Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

CAPRRESI: сбор химеры путем вставки плазмиды и рестрикционной ферментации сайта

doi: 10.3791/55526 Published: June 25, 2017

Summary

Здесь мы представляем сбор химеры путем восстановления плазмиды и введения сайта рестрикционного фермента (CAPRRESI), протокола, основанного на введении сайтов рестрикционных ферментов в последовательности последовательностей синонимов и восстановления функциональной плазмиды. Этот протокол является быстрым и недорогим методом слияния белок-кодирующих генов.

Abstract

Здесь мы представляем сбор химеры путем восстановления плазмиды и введения сайта рестрикционного фермента (CAPRRESI). CAPRRESI извлекает выгоду из многих преимуществ исходного метода извлечения плазмиды и вводит переваривание рестрикционного фермента, чтобы облегчить реакции лигирования ДНК (необходимые для сборки химеры). Для этого протокола пользователи клонируют гены дикого типа в одну и ту же плазмиду (pUC18 или pUC19). После выбора силикона областей аминокислотной последовательности, в которых собираются химеры, пользователи получают все последовательности синонимов ДНК, которые их кодируют. Ad hoc Perl-скрипты позволяют пользователям определять все последовательности синонимов ДНК. После этого шага другой скрипт Perl ищет сайты рестрикционных ферментов на всех синонимичных последовательностях ДНК. Это в силиконовом анализе также выполняется с использованием гена устойчивости к ампициллину ( ampR ), обнаруженного на плазмидах pUC18 / 19. Пользователи разрабатывают олигонуклеотиды внутри регионов синонима, чтобы разрушить гены дикого типа и ampR с помощью ПЦР. После obtАфинирующих и очищающих комплементарных фрагментов ДНК, происходит переваривание рестрикционного фермента. Сбор химеры достигается путем лигирования соответствующих комплементарных фрагментов ДНК. Векторы pUC18 / 19 выбраны для CAPRRESI, поскольку они предлагают технические преимущества, такие как малый размер (2686 базовых пар), высокий номер копии, преимущества функции реакции последовательности и коммерческая доступность. Использование рестрикционных ферментов для сборки химеры устраняет необходимость в ДНК-полимеразах, дающих продукты с тупыми концами. CAPRRESI - это быстрый и недорогой метод слияния белок-кодирующих генов.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Сбор химерных генов широко используется в молекулярной биологии для выяснения функции белка и / или для биотехнологических целей. Существуют различные способы слияния генов, такие как перекрытие амплификации ПЦР-продукта 1 , восстановление плазмиды 2 , гомологичная рекомбинация 3 , системы CRISPR-Cas9 4 , сайт-направленная рекомбинация 5 и сборка 6 Гибсона. Каждый из них предлагает различные технические преимущества; Например, гибкость перекрывающегося проектирования ПЦР, выбор конструкций конструкций во время восстановления плазмиды in vivo или высокая эффективность систем CRISPR-Cas9 и Gibson. С другой стороны, некоторые трудности могут возникать при выполнении некоторых из этих методов; Например, первые два подхода основываются на фрагментах ДНК с тупым концом, и лигирование этих типов продуктов может быть технически сложным по сравнению со стандартнымиKy-end лигирование. Рекомбинация на сайте может оставлять следы дополнительных ДНК-последовательностей (шрамов) на оригинале, как в системе CreloxoxP 5 . CRISPR-Cas9 может иногда модифицировать другие области генома в дополнение к целевому сайту 4 .

Здесь мы вводим сбор химеры путем извлечения плазмиды и введения сайта рестрикционного фермента (CAPRRESI), протокола для слияния белок-кодирующих генов, который объединяет способ восстановления плазмиды (PRM) с введением сайтов рестрикционных ферментов на синонимичные последовательности ДНК, повышая эффективность лигирования , Для обеспечения целостности аминокислотных последовательностей сайты рестрикционных ферментов вставляются в синонимичные последовательности ДНК. Среди преимуществ CAPPRESI заключается в том, что он может быть выполнен с использованием обычных лабораторных реагентов / инструментов ( например , ферментов, компетентных клеток, растворов и термоциклеров) и что он может давать быстрые результаты (при использовании соответствующих ферментов). Опираясь на ограничениеСайты ферментов, которые появляются из последовательностей ДНК синонимов, могут ограничить выбор точных точек слияния внутри интересующих белков. В таких случаях гены-мишени следует сливать с использованием перекрывающихся олигонуклеотидов, а сайты рестрикционных ферментов следует вставлять в ген устойчивости вектора.

CAPRRESI состоит из семи простых шагов ( рис. 1 ): 1) выбор вектора клонирования pUC18 или pUC19 6 ; 2) в силиконовом анализе последовательностей дикого типа, подлежащих сплавлению; 3) выбор областей разломов для сборки химеры и разрушения плазмиды; 4) в силиконовой генерации синонимичных последовательностей ДНК, содержащих сайты рестрикционных ферментов; 5) независимое клонирование генов дикого типа в выбранную плазмиду; 6) нарушение плазмиды с помощью ПЦР с последующим расщеплением рестрикционным ферментом; И 7) восстановление плазмиды с использованием лигирования ДНК и бактериальной трансформации. Химерные гены, полученные этой методикой, должны быть проверены wС последовательностью.

Векторы pUC18 / 19 предлагают технические преимущества для клонирования и сборки химеры, такие как малые размеры ( то есть, 2686 пар оснований), высокое количество копий, выгодные функции реакции секвенирования и коммерческая доступность 7 . Здесь хозяин Escherichia coli использовался для сборки и обработки химер, потому что бактериальные культуры дешевы и быстро растут. Учитывая это, потребуется последующее клонирование фрагментов слияния в конечные целевые плазмиды ( например, векторы экспрессии в виде pRK415 у бактерий или pCMV в клетках млекопитающих).

CAPRRESI был протестирован на слияние двух первичных генов сигма-фактора: E. colirpoD и Rhizobium etlisigA . Первичные сигма-факторы являются субъединицами РНК-полимеразы, ответственными за инициирование транскрипции, и они состоят из четырех доменов ( т. Е. Σ1, σ2, σ3 и σ4) 8 . Длина аминокислотной последовательностиЧ белков, кодируемых rpoD и sigA, равны соответственно 613 и 685. RpoD и SigA имеют 48% идентичности (охват 98%). Эти первичные сигма-факторы были разделены на два дополнительных фрагмента между областями σ2 и σ3. В соответствии с этой схемой были собраны два химерных гена: химера 01 (RpoDσ1-σ2 + SigAσ3-σ4) и химера 02 (SigAσ1-σ2 + RpoDσ3-σ4). Продукты слияния ДНК были проверены путем секвенирования.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Протокол CAPRRESI

ПРИМЕЧАНИЕ. На рисунке 1 представлен общий протокол CAPRRESI. Этот метод основан на силиконе и последующей конструкции желаемых химер.

  1. Выбор клонирующей плазмиды, pUC18 или pUC19.
    1. Выберите вектор pUC, который наилучшим образом соответствует техническим требованиям.
      ПРИМЕЧАНИЕ. Оба вектора имеют одинаковую последовательность, за исключением ориентации места множественного клонирования. Это важно для разработки олигонуклеотидов и нарушения плазмиды ПЦР.
  2. В силиконовом анализе генов дикого типа и последовательностей pUC18 / 19.
    1. Получите последовательности ДНК генов дикого типа и сохраните их в файле формата FASTA ( например, genes.fas).
      ПРИМЕЧАНИЕ. Последовательности векторов pUC18 / 19 содержатся в файле pUC.fas ( рисунок 1 , шаг 1).
    2. Определить, какое ограничение enzYmes не разрезают гены дикого типа и последовательности pUC18 / 19, запустив скрипт REsearch.pl. Альтернативно, выполните поиск сайта фермента рестрикции с помощью онлайн-инструмента ( рисунок 1 , шаг 2).
      1. Введите в терминал следующее:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        ПРИМЕЧАНИЕ. Эти команды создадут следующие выходные файлы: genes_lin.fas, genes_re.fas, pUC_lin.fas и pUC_re.fas.
      2. Выберите подходящие рестрикционные ферменты для клонирования генов дикого типа в сайт множественного клонирования выбранного вектора pUC18 / 19 путем сравнения файлов genes_re.fas и pUC.fas. Выберите ориентацию вставки относительно гена устойчивости к ампициллину ( ampR ) вектора pUC18 / 19.
    3. Разработать форвардные и обратные олигонуклеотиды для усиления кодирующей области генов дикого типа (внешние олигонуклеотиды). Включите подходящий сайт фермента рестрикции на каждом 5'-концеОлигонуклеотидов; Это определит ориентацию вставки.
      1. Включите функциональный сайт связывания рибосомы в передних олигонуклеотидах.
      2. Вставьте оба гена дикого типа в одну и ту же ориентацию внутри вектора.
  3. Выбор областей разломов для сборки химеры и разрушения плазмиды.
    1. Получите аминокислотную последовательность дикого типа и генов ampR , запустив скрипт translate.pl ( рисунок 1 , шаг 3).
      1. Введите в терминал следующее:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        ПРИМЕЧАНИЕ. Этот скрипт будет создавать следующие выходные файлы: genes_aa.fas и ampR_aa.fas.
    2. В глобальном масштабе выровнять две аминокислотные последовательности дикого типа с помощью соответствующего программного обеспечения ( например, MUSCLE) 9 .
    3. Выберите желаемые области разломов (3-6 аминокислот) для химеры asseMbly, основанный на выравнивании последовательности. Сохраните их в файл в формате FASTA ( например , regions.fas).
    4. Найдите последовательности ДНК, которые кодируют выделенную аминокислоту, простирающуюся на оба гена дикого типа.
  4. В силиконовой генерации синонимичных последовательностей ДНК, содержащих сайты рестрикционных ферментов.
    1. Получите все последовательности синонимов ДНК, которые кодируют для каждой последовательности аминокислотных последовательностей, выбранных в качестве областей разломов ( фиг. 1 , этап 4); Эти последовательности были сохранены в файле regions.fas.
      1. Введите в терминал следующее:
        Perl synonym.pl regions.fas
        ПРИМЕЧАНИЕ. Этот скрипт будет создавать выходной файл regions_syn.fas.
    2. Найдите сайты рестрикционных ферментов, найденные на последовательностях ДНК синонима.
      1. Введите в терминал следующее: perl REsynonym.pl regions_syn.fas
        ПРИМЕЧАНИЕ. Этот скрипт будет создавать выходной файл regions_syn-re.fas,
    3. Выберите один фермент рестрикции, который разделяют между синонимичными последовательностями обоих генов дикого типа; Этот сайт будет использоваться для сборки химер посредством рестрикционного фермента пищеварения. Убедитесь, что выбранный рестрикционный фермент не режет ни гены дикого типа, ни последовательности векторов pUC18 / 19.
      1. Сравните рестрикционные ферменты, найденные в файлах genes_re.fas, pUC_re.fas и regions_syn-re.fas.
    4. В silico заменить оригиналы для их синонимичных последовательностей ДНК в соответствующих локусах на обоих генах дикого типа. Добавить последовательности синонимов ДНК в файл последовательности wildtype (genes.fas).
    5. Получите аминокислотную последовательность генов, содержащихся в файле genes.fas ( perl translate.pl genes.fas ).
    6. Выровняйте аминокислотные последовательности, переведенные из последовательностей ДНК дикого типа и синонима. Убедитесь, что обе последовательности одинаковы.
    7. Повторите все этапы этого раздела с геном ampR , присутствующим на pUC18 / 19 вектор.
      ПРИМЕЧАНИЕ. Цель состоит в том, чтобы разрушить ген ampR (файл ampR.fas) на две дополнительные части. Рестриктирующий фермент, выбранный для разрушения гена ampR , должен отличаться от того, который используется для сборки химеры.
  5. Независимое клонирование двух генов дикого типа в выбранный вектор pUC18 / 19 (рис. 1, шаг 3).
    1. Очистите выбранную плазмидную ДНК pUC18 / 19 с использованием набора для очистки плазмидной ДНК.
      1. Например, трансформировать DH5α E. coli с плазмидой pUC18 и выращивать трансформанты в течение ночи при 37 ° C на твердом амбициллине LB-0,3 мг / мл (Amp). Выберите колонию трансформанта, инокулируйте новую пластину Amb LB-0,3 мг / мл и вырастите ее в течение ночи при 37 ° C.
      2. Примите участие в предыдущей культуре и вырасти в жидком LB-0,3 мг / мл Amp в течение 6-8 ч при 37 ° C. Экстрагируют плазмидную ДНК с использованием набора.
    2. ПЦР усиливают гены дикого типа из общей геномной ДНК с использованиемRiate внешние олигонуклеотиды. Используйте, если возможно, высококачественную ДНК-полимеразу. Выберите ДНК-полимеразу, которая максимизирует выход. Выполните ПЦР в соответствии с рекомендациями производителя и температурой плавления олигонуклеотидов.
      1. Выполнять циклы ПЦР в зависимости от ДНК-полимеразы, размера ампликона, матрицы и олигонуклеотидов. Например, для амплификации ДНК rpoD , подготовить 50 мкл реакции: 5 мкл 10x буфера, 2 мкл 50 мМ MgSO 4 , 1 мкл 10 мМ смеси dNTP, 2 мкл каждого 10 мкМ олигонуклеотида (таблица 2), 2 Мкл ДНК-матрицы (общая ДНК DH 100), 35,8 мкл ультрачистой воды и 0,2 мкл ДНК-полимеразы высокой точности. Выполнить следующие циклы ПЦР: 1 мин при 94 ° С для начальной денатурации с последующим 30 циклами амплификации (30 с при 94 ° С до денатурации, 30 с при 60 ° С для отжига олигонуклеотидов и 2 мин при 68 ° С расширить).
      2. Растворяют 1,2 гАгарозу в 100 мл дважды дистиллированной воды путем нагревания их в микроволновой печи. Соберите гель-лоток и расчесайте его и поместите в горизонтальный гелевый литейщик. Заполните лоток для геля расплавленным раствором агарозы и дайте ему затвердеть. Удалите гребенку.
      3. Поместите гель в камеру электрофореза. Заполните камеру 1 х буфером Трис-ацетат-ЭДТА. Загрузите 50 мкл продуктов ПЦР в гель-лунки. Электрофорезные образцы ( например , при 110 В в течение 1 часа).
      4. После электрофореза окрашивают гель в 100 мл дважды дистиллированной воды, содержащей 100 мкл раствора этидия бромида 1 мг / мл в течение 10 мин с медленным встряхиванием. Вымойте гель в двойной дистиллированной воде еще на 10 мин при медленном встряхивании; Используйте горизонтальный шейкер.
        Осторожно: бромид этидия является токсичным соединением; Носить защитные перчатки и хлопковое лабораторное покрытие.
      5. Очистите ДНК гена дикого типа из соответствующих полос геля с помощью набора. Визуализируйте полосы, поместив окрашенный гель в УФ-камеру (Рекомендуемая длина волны: 300 нм). Следите за тем, чтобы экспозиция геля была минимальной. Используйте комплект для очистки ДНК и следуйте инструкциям производителя.
        Осторожно: УФ-излучение опасно; Носить защитный экран, очки и хлопковое лабораторное покрытие.
    3. Дайджест очищенных генов дикого типа и плазмидной ДНК pUC18 / 19 с рестрикционными ферментами в соответствии с инструкциями производителя. Если возможно, используйте ферменты быстрого расщепления. Например, переварить 6 мкл ДНК pUC18 (300 нг / мкл) в 10 мкл сверхчистой воды, 2 мкл 10X буфера, 1 мкл рестрикционного фермента Kpn I и 1 мкл рестрикционного фермента Xba I. Оставьте реакцию при 37 ° С в течение 30 мин.
      1. Инактивируйте рестрикционные ферменты в соответствии с рекомендациями производителя. Например, инактивируют реакцию двойного расщепления Kpn I- Xba I при 80 ° C в течение 5 мин.
    4. Смешайте вставку: векторную ДНК с объемной крысойO от 3: 1. Следуйте инструкциям производителя для реакции лигирования. При необходимости используйте быстрые лигирующие ферменты (оставьте реакцию при 25 ° C в течение 10 минут).
      ПРИМЕЧАНИЕ. Как правило, концентрация ДНК после очистки с использованием наборов достаточно хороша для реакций переваривания и лигирования. Например, добавьте 6 мкл ДНК rpoD ( Kpn I- Xba I, 150 нг / мкл), 3 мкл ДНК pUC18 ( Kpn I- Xba I, 150 нг / мкл), 10 мкл 2x-буфера, 1 мкл ультрачистого Воды и 1 мкл ДНК-лигазы T4. Оставьте реакцию лигирования при 25 ° С в течение 10 мин.
    5. Трансформируйте DH5α E. coli с 2-4 мкл реакции лигирования, как описано в дополнительных материалах. Платируйте трансформированные клетки в твердые пластины LB / Amp / X-gal / IPTG. Оставьте планшеты на ночь при 37 ° C.
    6. Выделите колонии трансформанта E. coli белого цвета и нанесите их на новую пластину LB / Amp. Оставьте планшеты на ночь при 37 ° C. </ Li>
    7. Выполните ПЦР колонии, чтобы выбрать кандидатов для последовательности реакции, как описано в дополнительных материалах. Извлеките плазмидную ДНК из кандидатов. Альтернативно, дайджест кандидатной плазмидной ДНК с теми же рестрикционными ферментами, которые используются для клонирования вставок.
    8. Конструкции кандидатов последовательности с поставщиком услуг секвенирования 10 . Соберите последовательность в силиконе, используя ассемблер 11 ДНК ( рисунок 1 , этап 5).
  6. Нарушение плазмиды с помощью ПЦР с последующим расщеплением рестрикционным ферментом.
    1. Дизайн в кремниевых форвардных и обратных олигонуклеотидах в областях разлома для генов дикого типа и ampR , соответственно. Замените в silico фрагмент дикого типа для его соответствующей последовательности синонимов ДНК (полученной на этапе 1.4).
      ПРИМЕЧАНИЕ. Эта последовательность синонимов ДНК содержит сайт рестрикционного фермента. Прямые и обратные олигонуклеотиды перекрываются при tОн рестрикционный сайт фермента. Олигонуклеотиды должны варьироваться от 21-27 нуклеотидов, заканчиваться цитозином или гуанином и содержать сайт рестрикционного фермента. Прямой олигонуклеотид имеет такую ​​же последовательность, что и его область-мишень на матричной ДНК. Обратный олигонуклеотид представляет собой обратную комплементарную последовательность области мишени на матричной ДНК.
    2. Используйте две конструкции гена дикого типа в качестве шаблона ДНК для реакций ПЦР ( например, pUC18 rpoD и pUC18 sigA ). Получите две дополнительные части каждой конструкции (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3 -σ4, pUC18 sigA σ1-σ2 и pUC18 sigA σ3 -σ4) ( рис. 1 , этап 6).
    3. Загрузите образцы ДНК в агарозный гель 1-1,2% [мас. / Об.]. Отделите продукты ПЦР из шаблона ДНК электрофорезом ( например, 110 В в течение 1 часа). Альтернативно, переваривать реакции ПЦР с Dpn I, чтобы разрушить шаблон ДНК.
      ПРИМЕЧАНИЕ: DpnI фермент распознает только метилированные последовательности ДНК (5'-ГАТК-3 ').
      1. Очистите образцы с помощью набора для очистки ДНК. Следуйте рекомендациям производителя.
    4. Двойной переваривать все комплементарные фрагменты ДНК с соответствующими рестрикционными ферментами в соответствии с указаниями производителя. При необходимости используйте рестрикционные ферменты с быстрым перевариванием. Например, дважды перевариваем фрагмент ДНК pUC18rpoDσ1-σ2 с Afl II и Spe I, используя протокол производителя. Оставьте реакцию переваривания при 37 ° C в течение 15 минут.
    5. Инактивируйте рестрикционные ферменты в соответствии с рекомендациями производителя. Например, инактивировать Afl II- Spe I при 80 ° C в течение 20 мин.
  7. Выделение плазмиды с использованием лигирования ДНК и бактериальной трансформации.
    1. Смешайте правильные фрагменты ДНК в объемном соотношении 1: 1 для сборки желаемого химерного гена ( рисунок1, шаг 7).
      ПРИМЕЧАНИЕ. Таким образом, целостность гена ampR восстанавливается, производя функциональный белок.
      1. Например, смешивают 4 мкл ДНК pUC18 rpoD σ1-σ2 (расщепляют с помощью Afl II- Spe I, 150 нг / мкл), 4 мкл ДНК pUC18 sigA σ3 -σ4 ( Afl II- Spe I, 150 нг / мкл), 10 мкл 2x-буфера, 2 мкл сверхчистой воды и 1 мкл ДНК-лигазы Т4; Концентрация ДНК после очистки набора достаточна для пищеварения и последующего лигирования. Оставьте реакцию лигирования при 25 ° С в течение 10 мин.
    2. Трансформируйте DH5α E. coli с 3-5 мкл реакции лигирования сборки химеры (дополнительные материалы). Растите клетки трансформанта в пластинах LB / Amp / X-gal / IPTG в течение ночи при 37 ° C в течение ночи.
    3. Выделите колонии трансформанта E. coli белого цвета и нанесите их на новую пластину LB / Amp. Оставить планшеты в течение ночи при 37° С.
    4. Выполните ПЦР колонии, чтобы выбрать кандидатов для реакции секвенирования, как описано в дополнительных материалах. Визуализировать полосы в агарозном геле 1-1,2% (мас. / Об.) Путем проведения электрофореза (описано на этапе 2.3.2.1).
    5. Выращивайте культуры у позитивных кандидатов. Извлеките из них плазмидную ДНК, используя набор для очистки плазмидной ДНК.

2. Последовательные кандидаты Химерные конструкции

  1. Убедитесь, что качество плазмидной ДНК достаточно хорошо для реакции секвенирования, следуя рекомендациям поставщика услуг последовательности. Извлеките ДНК с помощью наборов для очистки. Например, на интернет-странице поставщика услуг последовательности обратите особое внимание на рекомендуемую концентрацию ДНК для образцов. Получите концентрацию образцов с помощью прибора для количественной оценки ДНК.
  2. Последовательные кандидатные химерные конструкции с поставщиком услуг секвенирования 10 .
  3. Собрать Считывание с использованием в ассемблере 11 силиконовой ДНК.
  4. Выровняйте собранные по сравнению с силиконовыми гибридными последовательностями с помощью инструментов выравнивания последовательностей 9 , 12 . Убедитесь, что химерный ген успешно сплавлен.

3. Подготовка препаратов

ПРИМЕЧАНИЕ. Все шаги, связанные с живыми клетками, должны выполняться в чистом ламинарном вытяжном шкафу с горелкой Бунзена.

  1. Изготовление компетентных клеток DH5α E. coli .
    1. Чтобы продуцировать клетки E. coli -competent, следуйте опубликованным протоколам 13 или см. Дополнительные материалы . Альтернативно, используйте коммерчески доступные компетентные ячейки.
  2. Трансформирование DH5α-компетентных клеток E. coli .
    1. Для химической трансформации культур E. coli следуйте опубликованным протоколамClass = "xref"> 13 или см. Дополнительные материалы . Альтернативно, используйте электропорацию для бактериальной трансформации. Если используются коммерчески доступные компетентные ячейки, следуйте рекомендациям производителя.
  3. Очищающая геномная и плазмидная ДНК от E. coli DH5α.
    1. Выполните экстракцию нуклеиновой кислоты, как указано в дополнительных материалах , с использованием коммерчески доступных наборов или следующих опубликованных протоколов 13 .
  4. Выполните колоние PCR.
    1. Используйте эту методику для идентификации выбранных колоний трансформанта для последующей реакции секвенирования.
      ПРИМЕЧАНИЕ. Этот метод не представляет собой окончательную проверку целостности последовательностей. Подробное описание этого метода доступно в дополнительных материалах .
  5. Подготовка решений.
    1. Видеть
  6. Загрузите скрипты и файлы последовательности, необходимые для протокола CAPRRESI.
    1. Загрузите файлы генных банков, содержащие полную последовательность генома нужного вида, извлеките ДНК-последовательность выбранного гена с помощью браузера генома и сохраните его в формате файла fasta. Загрузите скрипты Perl, необходимые для протокола CAPRRESI. Храните сценарии и файлы последовательности в том же каталоге.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

На рисунке 1 изображен CAPRRESI. Используя этот метод, два химерных гена были собраны путем обмена доменами двух бактериальных первичных сигма-факторов ( то есть E. coli RpoD и R. etli SigA). Последовательности ДНК генов rpoD и sigA были получены с использованием браузера Artemis Genome Browser 14 из файлов генома GenBank NC_000913 и NC_007761 соответственно. Последовательность ДНК вектора pUC18 была получена из нуклеотидной базы данных сервера NCBI. В силиконе анализы сайтов рестрикционных ферментов проводились на последовательностях ДНК, запуская скрипт Perl REsearch.pl (см. Шаг 1.2.2). Эти результаты были использованы для проектирования олигонуклеотидов (этап 1.2.3). Внешние олигонуклеотиды включали сайты распознавания рестрикционных ферментов Xba I и Kpn I для клонирования генов дикого типа в сайт множественного клонирования pUC18. Первой олигонуклеотид также включал рибоНекоторый сайт связывания ( таблица 2 ). Геномную ДНК экстрагировали из клеток DH5 E. coli, выращенных в бульоне LB / Nal (37 ° C, 220-250 об / мин) и R. etli CFN42 клетки, выращенные в бульоне PY / Nal / CaCl 2 (30 ° C, 220-250 об / мин ). Эти образцы использовали в качестве ДНК-шаблонов для амплификации гена дикого типа (этап 1.5.2).

Гены дикого типа амплифицировали с использованием высоконадежной ДНК-полимеразы Taq , которую очищали от агарозных гелей (набор для очистки ДНК), дважды расщепляли рестрикционными ферментами Kpn I- Xba I и клонировали в вектор pUC18. Химически компетентные клетки DH5α E. coli трансформировали 5 мкл реакции лигирования, соответствующей структурам дикого типа pUC18 rpoD и pUC18 sigA (шаг 1.5.5). Трансформантные клетки отбирали на твердых пластинах LB / Amp / X-gal / IPTG, выращенных при 37 ° C. Конструкции Wildtype были проверены секвенсором Sanger10 . Считывание последовательности Sanger проводилось в силиконе, собранном с использованием MIRA 11 (шаг 1.5.8).

Аминокислотные последовательности из генов дикого типа были получены при запуске скрипта translate.pl (шаг 1.3.1). После выравнивания генов дикого типа с Clustal 12 , аминокислотные области TLV и NLR были выбраны на основе гена устойчивости к ампициллину ( ampR ) и первичных сигма-факторов дикого типа соответственно (этап 1.3.3). Эти аминокислотные области использовались для вычисления всех возможных последовательностей синонимов ДНК, которые кодируют их, запустив сценарий synonym.pl (этап 1.4.1). Сценарий REsynonym.pl искал сайты рестрикционных ферментов, найденные на ранее сгенерированных последовательностях синонимов ДНК (шаг 1.1.4). Были выбраны те области синонима, которые ввели наименьшее количество изменений по сравнению с последовательностями дикого типа. Для генов первичного сигма-фактора последовательности дикого типа RpOD (AACTTACGT) и SigA (AACCTTCGC) были заменены на AA CTTAAG G. Последний включал сайт Afl II (полужирный). Для гена ampR последовательность дикого типа ACGCTGGTG обменивалась на ее синоним AC ACTAGT G. Последовательность ДНК синонима, вставленная в ген ampR , содержала сайт Spe I (жирный шрифт). Силиконовую замену дикого типа на соответствующие синонимические последовательности проводили для проверки целостности последовательности и олигонуклеотидной конструкции (шаги 1.2-1.4).

Изменения последовательности синонима были введены ПЦР с использованием соответствующих олигонуклеотидов ( таблица 2 ) и конструкций дикого типа в виде ДНК-шаблонов (шаг 1.5.2). Реакции амплификации продуцировали четыре комплементарные части: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3 -σ4, pUC18 sigA σ1-σ2 и pUC18 sigA σ3 -σ4. Дополнительные частиРубили не только сигма-факторы, но и гены ampR . Дополнительные части очищали с использованием набора для очистки ДНК (шаг 1.6.3).

Эти комплементарные фрагменты ДНК были дважды расщеплены рестрикционными ферментами Afl II и Spe I (этап 1.6.4). Согласно конструкции CAPRRESI фрагменты ДНК pUC18 rpoD σ1-σ2 лигировали с pUC18 sigA σ3 -σ4 для получения химеры 01, а pUC18 sigA σ1-σ2 лигировали с pUC18 rpoD σ3 -σ4 для сборки химеры 02 (шаги 1.7.1-1.7 0,3). Химически компетентные клетки DH5α E. coli трансформировали 5 мкл реакции лигирования pUC18 chim01 и pUC18 chim02 (шаг 1.7.4). Трансформантные клетки отбирали на твердых пластинах LB / Amp / X-gal / IPTG, выращенных при 37 ° C (шаг 1.7.5). Химерные конструкции были проверены секвенированием 10 Sanger (шаг 2). Последовательность Sanger rEads были собраны с использованием MIRA 11 , и его результирующие файлы перечислены в таблице 3 . На рисунке 2 показаны выравнивания (выполняемые с использованием MUSCLE) 9 собранных последовательностей дикого типа и химерных генов в зонах разломов.

Рисунок 1
Рисунок 1: Обзор CAPRRESI. Представления: гены (толстые стрелки), функциональные плазмиды (замкнутые круги) и олигонуклеотиды (тонкие, черные стрелы). Сайты рестрикционных ферментов, вставленные в олигонуклеотиды, появляются в цветах. Сокращения: Wt ( дикий тип ), FWD (прямой олигонуклеотид), REV (обратный олигонуклеотид), ampR (ген устойчивости к ампициллину), RES (сайт рестрикционного фермента), RE (рестрикционный фермент). Нажмите здесь, чтобы посмотреть большую версиюНа этом рисунке.

фигура 2
Рисунок 2: Выравнивание собранных последовательностей дикого типа и химерного гена. Собранные последовательности ДНК были выровнены с использованием MUSCLE 9 . Последовательности были собраны с MIRA 11 . Синонимичные последовательности отображаются черным цветом. Сайт распознавания Afl II подчеркивается. Нуклеотидный код IUPAC: R (A или G) и K (G или T). Конструкции: rpoD (красный), sigA (синий), последовательность химера 01 ( rpoD σ1-σ2-sigA σ3 -σ4) и последовательность химера 02 ( sigA σ1-σ2- rpoD σ3 -σ4). Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Решение Компоненты инструкции
Количество Соединение
Лура-Бертани (LB) бульон 5 г Экстракт дрожжей Растворите все компоненты в воде. Автоклавы. Хранить при комнатной температуре до использования. Для твердого бульона LB добавьте 15 г бактериологического агара в рецепт.
10 г Казеин-пептон
10 г NaCl
До 1 л Двойная дистиллированная вода
Пластины LB / Amp / X-gal / IPTG 100 мл Расплавленный твердый бульон LB Добавьте все компоненты в умеренный бульон LB. Заполните чашки Петри и подождите, пока они не затвердеют. Выполните шаги в чистом ламинарном потолке с горелкой Bunsen.
100 мкл Ампициллин (Amp) [100 мг / мл]
100 мкл X-gal [20 мг / мл]
50 мкл 1 М раствор IPTG
Пептоновый дрожжи (PY) 3 г Экстракт дрожжей Растворите все компоненты в воде. Автоклавы. Хранить при комнатной температуре до использования. Для твердого бульона PY добавьте 15 г бактериологического агара к рецепту. Для культуры R. etli добавьте 700 мкл 1 М раствора CaCl 2 перед использованием.
5 г Казеин-пептон
До 1 л Двойная дистиллированная вода
Пластины PY / CaCl 2 / Nal 100 мл Расплавленный твердый бульон PY Добавьте все компоненты в умеренный бульон PY. Заполните чашки Петри и подождите, пока они не затвердеют. Выполните шаги в чистом ламинарном потолке с горелкой Bunsen.
700 мкл 1 М CaCl 2 раствор
100 мкл Налидиксовой кислоты (Nal) [20 мг / мл]
1 М раствор хлорида кальция (CaCl 2 ) 11,1 г CaCl 2 Растворить CaCl 2 в воде. Автоклавы. Хранить при комнатной температуре.
До 100 мл Двойная дистиллированная вода
Tris-EDTA (TE) 10: 1 pH 8,0 1 мл 1 М Трис-решение Смешайте все компоненты. Автоклавы. Хранить при комнатной температуре.
400 мкл 0,25 М раствор ЭДТА
До 100 мл Двойная дистиллированная вода
TE 50:20 pH 8,0 5 мл 1 М Трис-решение Смешайте все компоненты. Автоклавы. Хранить при комнатной температуре. </ TD>
8 мл 0,25 М раствор ЭДТА
До 100 мл Двойная дистиллированная вода
TE 10: 1 10 мМ раствор NaCl 58,4 мг NaCl Растворить NaCl в TE 10: 1. Автоклавы. Хранить при комнатной температуре.
До 100 мл TE 10: 1 pH 8,0 раствор
Раствор лизиса I 80 мг лизоцим Растворите и смешайте все компоненты в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при комнатной температуре.
2 мл 0,5 М раствор глюкозы
400 мкл 0,5 М раствор ЭДТА
500 мкл 1 М Трис-решение
До 20 мл Стерилизованная двойная дистиллированная вода
Лизис-раствор II 1,2 мл 5 М раствор гидроксида натрия (NaOH) Растворите все компоненты в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при комнатной температуре.
3 мл 10% раствор додецилсульфата натрия (SDS)
До 30 мл Стерилизованная двойная дистиллированная вода
Лизис-раствор III 29,4 г Ацетат калия (CH 3 COOK) Растворите и смешайте все компоненты в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при комнатной температуре.
11,5 мл Абсолютная уксусная кислота (CH 3 COOH)
До 100 мл Стерилизованная двойная дистиллированная вода
1 М раствор хлорида магния (MgCl 2 ) 9,5 г MgCl 2 Растворить MgCl 2 в wАтер. Автоклавы. Хранить при комнатной температуре.
До 100 мл Двойная дистиллированная вода
3 М раствор ацетата натрия (CH 3 COONa) 24,6 г CH 3 COONa Растворить CH 3 COONa в воде. Автоклавы. Хранить при комнатной температуре
До 100 мл Двойная дистиллированная вода
10% раствор SDS 10 г SDS Растворить SDS в воде с помощью магнитной мешалки при низкой скорости. Автоклавы. Хранить при комнатной температуре.
До 100 мл Двойная дистиллированная вода
3 М CH 3 COOK раствор 29,4 г CH 3 COOK Растворить CH 3 COOK в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при комнатной температуре. До 100 мл Стерилизованная двойная дистиллированная вода
Раствор протеиназы K 5 мг Протеиназа K Растворить протеиназу K в растворе TE 50:20. Нагревают при 37 ° С в течение 1 часа. Хранить при температуре -20 ° C.
До 1 мл TE 50:20 pH 8,0 раствор
Решение RNase 10 мг РНКазы Растворить РНКазу в воде. Нагревают при 95 ° С в течение 10 мин. Хранить при температуре -20 ° C.
До 1 мл Стерилизованная сверхчистая вода
1 М изопропил-β-D-тиогалактозид (IPTG) 238,3 мг IPTG Растворить IPTG в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при температуре -20 ° C.
До 1 мл Стерилизованная сверхчистая вода
20 мг X-Gal Растворить X-gal в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при температуре -20 ° C.
До 1 мл Стерилизованная сверхчистая вода
Фенол: хлороформ: изоамиловый спирт 24: 24: 1 24 мл фенол Смешайте все компоненты. Хранить в янтарной бутылке при температуре 4 ºC. ВНИМАНИЕ! Опасный материал. Наденьте защитные очки, перчатки и хлопковое лабораторное платье. Используйте вытяжной колпак. НЕ включайте горелку Бунзена или любой другой источник огня во время работы. Альтернатива: использовать коммерческий раствор фенола: хлороформ: изоамиловый спирт 25: 24: 1
24 мл хлороформ
1 мл Изоамиловый спирт
0,5 М раствор глюкозы 9 г гlucose Растворить глюкозу в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при комнатной температуре.
До 100 мл Стерилизованная сверхчистая вода
0,5 М раствор этилендиаминтетрауксусной кислоты (ЭДТА) с рН 8,0 14,6 г ЭДТА Растворить ЭДТК в воде. Отрегулируйте pH 5 М раствором NaOH. Автоклавы. Хранить при комнатной температуре.
До 100 мл Двойная дистиллированная вода
0,25 М раствор ЭДТА с рН 8,0 7,3 г ЭДТА Растворить ЭДТК в воде. Отрегулируйте pH 5 М раствором NaOH. Автоклавы. Хранить при комнатной температуре.
До 100 мл Двойная дистиллированная вода
1 M Tris pH 8,0 раствор 12,1 г Трис Растворить Трис в воде. Отрегулируйте pHАбсолютная соляная кислота (HCl). Автоклавы. Хранить при комнатной температуре.
До 100 мл Двойная дистиллированная вода
5 М раствор гидроксида натрия (NaOH) 19,9 г NaOH, Растворяют NaOH в воде. Хранить при комнатной температуре. ВНИМАНИЕ! Каустическое соединение.
До 100 мл Стерилизованная двойная дистиллированная вода
0,1 М раствор NaOH 399 мг NaOH, Растворяют NaOH в воде. Хранить при комнатной температуре.
До 100 мл Стерилизованная двойная дистиллированная вода
Раствор налидиксовой кислоты (Nal) 60 мг Налидиксовая кислота Растворить Нал в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при температуре 4 ºC.
До 3 мл 0,1 MNРаствор аOH
Ампициллин (ампер) 300 мг ампициллин Растворите усилитель в воде. Фильтр стерилизуют с использованием фильтра 0,22 мкм. Хранить при температуре 4 ºC.
До 3 мл Стерилизованная двойная дистиллированная вода
10x трис-ацетат-EDTA-буфер 48,4 г Трис Растворите все компоненты в воде. Автоклавы. Хранить при комнатной температуре.
20 мл 0,5 М раствор ЭДТА
11,44 мл Ледяная уксусная кислота
До 1 л Двойная дистиллированная вода

Таблица 1: Подготовка раствора. Инструкции по подготовке раствора.

Нет . Код Последовательность Длина (nt) Особенности
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 Сайт XbaI ; Усиление гена дикого типа и клонирование векторов
2 RoD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 KpnI- сайт; Усиление гена дикого типа и клонирование векторов
3 Сиг-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 Сайт XbaI ; Усиление гена дикого типа и клонирование векторов
4 Сиг-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ TD> 29 KpnI- сайт; Усиление гена дикого типа и клонирование векторов
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 Сайт SpeI вставлен, мутация синонима. Нарушение гена ampR
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 Сайт SpeI вставлен, мутация синонима. Нарушение гена ampR
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 Добавлен сайт AflII , мутация синонима. Строительство chim01-02
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 Добавлен сайт AflII , мутация синонима. Строительство chim01-02
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 Добавлен сайт AflII , мутация синонима. Строительство chim01-02
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 Добавлен сайт AflII , мутация синонима. Строительство chim01-02

Таблица 2: Олигонуклеотидные последовательности. Подчеркиваются сайты ферментов рестрикции. Место связывания рибосомы: жирный.

строительство Файл последовательности Файл качества
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
сига siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

Таблица 3: Файлы последовательности, полученные с помощью ассемблера MIRA и секвенатора ДНК. Последовательности секвенсора Sanger из химерных и диких типов конструкций были собраны с программным обеспечением MIRA 11 с использованием опции сопоставления. Хроматограммы секвенирования химеры отображаются в виде файлов PDF.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI был разработан как альтернатива PRM 2 . Оригинальный PRM - это мощная техника; Он позволяет слияние последовательностей ДНК вдоль любой части выбранных генов. Для PRM ​​гены дикого типа должны быть клонированы в одну и ту же плазмиду. После этого олигонуклеотиды сконструированы внутри генов устойчивости к дикому типу и антибиотикам, обнаруженных на плазмиде. Прерывание плазмиды достигается с помощью ПЦР с использованием ДНК-полимераз с высокой степенью точности и высокой точностью и ранее разработанных олигонуклеотидов. Лигирование комплементарных продуктов ПЦР объединяет химерные гены и восстанавливает кассету резистентности к антибиотикам, что приводит к восстановлению функциональной плазмиды. PRM позволяет создавать библиотеки химерных генов на одном и том же фоне плазмиды. К сожалению, лигирование последовательностей ДНК с тупыми концами может быть технически трудным. Сбор химеры путем перекрывания фрагментов ПЦР 1 также требует, чтобы ДНК-полимеразы получали продукты с тупыми концами иОчистка ДНК для каждой реакции. Химерные гены, собранные этой методикой, представляют собой линейные ДНК-продукты. Клонирование каждой конструкции в целевой вектор может задержать дальнейший анализ.

CAPRRESI извлекает выгоду из многих преимуществ PRM, а также упрощает лигирование комплементарных фрагментов ДНК с использованием сайтов рестрикционных ферментов в областях последовательности синонимов ДНК. По этим причинам CAPRRESI не нуждается в ДНК-полимеразах с тупыми концами. Использование последовательностей синонимов ДНК сдерживает сайты слияния для сборки химеры, но повышает эффективность лигирования. Другая важная модификация, введенная в CAPRRESI, заключается в том, что химеры собираются и обрабатываются в векторах pUC18 / 19. Эти векторы обладают несколькими преимуществами, как указано ранее. Химерную ДНК можно получить путем распространения вектора конструкции в хозяевах E.coli . Последующее клонирование химерных генов в конечную плазмиду ( например , вектор экспрессии) иногдаобязательный.

CAPRRESI также полагается на обработку силиконом ДНК и аминокислотных последовательностей. Ad hoc Perl-скрипты позволяют выбирать подходящие рестрикционные ферменты для клонирования генов дикого типа, вычисления всех последовательностей ДНК синонимов, соответствующих зонам разломов (для сборки химеры), и идентификации рестрикционных ферментов для упрощения восстановления плазмиды. Учитывая эти условия, CAPRRESI является альтернативой слиянию белок-кодирующих генов. Критическими шагами протокола CAPRRESI являются: 1) выбор областей разломов и 2) очистка продуктов ПЦР. Разрушающими областями являются участки, в которых вычисляются последовательности синонима, создавая сайты рестрикционных ферментов, которые не встречаются в последовательностях дикого типа. Использование сайтов рестрикционных ферментов для сборки химеры устраняет необходимость в ДНК-полимеразах, которые дают продукты с тупыми концами и облегчают реакцию лигирования. Не во всех регионах будут использоваться сайты рестрикционных ферментов; Ф.О.По этой причине рекомендуется перемещать области разломов на одну аминокислоту за один раз, пока не будет найдено наилучшее растяжение. Если в конструкции силикона не допускается перемещение областей разломов или растяжек последовательности, не хватает синонимичных последовательностей ДНК с подходящими сайтами рестрикционных ферментов, рекомендуется спланировать гены-мишени с использованием перекрывающихся олигонуклеотидов и ввести синонимичные последовательности ДНК в ген устойчивости к ампициллину (Только на векторе). Таким образом, гены могут быть слиты в любой части, а восстановление плазмиды зависит от лигирования одного уникального сайта (переваренного только одним рестрикционным ферментом). Гибкость CAPPRESI позволяет выполнять ее в сочетании с другими методами.

Очистка продуктов ПЦР выполняется для устранения матричной ДНК, уменьшая вероятность заражения родительской плазмиды после лигирования комплементарных фрагментов ДНК. Выполнение этих двух критических шагов усиливает bac(Количество правильно собранных конструкций), позволяя CAPRRESI выполнять либо химически компетентные (CaCl 2 ), либо электрокомпетентные клетки E. coli . Первый тип компетентных клеток представляет собой самый дешевый источник культур E. coli , используемый для бактериальной трансформации в большинстве лабораторий. Из-за всех функций, показанных ранее, CAPRRESI представляет собой полезный вариант для сборки химер.

Более того, CAPRRESI может работать в комбинации с перекрывающимися фрагментами ПЦР или методами восстановления плазмиды. Например, вместо того, чтобы вставлять две последовательности синонимов на комплементарную часть ДНК, желаемая область разлома (на гены мишени дикого типа) может использовать перекрывающиеся олигонуклеотиды для слияния промежуточных последовательностей. Введение синонимических последовательностей может быть ограничено геном ampR векторов pUC18 / 19, что приводит к использованию только одного рестрикционного фермента для восстановления плазмидыD целостность. Эти будущие применения могли бы усилить CAPRRESI, разрешив слияние любых типов ДНК-последовательностей ( то есть, не только кодирующих белок генов), не ставя под угрозу эффективность лигирования.

Для тестирования CAPRRESI два химерных сигма-фактора были собраны путем обмена областями двух генов первичного сигма-фактора дикого типа: rpoD ( E. coli ) и sigA ( R. etli ). Все известные первичные сигма-факторы содержат четыре домена, от σ1 до σ4 8 . Химера 01 состоит из RpoDσ1-σ2 и SigAσ3-σ4, тогда как химера 02 имеет SigAσ1-σ2 и RpoDσ3-σ4. Целостность химерных конструкций была проверена секвенсированием 10 Sanger ( рисунок 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что у них нет конкурирующих финансовых интересов.

Acknowledgments

Эта работа была поддержана Национальным конгрессом и технологией, КОНАЦИТом, Мексикой (грант № 154833) и Национальной академией штата Мексика. Авторы хотели бы поблагодарить Виктора Гонсалеса, Розу И. Сантамарию, Патрицию Бустос и Соледада Хуареса за их административные и технические консультации.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: сбор химеры путем вставки плазмиды и рестрикционной ферментации сайта
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter