disse transkripter i umodne, in vitro modnede og in vivo modnede oocytter observeredes ikke uafhængigt af den anvendte normalisering. Specifikt blev resultaterne af transkriptionsudtryksanalysen, der blev rapporteret i figur 3, beregnet ud fra en standardkurve under anvendelse af SQ-metoden og normaliseret til husholdning glyceraldehyd-3-phosphat dehydrogenase ( GAPDH ). Tilsvarende, ingen forskelRencer blev observeret, når resultaterne blev normaliseret for spidsen i luciferase eller når ΔΔct-metoden blev anvendt (ikke vist).

Mål Fw primer Rv primer Amplicon størrelse
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
Luciferase TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148 bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Tabel 1: Primer Setails. 5'> 3'-sekvensen af ​​de fremadrettede (Fw) og (Rv) primere og den forventede ampliconstørrelse gives for hvert transkript analyseret: glyceraldehyd-3-phosphat dehydrogenase ( GAPDH ) , histonacetyltransferase 1 ( HAT1 ) , histon Deacetylase 1 ( HDAC1 ) , K-acetyltransferase 8 ( KAT8 ) , luciferase og NAD-afhængig protein deacetylase sirtuin 1 ( SIRT1 ). Genoptrykt med tilladelse fra reference 7 .

/55242fig1.jpg "/>
Figur 1: Aneuploidy Rate i Vivo- og In Vitro- modnede hesteococytter. ( A ) Repræsentative billeder, der viser aurora B phospho-Thr232 (rød) og DNA (grøn) farvning af en MII-fase heste-oocyt behandlet med monastrol. En euploid oocyt (32 kromosomer) er vist. Målestang = 5 μm. ( B ) Stanggrafen repræsenterer fordelingen af ​​euploide og aneuploide MII-trin-oocytter i in vivo (n = 12) og in vitro (n = 11) modnede oocytter. * Indikerer en signifikant forskel i aneuploiditetsfrekvensen (Fisher's nøjagtige test, P <0,05). Gentrykt med tilladelse fra Reference 7. Klik her for at se en større version af denne figur.

Figur 2 Figur 2: Spindelmåling og H4K16-acetylering i Vivo- og In Vitro- modnede hesteococytter. Repræsentative billeder, der viser tubulin (grøn), acetyleret H4K16 (rød) og DNA (blå) i MII-oocytter efter in vivo (n = 4) eller in vitro (n = 14) modning. Tubulinbillederne viser de akser, der anvendes til spindel længde og diameter målinger. Målestang = 5 μm. Ændret fra reference 7 . Klik her for at se en større version af denne figur.

Figur 3
Figur 3: Ekspression af KAT8 , SIRT1 , HAT1 , Og HDAC1 i ImmatuRe, in vivo Og in vitro modnede oocytter. Stanggraferne repræsenterer middelværdien ± SEM af den relative mRNA-ekspression af KAT8 , SIRT1 , HAT1 , Og HDAC1 , Udtrykt som startkvantiteten (SQ) for transkriptet af interesse sammenlignet med SQ for GAPDH , der anvendes som husholdning. Der blev ikke observeret statistiske forskelle mellem umodne (GV, n = 14), in vivo (n = 14) og in vitro (n = 12) modnede oocytter (envejs ANOVA, P > 0,05). Genoptrykt med tilladelse fra reference 7 . Klik her for at se en større version af denne figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Selv om IVM er blevet udført på heste i mere end 20 år 16 , ved vi endnu ikke, om oocyten kan være oprindelsen af ​​embryonal aneuploidi, som det er blevet foreslået for mennesker 17 . Årsagen er sandsynligvis, at fremstillingen af ​​oocyt-spredninger til kromosometælling resulterer i et betydeligt prøveab. Med dette i betragtning blev en undersøgelse af metoderne til undersøgelse af fejl i kromosomsegregation udført for at søge den mest hensigtsmæssige teknik til anvendelse på hesteocyter. Fire hovedteknikker blev fundet i den videnskabelige litteratur: 1) kromosomale spredninger 5 , 18 , 19 , 2) fluorescerende in situ hybridisering (FISH) 4 , 6 , 17 , 20 , 3) centromere tæller på monastrol-sammenbrudte spindler , 14 , 21 , 22 og 4) kromosom fluorescensfarvning uden kromosometælling 23 , 24 , 25 .

Som allerede nævnt kompliceres fremstillingen af ​​kromosomale spredninger efterfulgt af Giemsa-farvning ved en høj grad af prøveforsinkelse. Denne metode er i mange tilfælde blevet erstattet af FISH, som bruger specifikke prober til at kortlægge forskellige kromosomer. En ulempe ved FISH-teknikker er, at når et lille antal prober anvendes, kan forekomsten af ​​et falsk negativt øge ( dvs. identificere som normalt en celle, der er aneuploid, fordi det manglende eller supernumerære kromosom ikke er blevet probet). Den pålidelige brug af FISH er derfor i høj grad baseret på kendskabet a priori af kromosomerne, der hyppigere påvirkes af aneuploidi ( f.eks.., Kromosom 21 hos mennesker). FISH har tidligere været anvendt til at undersøge kromosomale abnormiteter i hesteembryoner ved anvendelse af 2 prober mod kromosom 2 og kromosom 4 20 . Ifølge disse eksperimenter er kernerne af in vitro producerede embryoner mere tilbøjelige til at blive påvirket af kromosomale abnormiteter end in vivo producerede embryoner. Dette fund er i overensstemmelse med den ovenfor anførte observation ved anvendelse af monastrol-sammenbrudsmetoden i IVM-oocytter. Forekomsten af ​​aneuploidi i IVM-oocytter var dog endnu højere end den, der blev rapporteret ved anvendelse af FISH i in vitro- producerede embryoner 20 . Denne partielle uoverensstemmelse kan forklares ved, at kun to kromosomspecifikke prober blev anvendt til FISH-forsøgene. Denne tilgang kunne have undervurderet forekomsten af ​​aneuploidi, der involverer andre kromosomer, især når man overvejer at heste har 32 kromosomer. Det kan dog ikke udelukkes, at alvorlig aneuPloider, der kan påvises i oocytterne, opretholdes ikke i embryoerne, fordi gameter, der er ramt af kritiske genetiske abnormiteter, muligvis ikke udvikler sig yderligere.

Kombinationen af ​​monastrolbehandlings-, kromosom- og centromerefarvning og konfokalmikroskopi tillod konsistente tællinger af kromosomtalet i MII-trinhesteocyter med minimal prøveforsinkelse. Den tekniske begrænsning, der opstod ved udvikling af denne teknik til hesteocyter, var tilgængeligheden af ​​hestespecifikke antistoffer. Inden Aurora B phospho- (Thr232) blev anvendt, producerede to andre antistoffer (anti-Aurora B og anti-CENPA) ikke en centromerisk plet. Især blev anti-Aurora B og anti-CENPA allerede succesfuldt anvendt i kvæg og humane celler 26 , 27 , 28 ; Derfor blev det konkluderet, at de ikke var specifikke for hesten. Denne teknik kan også begrænses af tilgængeligheden af ​​en konfokal laser scAnningmikroskop og billedanalysesoftware. Blindtælling af to uafhængige operatører er også afgørende for at udelukke operatørinducerede artefakter. Selvom kromosomaltællingen af ​​en monastrolkollapset spindel er en fremgangsmåde, som bedre bevarer cellens morfologi og forhindrer prøveforsinkelse, tillader denne teknik kun observation af forskelle i det basale antal kromosomer; Det er ikke informativt om andre kromosomale abnormiteter ( fx translokationer, segmentinterchanger osv. ), Der i stedet kan afsløres ved karyotyping og i nogle tilfælde af FISH.

Fejl ved kromosomsegregation er også undersøgt ved spindel- og kromosomimmunfluorescens uden at udføre et kromosomalt tal 23 , 24 , 25 . I dette tilfælde betragtes spindler med svære anomalier og forsinkede eller spredte kromosomer tegn på uregelmæssig chromosoMig adskillelse. Følgelig blev kromosomer, der blev spredt ud af spindlen, observeret i in vitro modnede oocytter 7 (den klasse, der er mere sandsynligt påvirket af aneuploidi). Imidlertid har kromosomaltælling den fordel at formidle kvantificerbar information.

