Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Индукция мезенхимных-эпителиальных переходы в клетках саркомы

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Мы представляем здесь способ культивирования клеток для индукции мезенхимальных-эпителиальные переходы (MET) в клетках саркомы на основе комбинированного эктопической экспрессии микроРНК-200 членов семьи и grainyhead-типа 2 (GRHL2). Этот метод подходит для лучшего понимания биологического воздействия фенотипической пластичности на агрессивности рака и лечении.

Abstract

Фенотипическая пластичность относится к явлению, в котором клетка транзиторна получить черты другого рода. Во время прогрессирования рака, фенотипическая пластичность дисков вторжения, распространение и метастазирование. В самом деле, в то время как большинство исследований фенотипической пластичности было в контексте эпителиальных полученных карцином, оказывается, саркомы, которые являются мезенхимальными по происхождению, также демонстрируют фенотипическую пластичность, с подмножеством сарком переживают феномен, который напоминает mesenchymal- эпителиальный переход (МЕТЫ). Здесь, мы разработали способ, включающий семейство микроРНК-200 и grainyhead-типа 2 (GRHL2), чтобы имитировать этот MET-подобный феномен, наблюдаемый в саркому пациента samples.We последовательно выразить GRHL2 и семейство микроРНК-200 клеток с помощью трансдукции и трансфекции, соответственно, , чтобы лучше понять молекулярные основы этих фенотипических переходов в клетках саркомы. Саркома клетки, экспрессирующие MIR-200s и GRHL2 продемонстрировал повышенную эпителиальной characteristИКС в морфологии клеток и изменения эпителиальных и мезенхимальных биомаркеров. Дальнейшие исследования с использованием этих методов могут быть использовано, чтобы лучше понять последствия фенотипических из МЕТ-подобных процессов на клетки саркомы, такие как миграция, инвазия, метастатическая склонность и устойчивость к терапии.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Фенотипическая пластичность относится к обратимому переходу между клеточными фенотипами, и обычно делится на два типа, эпителиально-к-мезенхимальный (ЕМТ) переходы и мезенхимальных-к-эпителиальные переходы (Met). Это фенотипическая пластичность играет важную роль в нормальных процессах многоклеточных организмов, такие как развитие и заживление ран 1; Однако, эти же пути и программа экспрессии генов также могут привести к болезни, такие как фиброз (обзор в 2, 3, 4) и карциноме метастазы (обзор в ссылках 5, 6, 7, 8). Во время метастазирования, например, ЕМТ нарушает полярность клеток, межклеточные взаимодействия, а также способствует инвазии 9, 10. Вместе EMT вкладs в фенотипическое состояние, что способствует распространению раковых клеток. Кроме того, ЕМТ также приводит к целому ряду других фенотипических изменений , которые ведут агрессивный фенотип, в то числе дерегуляции раковых клеток метаболизма 6, развития лекарственной устойчивости 11, 12, увеличенная способностью опухоли инициации 13, 14 и принимающей иммунное уклонение от 15.

Фенотипическая пластичность хорошо изучена в прогрессировании рака; Однако, саркомы также демонстрируют фенотипическую пластичность. Интересно, что кажется, как будто некоторые из тех же водителей фенотипической пластичности в карциномах также способствуют саркомам пластичности и агрессивности. Так , например, циркулирующие опухолевые клетки (CTCs) у пациентов с саркомой , как были показаны , чтобы выразить EpCAM, белок клеточной поверхности , которые , как правило , найденные на эпителиальные клетках 16. Аддиционно, 250 мягких тканей саркома образцы были классифицированы как эпителиальные-типа или мезенхимальные-как на основе экспрессии генов. Пациенты в эпителиального типа биомаркеров подписи имели лучший прогноз , чем у пациентов с мезенхимальной типа биомаркеров подписи 17. Это согласуется со многими карцином, в которых пациенты с более эпителиальных карцином , как имеют лучшие результаты по сравнению с пациентами с более мезенхимальных подобных опухолей 18.

В то время как некоторые саркомы отображения биомаркеров и экспрессии генов пути в соответствии с MET, молекулярные подкрепления этой фенотипической пластичности остаются мало изучены. Изучить механизмы и движущие MET саркомы мы разработали модель MET индукции с использованием двух факторов эпителиальных конкретным, микроРНК (микроРНК) -200 семьи и grainyhead типа 2 (GRHL2). В MIR-200s представляют собой семейство небольших некодирующих РНК, которые регулируют экспрессию генов путем связывания с 3'-UTRs в MESSENгер РНК и предотвращения перевода в белок. МикроРНК-200 семейство состоит из двух подгрупп - один, содержащий MIR-141 и MIR-200a, а другой в том числе MIR-200b, MIR-200c, и MIR-429. Члены семейства микроРНК-200 обогащены эпителиальных тканей, а потеря MIR-200s связан с метастазами в карцином 19. Семейство микроРНК-200 также подавляется в сарком мягких тканей по сравнению с нормальной тканью 20. Подобно MIR-200s, GRHL2 является ключевым регулятором , который имеет важное значение для развития эпителиальных 21. Фактор транскрипции GRHL2 действует в двух способах активируют эпителиальные гены, такие как E-кадгерин: 1) В эпителиальных клетках, GRHL2 непосредственно репрессирует главный регулятор ЕМТА, ZEB1 22; и 2) GRHL2 непосредственно активирует транскрипцию генов эпителиальных 23. Наши предыдущие исследования показали, что комбинированное выражение MIR-200s и GRHL2 в клетках саркомыиндуцирует МЕТ-подобный фенотип 24. Здесь мы представляем подробный протокол для создания модели ин витро MET индукции в клетках саркомы с помощью эктопической экспрессии микроРНК-200s и GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Приготовление реагентов

  1. Подготовка DMEM для культивирования клеток путем добавления 50 мл фетальной бычьей сыворотки (FBS) и 5 ​​мл пенициллина-стрептомицина (5000 ед / мл) до 500 мл DMEM. Эта среда может храниться при температуре 4 ° С в течение до шести месяцев.
  2. Ресуспендируют лиофилизированные праймеры в нуклеазах без воды до конечной концентрации 10 мкМ. Хранить ресуспендировали праймеры при -20 ° С.
  3. Подготовьте радиоиммунопреципитации анализа (Ripa) буфера (150 мМ NaCl, 0,5% дезоксихолат натри, 0,1% SDS, 50 мМ Трис, рН 8,0). Дополнение с ингибитором протеаз перед использованием и сохранить буфер на льду при использовании. Хранить при 4 ° С.
  4. Подготовьте 10 мг / мл полибрена (полибрен) в воде и шприцевой фильтр для стерилизации с использованием полиэфирсульфона фильтр 0,45 мкм. Решение может храниться при температуре 4 ° С в течение шести месяцев.
  5. Подготовьте 1 мг / мл рабочего раствора нитро-синего тетразолия хлорида путем растворения 10 мг в 10 мл PBS. Хранить при 4 ° С.

2. Lentiviral трансдукция GRHL2

1 день

  1. Пластина 3 х 10 5 HEK293T клеток на лунку 6-луночного планшета в 2 мл DMEM , дополненной. Количественно клетки с использованием автоматического счетчика клеток. Клетки должны быть в пределах 40 - 60% сплошности , после культивирования в течение ночи при 37 ° С с 5% CO 2.

День 2

  1. Развести 2 мкг пустого вектора (PCMV-UBC-EGFP) или 2 мкг PCMV-GRHL2-UBC-EGFP 24, 25 в 200 мкл сыворотки среды наряду с 1,8 мкг pΔ8.9 и 0,2 мкг PCMV-VSV -G хелперы плазмид. В отдельную пробирку, разбавляют 4 мкл липидной основе трансфекции реагента в 200 мкл сыворотки среды на трансфекцию (8 мкл в 400 мкл для двух образцов). Добавьте 200 мкл смеси реагентов трансфекции для каждой плазмиды раствора и инкубируют в течение 20 мин при комнатной температуре.
  2. Во время Инкубаторыции, мыть HEK293T клетки путем удаления среды с помощью вакуумной аспирации и промывки клеток с 1 мл PBS. Заменить PBS с 800 мкл не содержащей сыворотки среде. Через 20 мин добавл ют 200 мкл реагента для трансфекции: плазмидной смесь со стадии 2.2 по каплям в каждую лунку и инкубируют клетки в течение 2 ч при 37 ° С в 5% CO 2.
  3. Осторожно снимите трансфекции среды с помощью вакуумной аспирации и заменить 2 мл DMEM, дополненные. Вернуть клетки в инкубатор для ночной культуры.
    Примечание: HEK293T клетка свободно присоединенная. Замена СМИ должна выполняться с осторожностью, чтобы ограничить удаление клеток из нижней части блюда или колбы.

День 3

  1. Обновить носитель на трансфицированных клетках HEK293T и пластины 3 × 10 5 RD клеток на лунку 6-луночного планшета в 2 мл DMEM , дополненной. Культуры клеток в течение ночи. RD клетки представляют собой коммерчески доступная человеческая линию клеток рабдомиосаркомы.

День 4

  • Собрать вирусный носитель из HEK293T клеток. Пипетировать носитель DMEM из HEK293T клеток и места в новые 15 мл конических. Тщательно заменить новое DMEM СМИ и место HEK293T клеток обратно в инкубаторе на следующий день.
  • Добавьте 2 мкл 10 мг / мл полибрена на мл вирусных сред на две новые 50 мл конические пробирки (по одному на пустой вектор трансфекции, а другой для трансфекции GRHL2). Шприц фильтр вирусного носителя путем удаления плунжера из 3 мл шприца и прикрепить 0,45 мкм фильтра полиэфирсульфона к кончику.
    1. Добавьте вирусные носители, собранные на этапе 2.6 в цилиндр шприца, и погрузить носитель в новые 50 мл конических пробирок, содержащих полибрены. Удалить материал из RD клеток с помощью вакуумной аспирации и добавить отфильтрованный вирусный носитель для RD клеток.
  • День 5

    1. Повторные День 4. HEK293T клетки могут быть отброшены после того, как вирусные средства массовой информации была собрана.

    День 7

    1. Промывочный RD клеток с 1 мл PBS и добавляют 200 мкл 0,05% трипсина на каждую лунку. Инкубирую при 37 ° С в течение 5 мин, добавляют 2 мл дополненных средств массовой информации, и переместить суспензии клеток в новых 15 мл конических. Центрифуга клетки при 250 мкг в течение 5 мин при комнатной температуре и аспирата средств массовой информации. Ресуспендируют в 1 мл DMEM (с добавлением 5% FBS и 1% пенициллина-стрептомицина).
      Примечание: Используя более высокий процент FBS может вызвать засорение в процессе проточной цитометрии
      1. Фильтрующие элементы для проточной цитометрии. С помощью пипетки применять 1 мл суспензии клеток RD через фильтр 30 мкм в проточной цитометрии трубок и трубок место на льду.
      2. Сортировка EGFP + клетки 26 в 1,5 мл микроцентрифужных пробирках , содержащих 0,5 мл среды DMEM с добавлением 10% FBS и 1% пенициллина-стрептомицина и место на льду. Пластина EGFP + клетки сортируются в общей сложности 1 мл дополненной DMEM в одну лунку 12-луночного планшета и место в инкубаторе для культуры.
        ; Примечание: Выход EGFP + клетки из проточной цитометрии после этой трансдукции, как правило, низкие (50000-100000 клеток). Клетки возможно, должны быть культивировали в течение 10 - 14 дней, прежде чем перейти к шагу 3.

    3. Обратный Трансфекция MIR-200s

    1. Готовят 50 мкМ запасов микроРНКа-200 имитаторов с использованием нуклеазы без H 2 O. Аликвотных запасов и хранят при -20 ° C , чтобы избежать повторных циклов замораживания / оттаивания.
    2. Добавьте 3 мкл каждого 50 мкМ микроРНК-200 мимической (MIR-200а, MIR-200b, и MIR-200с) к 300 мкл сыворотки среды или 9 мкл 50 мкМ миРНК отрицательный контроль до 300 мкл сыворотки среды.
    3. Добавить 6 мкл миРНК конкретного реагента для трансфекции до 600 мкл сыворотки среды и разделить 300 мкл этой смеси на две трубки, по одному для каждой из двух смесей MIR из шага 3.2. Смешайте 300 мкл каждой смеси микроРНК со стадии 3.2 со смесью 300 мкл реагента для трансфекции. Инкубируют в течение 20 мин при комнатной Temperature.
    4. В то время инкубации, подготовить клеточную суспензию 600000 клеток EGFP + RD, экспрессирующих EV или GRHL2 созданную в разделе 2 в 2,4 мл (250 клеток / мкл) сыворотки среды на обработку.
    5. В 24-луночный планшет, добавьте 100 мкл на лунку микроРНК-200 или смеси отрицательного контроля смеси со стадии 3.3, в шесть лунок, а затем добавить 400 мкл каждой клеточной суспензии на три лунки каждой смеси микроРНК.
    6. Инкубируйте клетки при 37 ° С в 5% CO 2 в течение ночи и изменить носитель полностью дополнен DMEM на следующий день. Сбор клеток через 2 дня для анализа с использованием соответствующего буфера (см. Ниже) Время покадровой визуализации клеток саркомы RD, проходящих MET доступен в качестве дополнительного материала. Изображение в каждую лунку , каждые 2 ч с целью 10X с использованием автоматизированного формирования изображения живых клеток 27.

    4. экстракции РНК, обратной транскрипции, и КПЦР

    1. Извлечение РНК в соответствии с инструкциями производителя, используя стандартную РНККомплект для слива 24. Извлеченный РНК можно хранить при -80 ° С.
    2. Количественная концентрации РНК. Оттепель и работать с РНК на льду. Для количественной оценки концентрации РНК, измерения УФ-поглощению при 260 нм с помощью планшет-ридер спектрофотометра в соответствии с протоколом производителя. Развести все образцы к самой низкой концентрации с нуклеазы без воды.
    3. Выполнение обратной транскрипции суммарной РНК в комплементарной ДНК (кДНК). Смешайте не менее чем 100 нг тотальной РНК с ПЦР буфера, дНТФ смеси (100 мМ), случайных праймеров гексамере, обратной транскриптазы и нуклеазы без воды в объеме 24 мкл реакционной 20. Запуск циклов RT в соответствии с протоколом изготовления. кДНК можно хранить долгосрочные при -20 ° С.
    4. Развести 20 мкл реакции на 100 мкл с 80 мкл нуклеазы без H 2 O.
    5. Смешайте 5 мкл флуоресценции на основе красителя Интеркалирующий 2x КПЦР мастер смеси, 0,06 мкл каждого 10 мкМ праймера, A2-й мкл разбавленного реакции RT в образце.
    6. Выполнить КПЦР в соответствии с протоколом производителя для флуоресценции на основе мастер-микс.
    7. Количественно относительных количеств мРНК дельта-метода КТ и нормализовать к GAPDH. Участок среднего экспрессии мРНК биологических повторностей ± стандартное отклонение для каждой группы обработки.
      Примечание: Особые меры предосторожности следует соблюдать осторожность при работе с РНК, чтобы избежать контакта с РНКазами, например, с использованием РНКазы свободной пластики и реагентов. Номера одноразовое оборудование должно быть обработано перед использованием, чтобы удалить РНКазы.

    5. иммунофлуоресценции Окрашивание

    1. После этапа 3.6, аспирация средств массовой информации путем вакуумной аспирации из клеток RD в формате 24-луночного.
    2. Закрепить клетки путем добавления 500 мкл 4% параформальдегида (PFA) на лунку и инкубировали в течение 15 мин при комнатной температуре (RT). После фиксации, место клеток в фосфатно-солевом буфере (PBS) и хранят при температуре 4 ° С в течение ночи, если это необходимо.
    3. проницаемымиклетки путем добавления 500 мкл PBS + 0,2% Triton-X100 и инкубировать 30 мин при комнатной температуре. По вакуумной аспирации, удалить пермеабилизации буфер и промыть три раза PBS.
    4. Блок в 500 мкл 5% бычьего сывороточного альбумина (BSA) / PBS и инкубируют клетки в течение 30 мин при комнатной температуре. Клетки можно хранить при температуре 4 ° С в течение ночи, если это необходимо.
    5. Готовят разбавления первичного антитела. Пипетка 200 мкл 5% BSA / PBS в каждую лунку в 15 мл конические (12 лунок = 2,4 мл) и добавляют 1 мкл первичного антитела на мл 5% BSA / PBS, необходимо. Удалить блокирующий буфер с помощью вакуумной аспирации и дозирования 200 мкл разбавленного первичного антитела в каждую лунку.
      1. Инкубируйте клетки в соотношении 1: 1000, разбавленные первичных антител в 5% BSA / PBS в течение 1 ч при комнатной температуре или в течение ночи при 4 ° С. После инкубации, мыть клетки два раза PBS.
    6. Подготовка вторичного разведения антител в том же объеме 5% BSA / PBS, как описано выше. Добавьте далеко красный краситель-конъюгированные вторичные антитела с использованием 1: 2000 разбавление. Кроме того, добавить1 мкг / мл Hoechst красителя к смеси. Удалить PBS и добавьте 200 мкл смеси в каждую лунку.
      1. Инкубирую при комнатной температуре в течение 1 ч в темноте. Промыть 3 раза PBS, оставить клетки в PBS, и защищают клетки от света, используя фольгу. Клетки можно хранить при температуре 4 ° С, если это необходимо.
    7. Клетки изображения на 400X общее увеличение на перевернутой эпифлуоресцентной микроскопа с длиной волны возбуждения 594 - 650 нм.

    6. Вестерн блот

    1. Промыть клетки от 3,6 раза охлажденным льдом PBS. На льду, лизируют клетки с 50 мкл 1x RIPA буфера с добавлением 1x ингибиторов протеаз.
    2. Рок лизаты при 4 ° С в течение 15 мин, собирают лизаты во 1,5 мл пробирки и центрифуге при высокой скорости (20000 Xg) в течение 5 мин, чтобы уточнить образцы. Клеточные лизаты могут быть сохранены в долгосрочной перспективе при -80 ° С в случае необходимости.
    3. Количественно общий белок с использованием анализа Брэдфорда и аликвота равного количества белка в новые 1,5 мл микроцентрифужных пробирок. Бринг образцов в равном объеме с использованием RIPA буфера и 3x Laemmli загрузки буфера с добавлением 2-меркаптоэтанола.
    4. Инкубируйте образцы в 1x Лэммли загрузки образца буфера в течение 5 мин при температуре 95 ° C и запустить SDS-PAGE с использованием 4-12% Трис-глицин гель с при 200 V в течение 45 мин. Количество белка загружены диапазоны в зависимости от клеточной линии. В некоторых случаях, 50-100 мкг общего белка необходимы для обнаружения E-кадгерина в мезенхимальных клеточных линиях.
    5. Перенос белков на нитроцеллюлозную мембрану в течение 2 ч при 50 V в 1x Трис-глицин буфере передачи.
    6. Блок мембраны в течение 1 ч при комнатной температуре или в течение ночи при 4 ° С в блокирующем буфере БСА основе.
    7. Развести первичные антитела 1: 1000 концентрации в 5 мл блокирующего буфера, добавляет разбавление к мембране, и инкубировать с нежной качалкой в ​​течение 1 ч при комнатной температуре или в течение ночи при 4 ° С. Промывочные мембраны 3 раза в PBS с 0,05% Tween-20.
    8. Инкубируйте мембраны в течение 1 ч при комнатной температуре с инфракрасным флуоресцентной связью secondarу антитела 1: 20000 разбавления в блокирующем буфере, как описано выше.
    9. Промыть мембранные два раза в PBS с 0,05% Tween-20, а затем один раз в PBS.
    10. Изображение мембрана с использованием стандартной ИК-обнаружения флуоресценции.

    7. Анализы роста Анкерного-независимой

    Примечание: Для детального мягкого агара протокола анализа, см 28.

    1. Теплый стерильная 2x DMEM, носитель до 42 ° С в ванне с горячей водой. В течение этого времени, тепло предварительно выдерживают в автоклаве 1% агарозы в микроволновой печи в течение 3 мин. Микроволновая печь дополнительно в течение 30 с в то время, по мере необходимости, или до тех пор, пока полностью расплавленным. Перемещение агарозном до С водяной бане при 42 °.
    2. Поместите 50 мл коническую трубку в химическом стакане с 42 ° C водой в стерильных капот и смешать 1% агарозы и 2x DMEM носитель в соотношении 1: 1 соотношение учета по 1,5 мл смеси на лунку в 6-луночный планшет. Всегда готовьте дополнительные DMEM / агарозы, чтобы учесть ошибки пипетирования и избежать пузырей.
    3. Добавить смесь встороны хорошо, что гарантирует отсутствие пузырьков формы и дайте отстояться в течение 30 мин при комнатной температуре.
    4. В то время как нижний слой твердеть, готовит каждую группу RD клеток, трансфецированные на шаге 3 аспирации средства массовой информации и промываниях один раз 1 мл PBS. Аспирируйте PBS и добавляют 0,2 мл 0,05% трипсина и инкубируют при 37 ° С в течение 5 мин.
    5. Нейтрализовать трипсина в 0,8 мл среды и растирают клеток с образованием одной клеточной суспензии. Передача клеточной суспензии в 15 мл коническую трубку.
    6. Граф клеток и рассчитать объем клеточной суспензии, необходимую для 10000 клеток на лунку.
    7. Тепло 0,6% агарозы в микроволновой печи в течение 3 мин, затем 30 секунд в то время, пока полностью не растает. Перемещение агарозном до 42 ° С на водяной бане.
    8. Поместите 50 мл коническую трубку в химическом стакане с 42 ° C воды в стерильной крышкой. Смешайте 0,6% агарозы и разбавленную суспензию клеток в соотношении 1: 1, чтобы подготовить 1,5 мл смеси на лунку в 6-луночный планшет. Всегда готовьте дополнительные суспензии клеток / агарозном перемешайте, чтобы учесть ошибки пипетирования ичтобы избежать пузырей.
      Примечание: Важно, чтобы работать при температуре 42 ° C здесь. Если температура слишком низка смесь затвердевает прежде, чем обшивкой, а температура выше 42 ° C будет влиять на жизнеспособность клеток.
    9. Хорошо перемешать растирание клеток несколько раз и добавьте смесь клеток в лунки, не обеспечивает никакой формы пузыри, и пусть затвердеваем в течение 20 мин при комнатной температуре.
    10. Добавляют 2 мл дополненных СМИ в каждую лунке и перемещать пластины инкубатора.
      1. Изменение средств массовой информации раз в неделю в течение 3-4 недель или до многоклеточные колонии образуют. Будьте осторожны, чтобы не прикасаться агаром при удалении средств массовой информации с помощью вакуумной аспирации. В качестве альтернативы, использовать P1000, чтобы удалить верхний слой жидких сред.
      2. Пятно мягкого агара добавления 200 мкл раствора хлорида в нитро- тетразолии (1 мг / мл в PBS) и инкубируют планшет в течение ночи при 37 ° С. Заменить СМИ на следующий день с PBS для работы с изображениями.
      3. Изображение скважин на 40Х общее увеличение на инвертированный микроскоп.
      4. Провести анализ на ImageJ для зоны колонии и числа. Участок среднего числа колоний биологических повторностей ± стандартное отклонение.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Схема для MET индукции в клетках саркомы

    Общий график для индукции МЕТ-подобных изменений в клетках саркомы показан на рисунке 1. Протокол начинается трансдукции GRHL2 (Фигура 1А), а затем путем трансфекции семейства микроРНК-200 (Фиг.1В). Члены семьи GRHL2 или микроРНК-200 не смогли повлиять на внешний вид РД клеток при экспрессии в одиночку, но эктопическая экспрессия GRHL2 и MIR-200s вместе приводит к эпителиальных как морфологические изменения в клетках RD. Клетки переход от веретенообразной формы к более закругленным внешний вид с увеличением межклеточного контакта (рис 1C).

    Индукция МЕТ-подобных изменений в клетках саркомы

    Морфологические изменения в РД клеток на GRHL2 и микроРНК-200избыточная экспрессия сопровождалось усилением активности эпителиального маркера Е-кадгерина (рис 2A). Добавление MIR-200s повышалась E-кадгерина в одиночку, но в сочетании MIR-200s и GRHL2 избыточная экспрессия синергически усиливается Е-кадгерина выражение (рисунок 2А, а не логарифмическом масштабе). Кроме того, было отмечено увеличение в межклеточных соединений молекул адгезии, эпителиально EpCAM и TJP1, белыми стрелками (также известный как zóna occludens 1, ZO-1) (рис 2В).

    MET индукции уменьшает образование колонии способность клеток саркомы

    Положительная регуляция эпителиальных белков сопровождалось подавлением генов мезенхимальные Zeb1 и Notch1 (рис 3A), которые известны мишени для микроРНК-200. Индукция MET уменьшила рост анкерного-независимый от RD клеток , как измерена по количеству колоний (рис 3B). Это гроWTH ингибирование было вызвано только MIR-200s; а избыточная экспрессия GRHL2 привело к увеличению анкерного независимого роста (рисунок 3). Это согласуется с предыдущими сообщениями , показывающих экспрессию GRHL2 индуцирует рост 22 якорной-независимыми.

    Рисунок 1
    Рисунок 1: График времени MET индукции с GRHL2 сверхэкспрессией и микроРНК-200 Трансфекцией. (А) Временная шкала эктопической экспрессии по-части GRHL2 в клетках - мишенях. (Б) Хронология MET индукции с помощью обратной трансфекции членов семьи микроРНК-200 в клетках - мишенях. (С) GRHL2 и микроРНК-200 сверхэкспрессия привели к изменениям в морфологии клеток - мишеней в соответствии с MET. Шкала бар = 75 мкм Пожалуйста , нажмите здесьдля просмотра увеличенной версии этой фигуры.

    фигура 2
    Рисунок 2: Параллельная избыточная экспрессия GRHL2 и MIR-200s водить к МЕТАМ в клетках - мишенях. (А) Выражение MIR-200s привело к повышенной экспрессии Е-кадгерина , а в сочетании выражение GRHL2 и MIR-200s получают синергический эффект на экспрессию Е-кадгерина как на уровне мРНК (средние значения ± стандартное отклонение) и уровни белка. (В) Комбинированное выражение GRHL2 и MIR-200s привело к увеличению экспрессии EpCAM и TJP1 в межклеточных контактов (стрелки). Шкала бар = 20 мкм. * Указывает на то р <0,05 анализировали с помощью ANOVA с апостериорных correction.This фигура Тьюки была изменена с позиции 24. Copyright © Американское общество микробиологии, молекулярной биологии клетки, объем 36, выпуск 19, 2503-2513, 2016. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    Рисунок 3
    Рисунок 3: Экспрессия MIR-200S Подавляет мезенхимальных маркеров и уменьшает Анкоридж-независимого роста в клетках саркомы. (А) Над - выражение MIR-200s , но не ингибирует экспрессию GRHL2 Zeb1 и Notch1 мРНК (средние значения ± стандартное отклонение). (В) Сверхэкспрессии MIR-200s , но не GRHL2 заторможенных аноикис сопротивления в клетках саркомы. Представитель изображения окрашенных колоний (Шкала бар = 200 мкм) и количественного определения количества колоний (средние значения ± стандартное отклонение) показаны. * Указывает на то р <0,05 анализировали с помощью ANOVA с апостериорных correction.This фигурой Тьюки был изменен из гправочник 24. Copyright © Американское общество микробиологии, молекулярной биологии клетки, объем 36, выпуск 19, 2503-2513, 2016. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    Рисунок 3
    Справочное Видео: RD клетка , экспрессирующая пустой вектор и отрицательный микроРНК управления. Видео были составлены из изображений RD клеток, трансфицированных пустым вектором и отрицательным микроРНК управления приобретенными через каждые два часа с использованием автоматического живых клеток томографа. Пожалуйста , нажмите здесь , чтобы просмотреть это видео. (Щелкните правой кнопкой мыши для загрузки.)

    Рисунок 3 />
    Справочные Видео 2: RD Клетка , экспрессирующая GRHL2-EGFP и отрицательный микроРНК управления. Видео были составлены из изображений RD клетка, трансфицированного GRHL2-EGFP и отрицательного микроРНК управления приобретенных через каждые два часа с использованием автоматических живых клетками томографа. Пожалуйста , нажмите здесь , чтобы просмотреть это видео. (Щелкните правой кнопкой мыши для загрузки.)

    Рисунок 3
    Справочные Видео 3: RD Клетка , экспрессирующая пустой вектор и miR200 микроРНК. Видео были составлены из изображений RD клетка, трансфицированного пустым вектором и miR200 микроРНКа приобретенных через каждые два часа с использованием автоматических живых клетками томографа. Пожалуйста , нажмите здесь , чтобы просмотреть это видео. (Щелкните правой кнопкой мыши для загрузки.)

    нт»ВКИ: Keep-together.within-страница = "1"> Рисунок 3
    Справочные Видео 4: RD Клетка , экспрессирующая GRHL2-EGFP и miR200 микроРНК. Видео были составлены из изображений RD клеток, трансфицированных GRHL2-EGFP и miR200 микроРНК приобрели каждые два часа с использованием автоматического живых клеток томографа. Пожалуйста , нажмите здесь , чтобы просмотреть это видео. (Щелкните правой кнопкой мыши для загрузки.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Саркомы являются редкими, но очень агрессивные раковые мезенхимной линии. Несмотря на их мезенхимальное происхождение, подмножество сарком, как представляется, пройти фенотипический переход к более эпителиальным подобным состояниям. Это МЕТ-подобный переключатель имеет прогностическое значение, так как пациенты с большим количеством эпителиальных опухолей, как менее агрессивны 24. Несмотря на их клиническое значение, есть несколько исследований, касающихся молекулярных механизмы, движущие эти фенотипические переходы в саркомах.

    Для изучения МЕТ-подобных переходов в клетках саркомы, мы разработали MET-индукционную модель путем комбинирования экспрессии эпителиальные факторов GRHL2 и семейства микроРНК-200. Этот метод быстро индуцирует клетку саркомы, чтобы стать более эпителиальным типом, как измерено с помощью изменений в морфологии и экспрессии генов. Используя этот протокол, чтобы вызвать MET в клетках саркомы облегчает изучение влияния этих переходов на фенотипы, которые управляют саркомы агрессии, такойкак миграция, инвазия, распространение и сопротивление смерти и как каждый из этих изменений в биологии может повлиять на наркотики сопротивления.

    В контексте эпителиальных карцином происхождения, экспрессия одного фактора мезенхимального часто бывает достаточно , чтобы вызвать ЕМТ 14. Тем не менее, в этом саркомы полученные модели MET экспрессии двух эпителиальных факторов, GRHL2 и MIR-200s, требуются. Интересно, что MIR-200s в одиночку имел более сильный эффект на большинство биомаркеров MET чем GRHL2, в то время как GRHL2 был способен активировать робастно эпителиальные гены только в присутствии микроРНК-200 на основе репрессии эпителиальных репрессоров генов, таких как ZEB1 24. Вполне возможно , что для некоторых типов клеток мезенхимы эпителиальные гены должны быть как де-репрессирован (например , с помощью микроРНК-200s) и активируется (например , через GRHL2) для привода MET.

    Мы испытали изменения в уровнях экспрессии GRHL2 в разных CELл линии. Чтобы преодолеть это, мы использовали выражение плазмиды GRHL2 , которая также выражает EGFP 25 сортировать по проточной цитометрии EGFP положительных клеток до экспериментов. Важно также, чтобы проверить функциональность MIR-200s и GRHL2 в различных типах клеток. ЕМТ рассматриваются как спектр на основе экспрессии эпителиальных и мезенхимальных-ассоциированные гены, которые могут иметь контекстно-зависимые изменения основаны на клеточной линии, типа рака, лечение и т.д. Таким образом, мы проанализировали пять генов, регулируемых MIR-200 или GRHL2 к учет клеток контекстно-зависимые изменения. Еще один нюанс этого анализа является опора на транзиторной трансфекции MIR-200s для MET индукции. Таким образом, долгосрочные эксперименты могут стать дорогостоящими и сложными, когда несколько повторной трансфекция становится необходимой. Эту проблему можно решить с помощью плазмиды экспрессии микроРНК-200.

    Другие исследования также свидетельствуют о MET в саркомах. Так, например, МЕТ наблюдалась в подгруппе leiomyosarcomas и был связан с лучшей выживаемостью пациентов. Механистически Янг и др. Обнаружено , что в Лейомиосаркоме клеточной линии ингибировании Slug с миРНКом было достаточно , чтобы вызвать МЕТЫ-подобные изменения 29. Кроме того, истощение еще один фактор мезенхимального, улитка, в мезенхимальных стволовых клеток снижает образование саркомы у мышей 30. Таким образом, как видно из литературы, что существует множество путей к МЕТАМ-подобному фенотипу, который может варьироваться в зависимости от типа клеток. Хотя это не единственный способ, чтобы побудить МЕТЫ, мы использовали наш метод, чтобы вызвать MET в двух саркоме подтипов, в том числе рабдомиосаркомы (RD клетка) и остеосарком (14 клетки). В будущем, было бы интересно сравнить эти различные методы в широком диапазоне клеток саркомы. Например, у некоторых подтипы саркомы имеют основные генетические или эпигенетические изменения, которые делают их более или менее восприимчивы к МЕТАМ индукции?

    Определение влияния METна различных биологических выходов в клетках саркомы может обеспечить лучшее понимание того, почему у пациентов с более эпителиальных типа саркомы имеют улучшенный прогноз. Кроме того, понимание влияния лечения на вождение фенотипических переходов между состояниями бы углубить наше понимание биологического и сообщить при ответе на текущие терапии у пациентов с саркомой.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Авторы не имеют ничего раскрывать.

    Acknowledgments

    JAS признает поддержку со стороны Института Дьюка рака, мочеполовой онкологической лаборатории Duke University и Университета Дьюка отдела ортопедии. HL была поддержана Национальным научным фондом (NSF) Центр теоретической биологической физики (НФС PHY-1427654) и NSF DMS-1361411, а также в качестве CPRIT (Профилактика рака и Научно-исследовательский институт Техас) Scholar в Cancer Research штата Техас в университете Райса. KEW была поддержана NIH F32 CA192630 MKJ и HL выгоду от полезных дискуссий с Мэри C Фарак-Carson, JN Onuchic Самир M Ханаш, Кеннет J Пиента и Дональд S Коффи.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Индукция мезенхимных-эпителиальных переходы в клетках саркомы
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter