Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair

Summary

Here, we present a protocol to visualize blood vessel formation in vivo and in real-time in 3D scaffolds by multiphoton microscopy. Angiogenesis in genetically modified scaffolds was studied in a murine calvarial critical bone defect model. More new blood vessels were detected in the treatment group than in controls.

Abstract

The reconstruction of critically sized bone defects remains a serious clinical problem because of poor angiogenesis within tissue-engineered scaffolds during repair, which gives rise to a lack of sufficient blood supply and causes necrosis of the new tissues. Rapid vascularization is a vital prerequisite for new tissue survival and integration with existing host tissue. The de novo generation of vasculature in scaffolds is one of the most important steps in making bone regeneration more efficient, allowing repairing tissue to grow into a scaffold. To tackle this problem, the genetic modification of a biomaterial scaffold is used to accelerate angiogenesis and osteogenesis. However, visualizing and tracking in vivo blood vessel formation in real-time and in three-dimensional (3D) scaffolds or new bone tissue is still an obstacle for bone tissue engineering. Multiphoton microscopy (MPM) is a novel bio-imaging modality that can acquire volumetric data from biological structures in a high-resolution and minimally-invasive manner. The objective of this study was to visualize angiogenesis with multiphoton microscopy in vivo in a genetically modified 3D-PLGA/nHAp scaffold for calvarial critical bone defect repair. PLGA/nHAp scaffolds were functionalized for the sustained delivery of a growth factor pdgf-b gene carrying lentiviral vectors (LV-pdgfb) in order to facilitate angiogenesis and to enhance bone regeneration. In a scaffold-implanted calvarial critical bone defect mouse model, the blood vessel areas (BVAs) in PHp scaffolds were significantly higher than in PH scaffolds. Additionally, the expression of pdgf-b and angiogenesis-related genes, vWF and VEGFR2, increased correspondingly. MicroCT analysis indicated that the new bone formation in the PHp group dramatically improved compared to the other groups. To our knowledge, this is the first time multiphoton microscopy was used in bone tissue-engineering to investigate angiogenesis in a 3D bio-degradable scaffold in vivo and in real-time.

Introduction

Bone is a highly vascularized tissue that continues to remodel during the lifetime of an individual¹. The rapid and effective bone regeneration of large bone defects resulting from trauma, nonunion, tumor resections, or craniofacial malformations is a complex physiological process. Traditional therapeutic approaches used for bone defect repair include autograft and allograft implantation, but their use involves several problems and limitations, such as limited availability, significant donor site morbidity, a high risk of infection, and host immune rejection^2,3. However, artificial bone grafts offer an efficient alternative to alleviate these limitations. They can be made from biodegradable materials, are easy to be fabricate with a suitable pore size, and can be genetically modified^4,5.

Currently, various tissue engineering scaffolds have been employed in the development of tissue-engineered bone^6,7. To induce bone repair and regeneration more effectively, engineered biomaterials combined with growth factors have emerged and achieved good results^8,9. Unfortunately, the short half-life, easy-to-lose activity, and supraphysiological dosage of growth factors for therapeutic efficacy limit their clinical application¹⁰. To overcome these problems, the delivery of growth factor genes instead of growth factors has been demonstrated as an effective approach to sustain bioactivity for the treatment of osseous defects and diseases^11,12. Viral vectors are promising delivery tools for tissue regeneration due to their high expressing efficiency¹³.

Among growth factors, platelet-derived growth factor (PDGF-BB) was selected in this study because it is not only a mitogen and chemoattractant for mesenchymal and osteogenic cells, but also a stimulant for angiogenesis^14,15. Previous preclinical and clinical studies showed that PDGF-BB could safely and effectively promote bone repair in periodontal osseous defects^16,17. Recent studies revealed that PDGF-BB stimulates angiogenesis by motivating endothelial cell migration and proliferation in vivo^18,19. Furthermore, PDGF-BB can also render mesenchymal stem cells (MSCs) capable of differentiating into endothelial cells²⁰, and this further highlights the potential role of MSCs in neovascularization. Therefore, inducing the de novo formation of vasculature in scaffolds with PDGF-BB is an important step for the repair of tissue grown into scaffolds in bone tissue engineering.

Bone defect healing is a dynamic tissue morphogenetic process that requires coordinated osteogenesis and angiogenesis at the repairing positions²¹. Neoangiogenesis into implanted tissue-engineered scaffolds is an essential pre-requisite for supplying cells with nutrients and oxygen for growth and survival and for removing metabolic waste. Commonly used imaging methods, including X-ray micro-computed tomography (microCT), magnetic resonance imaging (MRI), scanning electron microscopy (SEM), optical coherence tomography (OCT), and confocal laser scanning microscopy, are applied instead of histological examination to obtain angiogenesis information^22,23. However, these methods face various obstacles in visualizing and measuring neovasculature in 3D scaffolds in bone tissue engineering. Multiphoton microscopy (MPM) is a comparatively novel bio-imaging technique that has the distinct advantage of simultaneously visualizing cells, extracellular matrix, and surrounding vascular networks in vivo. It possesses an inherent three-dimensional imaging capability for deep tissue penetration and causes low photodamage. Hence, in the last decade, MPM has gained much attention in biomedical studies²⁴, including in neuroscience, immunology, and stem cell dynamics. However, it is barely used in orthopedic research.

Protocol

The animal care was in compliance with the Guide for the Care and Use of Laboratory Animals of Guangdong Province. All procedures were performed under the supervision and approval of the Ethics Committee for Animal Research, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences.

1. Lentiviral (LV) Production

1. Clone the pdgf-b cDNA into a lentiviral expression vector (pLenti6/5-eGFP or LV-eGFP) at a custom multiple-cloning site downstream of the cytomegalovirus promoter using Spe I and Sal I restriction sites to construct the pLenti6/5-PDGFB-eGFP plasmid (LV-pdgfb)²⁵.
2. Produce lentiviral particles (LV-pdgfb) from HEK-293FT cells by co-transfecting with virus packaging plasmids (pLP1, pLP2, and pVSV-G) using the standard calcium phosphate method with chloroquine (final concentration: 25 µM)²⁵.
3. After 48 h of transfection, harvest and filter 500 mL of virus-containing supernatant with a filter (0.45 µm). Subsequently, concentrate the viral particles by ultracentrifugation at 89,000 x g for 2 h. Resuspend in 200 µL of phosphate-buffered saline (PBS), aliquot, and store at -80 °C.
4. To determine the titer of lentivirus, incubate HEK293T cells with serially diluted lentiviral solution for 24 h and calculate the lentiviral titer, as previously described²⁵.

2. Fabrication of 3D-printed PLGA/nHAp Scaffolds and LV Immobilization

1. Dissolve 20 g of PLGA (Poly D,L-lactide-co-glycolide) material in 20 mL of 1,4-dioxane to form a homogeneous solution. Add 2 g of nanosized HAp (nano-hydroxyapatide) powder (nHAp) to the solution; the PLGA: nHAp ratio should be 10:1 (w/w).
2. Stir the mixed solution vigorously (stirring speed: 1,500 rpm) at room temperature for 16 h using a magnetic stirrer to form a uniform paste. Fabricate it into porous PLGA/nHAp scaffolds using a 3D low-temperature printer with a computerized nozzle that deposits the paste layer-by-layer, bottom to top, according to a predesigned model²⁶; the pore sizes of the scaffolds range from 200 to 400 µm.
3. Vacuum freeze-dry the scaffolds for 48 h to remove solvent as completely as possible. Soak the scaffolds in 75% ethanol solution for 1 h for sterilization and lyophilize to get neutral, aseptic scaffolds.
   NOTE: The major parameters for vacuum freeze-drying include the condensation temperature (°C) and vacuum degree (Pa). Under a vacuum degree of 45 Pa, the PLGA/nHAp scaffolds were vacuum freeze-dried at -78 °C for 48 h to thoroughly remove the solvent.
4. Add 10 µL of LV particles (4.5 x 10⁵) to each PLGA/nHAp scaffold (4 mm x 4 mm x 2 mm) and incubate the scaffolds for 2 h at 37 °C in a humidified incubator to allow adsorption.
5. After immobilization, rinse the scaffolds twice with PBS to remove unbound LV particles. Snap-freeze the LV particle-coated scaffolds in liquid nitrogen, lyophilize again, and store at -80 °C for future use.

3. In Vitro Kinetics of LV Particle Release from Scaffolds and LV Transduction Activity Assay

1. Incubate 3D scaffolds (4 mm x 4 mm x 2 mm) carrying LV-green fluorescent protein (LV-eGFP, 4.5 x 10⁵ LV particles) in 1 mL of complete DMEM in 2.0 mL cryogenic vials at 37 °C with shaking for 5 days.
2. Take a 1 mL sample every 12 h from 12 h to 120 h post-incubation and replace the medium. At each time point, add 1 mL of fresh medium instead of 1 mL of incubation medium.
3. Use the collected media to transduce HEK293T cells by co-incubating for 48 h. Measure the number of bioactive LV particles by determining the number of GFP-positive HEK293T cells by flow cytometry²⁷.
   1. Before transducing the HEK293T cells, remove the culture medium and rinse the HEK293T cells twice with PBS. Add the collected media containing lentivirus released from the scaffolds to the well (1 mL/well) and culture with the HEK293T cells for 48 h at 37 °C in a humidified incubator.

4. In Vitro Assessment of Bone Marrow-derived MSC (BMSC) Migration

1. Before the migration assay, prepare BMSCs expressing tomato fluorescent protein (BMSCs-T) and PDGF-BB protein (BMSCs-P)²⁸.
2. Perform the BMSC migration assay with a Boyden chamber using a 24-well plate and polycarbonate filters with a pore size of 8 µm.
   1. Place 0.5 mL of BMSCs (5 x 10⁴) transfected with LV expressing tomato fluorescent protein (BMSCs-T) in the upper chambers. Place 0.5 mL of BMSCs (2 x 10⁵) transfected with LV expressing PDGF-BB protein (BMSCs-P) in the lower chambers.
3. Include six groups in this experiment and add 500 µL to the lower compartment of each well.
   A. Blank control, serum-free medium only
   B. FBS control, medium supplemented with 10% FBS
   C. PDGF-BB control, 4 ng/mL PDGF-BB in serum-free medium
   D. PDGF-BB seize group, PDGF-BB (4 ng/mL) and anti-PDGF-BB (4 ng/mL) polyclonal antibody in serum-free medium
   E. BMSC group, 2 x 10⁵ BMSCs in serum-free medium
   F. BMSCs-P group, 2 x 10⁵ BMSCs-P in serum free medium.
4. Incubate for 48 h at 5% CO₂ and 37 °C in a humidified incubator. Afterwards, remove the migrated cells on the lower chamber side and collect them for quantification of the number of BMSCs-T by flow cytometry.
   1. Remove migrated cells on the lower chamber side using a cell scraper and resuspend the migrated cells with 2 mL of PBS. Quantify the number of migrated BMSCs-T by flow cytometry²⁹.

5. Establishment of a Murine Calvarial Critical Bone Defect Model and Scaffold Transplantation

NOTE: Male BALB/c mice (7 weeks old) were purchased from Guangdong Medical Laboratory Animal Center (Guangdong, China).

1. Enroll a total of 42 male mice for the calvarial bone defect experiment. Randomly divide the mice into three groups, with fourteen in each group that receive the following treatments: Group A, no implants; Group B, PH scaffolds implanted (PLGA/nHAp); and Group C, PHp scaffolds implanted (PLGA/nHAp/LV-pdgfb).
2. Anesthetize the animals with the intraperitoneal administration of sodium pentobarbital (50 mg/kg). Remove fur with depilatory paste and clean the head skin with 75% alcohol solution before making the first incision. Fix the head of each mouse with a stereotactic instrument to keep it still during surgery.
3. Make an initial incision with a scalpel and then enlarge it with scissors to create a 1-cm linear skin incision. Scrape the periosteum from the bone of the cranium to reveal the bone surface of the skull using a sterile cotton swab.
4. Use a trephine burr to create a 4 mm-diameter critical-size defect on the left side of the calvaria³⁰. Transplant the scaffold into the bone defect site.
   NOTE: Critical size defects (CSDs) were originally defined as "the smallest size intraosseous wound in a particular bone and species of animal that will not heal spontaneously during the lifetime of the animal." In this experiment, the 4 mm-diameter defect is a critical size bone defect, according to the previously study^31,32.
5. Use ophthalmic forceps to move the periosteum back gently to cover the surgical site. Suture the incised skin with three stitches per cm.
6. Perform post-operational care. Administer the analgesic buprenorphine (0.1 mg/kg) to relieve pain. Maintain the body temperature with a heating pad until the animal awakens. Subsequently, feed the animals with food and water and record their activity every day until the end of the test. Note: Analgesia can be administered prior to the procedure depending on your local animal care committee guidelines. 

6. In Vivo Imaging of Angiogenesis Within the Bone Defect with MPM

NOTE: FITC-conjugated 250 kD dextran (10 mg/mL) in saline was intravenously injected into mice to obtain high-SNR (signal-to-noise ratio) images of new blood vessels according to a previous study³³.  Please note that this is a survival procedure. 

1. Assemble the multiphoton microscopy (MPM) system for two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG) imaging.
2. Anaesthetize the animals with an intraperitoneal injection of pentobarbital sodium (50 mg/kg) and immobilize the animals on a heating plate to maintain their body temperature at 37 °C throughout the experiments. Use 3.0% isoflurane gas in 100% oxygen to maintain satisfactory anesthesia and analgesia during the imaging process. Intraperitoneally inject saline (200 µL/animal) to prevent dehydration before imaging.
3. Tune the femtosecond Ti-Sapphire laser to 860 nm. Create a 512 x 512 µm sampling area by scanning a pair of galvo mirrors and use NA1.0 water-immersion objective lens to focusthe excitation beam into the sample and to collect the backscattered TPEF/SHG signal.
   NOTE: The imaging was performed on a home-build multiphoton microscopic imaging system (MPM). During imaging, a femtosecond Ti-Sapphire laser was tuned to 860 nm as the optimal excitation wavelength. The laser beam was raster scanned across a sample plane using a pair of galvanometer mirrors. After passing through a dichroic mirror of 685 nm, the beam was focused on the specimen by a 20X NA1.0 objective. The induced TPEF and SHG signals were collected by the same objective. The signals were split from the excitation laser by the dichroic mirror mentioned above and purified by a 680-nm short-pass filter. The TPEF and SHG signals were collected by a fiber bundle and conducted to a spectrograph. The detector on the spectrograph was a linear array of photomultiplier tubes (PMTs). The combination of spectrograph and linear array PMTs offered the capability to record the signal in 16 consecutive spectral bands, from 400 nm to 600 nm, at 12.5-nm intervals. Therefore, the TPEF and SHG signals were detected at the same time and separated in spectral domains. Furthermore, for 3D imaging, an axial motor was used to control the imaging depth. The area of each image was set to 512 x 512 µm, and the depth interval was set to 2 µm (control group, 5 µm). Notably, 5 sites on each defect were imaged to collect statistically significant data, and the selected imaging sites were distributed evenly and randomly along the defect.
4. Scan 5 sites on each defect to collect statistically significant data to measure vessel formation.
   1. Use scanning sites evenly and randomly distributed along the defect. For the control group, have the field of view (FOV) cover both the original bone area and the edge of the defect, but for the PH and PHp groups, have the FOV on the implanted scaffold.
   2. Make a 1-cm linear skin incision using a scalpel and suture the open skin to the fixation to reveal the transplantation site. Use a syringe to place a drop of water between the dipping lens and transplants to form a water glass.
5. Acquire image stacks every 12 s over a 2 h imaging period. Display and analyze volumetric data using a custom MATLAB program and quantify the blood vessel areas with ImageJ software^34,35.

7. Gene Expression Analysis of pdgf-b and Angiogenesis-related Genes by RT-qPCR

NOTE: PCR was performed following the usual steps: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. Post-PCR melting curves confirmed the specificity of single-target amplification, and the fold change of the gene of interest relative to β-actin was determined. The reaction for each sample was tested three times.

1. Harvest implanted scaffolds and tissues from the experimental mice at 2, 4, and 8 weeks post-operation³⁶; control group samples (n = 4), taken at the same time points, should be from adjacent bone tissue.
   NOTE: At each time point (2, 4, and 8 weeks), euthanized the mice with CO₂ inhalation. Dissect the calvaria and, subsequently, remove and harvest the implanted scaffolds from the calvaria.
2. Use a commercial reagent to extract the total RNA from each sample according to the manufacturer's protocol. Use the Reverse Transcription Kit to reverse-transcribe the RNA into cDNA following the manufacturer's protocol.
3. Perform quantitative real-time PCR using the SYBR Green Detection System; the primers are listed in Table 1.

Primer(5'–3')
Gene		Forward		Reverse
pdgfb	CATCCGCTCCTTTGATGATCTT			GTGCTCGGGTCATGTTCAAGT
vWF	CTCTTTGGGGACGACTTCATC			TCCCGAGAATGGAGAAGGAAC
VEGFR2	GAAATGACACTGGAGCCTACA AG			TCCATGCTGGTCACTAACAGAA G
β-actin	GTATCCATGAAATAAGTGGTTAC AGG			GCAGTACATAATTTACACAGAAG CAAT

Table 1: Pimer Sets.

8. MicroCT Analysis of Bone Regeneration

1. Euthanize mice with CO₂ inhalation at 8 weeks post-operation. In a well-ventilated environment, gently place each mouse into a clean mouse cage and pump CO₂ gas into the cage to anaesthetize the mice before the euthanasia.
2. Dissect the skull for microCT imaging of the bone defect region. User the following scanning parameters in the experiments: 9 µm resolution, Al 0.5 mm filter, 50 kV voltage, and 142 µA current.
3. Reconstruct all imaging data using commercial software provided by the company. Calibrate the scans using the calibration function of a CTAn software.
   NOTE: Place a Hounsfield unit (HU) under the mice in each scan.

Results

Cylindrical Porous PLGA/nHAp scaffolds 0.6 mm in height and 4 mm in diameter were fabricated with a 3D printer. The morphologies of the scaffolds were analyzed via scanning electron microscopy and microCT. Figure 1A shows the photograph of the implanted scaffold. MicroCT scanning revealed that more than 85% of the pores had sizes ranging from 200 to 400 µm (Figure 1B). SEM imaging demonstrated that the surface of the scaffold had a rough microtopography, ...

Discussion

Bone is a highly vascularized tissue with a unique capacity to continuously heal and remodel throughout the lifetime of an individual¹. The level of vascularization is important for osteogenesis and defect repair. Low vascularization limits the wide clinical application of tissue-engineered bone. Constructing a highly vascularized tissue-engineered bone according to the theory of biomimetics has become a tool for repairing large segment bone defects. Various kinds of scaffolds have been successful...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Poly(D,L-lactide-co-glycolide) (PLGA)	Sigma	P1941	L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles	Sigma	702153	Average diameter < 200 nm
Chloroquine diphosphate salt	Sigma	C6628
FITC-conjugated 250-kD dextran	Sigma	FD250S
1,4-dioxane	lingfeng,Shanghai		0.45 micron
Stericup filters	Merck Millipore Corporation	SLHV033RB
PDGF-BB Cdna	Sino Biological, Inc	MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody	BioVision, Inc	5489-30T
PDGF-BB recombinant protein		4489-50
Calcium-phosphate transfection solution	Promega Corporation	E1200
L-DMEM	Hyclone	SH30021.01
DPBS	Hyclone	SH30028.01
Penicillin-Streptomycin, Liquid	Thermo Fisher Scientific	15140122
FBS	Thermo Fisher Scientific	10099-141
Transwell	Corning	3422
Male BALB/c mice	Guangdong Medical Laboratory Animal Center
sodium pentobarbital	Merck	1063180500
multiphoton microscopy			A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane	Keyuan, Shandong	401750169
TRIzol reagent	Invitrogen	15596018
PrimeScript RT Master Mix (Perfect Real Time)	Takara	RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus)	Takara	RR036B
Hematoxylin and eosin	Beyotime	C0105
Paraffin	Leica	RM2235
Ultracentrifuge OPtima L-100XP	Beckman Coulter	L-100XP
Low-temperature printer	Tsinghua university		A homemade in Tsinghua university
LightCycler 480 instrument	Roche	5815916001
microCT	Bruker	1176
commercial software	Bruker
Buprenorphine