Sammenfattende sammenlignet med de andre beskrevne teknikker har brugen af ​​monastrol og centromere farvning den fordel at forhindre prøvestab, minimere forekomsten af ​​falske negativer og være kvantificerbare.

Ændringen af ​​de epigenetiske modifikationer er blevet foreslået som en mulig mekanisme i begyndelsen af ​​oocyt aneuploidi 18 , 24 , 25 . Ved hjælp af en tredobbelt fluorescerende plet var det muligt at visualisere og måle den meotiske spindel og observere forsinkende / spredte kromosomer. Samtidig takket være udviklingen af ​​antistoffer somGenkendes specifikke restmodifikationer, blev acetyleringsniveauet af H4K16 udført på samme prøve. Denne fremgangsmåde tjente det dobbelte formål at reducere mængden af ​​oocytter, der var nødvendige for analysen og korrelere H4-acetylering med spindelens morfologi.

Kvantificeringen af ​​kovalente protein modifikationer kan udføres af Western blot. Denne teknik kræver imidlertid en større prøvestørrelse og bevarer ikke prøvenes integritet til morfologiske undersøgelser. Den tredobbelte fluorescerende farvning tilgang kan anvendes til andre histon modifikationer og potentielt til ethvert protein, der kan genkendes af forskellige sekundære antistoffer 8 ; Den eneste begrænsende faktor er tilgængeligheden af ​​hestspecifikke antistoffer. I denne sammenhæng håber forfatterne, at opmærksomheden på hestemodellen vil øge interessen for undersøgelsen af ​​grundlæggende biologiske mekanismer i denne art, og derfor i udviklingenEnt af dedikerede værktøjer.

Endelig beskrives ekspressionsundersøgelsen af ​​mRNA'er, der koder for histon-deacetylaser (HDAC'er) og acetyltransferaser (HAT'er) udført ved revers transkription og kvantitativ-PCR (q-PCR). Q-PCR er en bredt spredt teknik; Dog er dets anvendelse til hesteocytter ikke diffus. Det er vigtigt at specificere, at analysen af ​​det totale transkriptionsmængde på grund af den generelle afstødning af transkriptionsaktivitet under oocytmodning 29 kun kan afsløre mRNA-stabilitet eller nedbrydning i denne baggrund 30 , 31 . Forskelle i den relative ekspression af transkripter mellem in vitro og in vivo modning observeredes ikke. Disse resultater tyder på, at oversættelses- og posttranslationelle bestemmelser kan blive påvirket af IVM, idet man påpeger behovet for udvikling af andre eksperimentelle tilgange, der har til formål at undersøge translational og poSt-translational mekanismer på single-celle niveau.

Samlet set beskriver den foreliggende undersøgelse en eksperimentel tilgang til morfologisk og biokemisk karakterisering af hesteocyter. Denne fremgangsmåde kan anvendes på oocytter af andre arter, der på samme måde påvirkes af en lav udvindingsrate, herunder mennesker eller truede arter. Disse undersøgelser vil udvide vores viden om pattedyrs reproduktiv biologi og vil bidrage til vores forståelse af infertilitet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Forfatterne vil gerne takke Fabrice Vincent for supporten med laser scanning confocal microscopy (LSCM) , og Philippe Barrière og Thierry Blard for at udføre daglig ultralyd ovariescanning og hCG-injektion. Dette arbejde blev delvist støttet af "Regione Sardegna og Regione Lombardia" -projektet "Ex Ovo Omnia" (tilskud nr. 26096200 til AML); "L'Oreal Italia per le Donne e la Scienza 2012" fællesskab (kontrakt 2012 til FF), FP7-PEOPLE-2011- CIG, forskningsforvaltningsorganet (REA) "Pro-Ovum" (tilskud nr. 303640 til VL); Og af Postdoktorskolen for Landbrug og Veterinærmedicin, medfinansieret af Den Europæiske Socialfond, Sektorielt Operationelt Program for Menneskelige Ressourceudvikling 2007-2013 (Kontrakt nr. POSDRU / 89 / 1.5 / S / 62371 til IM). In vivo- oocytopsamlingen blev finansieret af Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Analyse af kromosomsegregation, histonacetylering og spindelmorfologi i hesteococytter
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter