Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

تقنيات للحث وتحديد الخلوي الشيخوخة

doi: 10.3791/55533 Published: May 1, 2017

Summary

الشيخوخة الخلوية، والدولة لا رجعة فيها اعتقال دورة الخلية، يمكن الناجمة عن مختلف الضغوط الخلوية. هنا، نحن تصف بروتوكولات للحث على الشيخوخة وطرق الخلوية لتقييم علامات الشيخوخة.

Abstract

وردا على الإجهاد الخلوي أو ضرر، ويمكن الخلايا المتكاثرة لحث على برنامج معين الذي يبدأ حالة اعتقال دورة الخلية على المدى الطويل، ووصف الشيخوخة الخلوية. تراكم خلايا هرمة يحدث مع الشيخوخة عضوي ومن خلال زراعة المستمرة في المختبر. خلايا هرمة تؤثر العديد من العمليات البيولوجية، بما في ذلك التطور الجنيني، وإصلاح الأنسجة وتجديدها، وقمع الورم، والشيخوخة. وتشمل السمات المميزة للخلايا هرمة، ولكن لا تقتصر على، وزيادة النشاط β غالاكتوزيداز المرتبطة الشيخوخة (SA-β-غال)؛ INK4A P16، البروتين p53، وP21 المستويات؛ مستويات أعلى من الحمض النووي من التلف، بما في ذلك γ-H2AX. تشكيل المرتبطة الشيخوخة-المغاير البؤر (SAHF)؛ والاستحواذ على المصاحب الشيخوخة إفرازية النمط الظاهري (SASP)، وهي ظاهرة تتميز إفراز عدد من السيتوكينات الموالية للالتهابات والجزيئات الإشارة. هنا، نحن تصف بروتوكولات لكلا تنسخي والشيخوخة DNA الأضرار التي يسببها في الخلايا المستزرعة. وبالإضافة إلى ذلك، نسلط الضوء تقنيات لمراقبة النمط الظاهري الشيخوخي باستخدام العديد من علامات الشيخوخة المرتبطة، بما في ذلك SA-β-غال، γ-H2AX وSAHF تلطيخ، ولقياس البروتين ومرنا مستويات المنظمين دورة الخلية والعوامل SASP. ويمكن تطبيق هذه الأساليب لتقييم الشيخوخة في مختلف النماذج والأنسجة.

Introduction

منذ أكثر من نصف قرن، ووصف Hayflick وزملاؤه كيف خلايا تتكاثر هو دون تغيير في الثقافة، ولكن فقط لفترة محدودة من الوقت 1. زراعة على المدى الطويل من الخلايا الليفية الإنسان تسبب الخلايا لوقف الانتشار. ومع ذلك، فإنها كانت نشطة عملية الأيض، وهذا ما يسمى الشيخوخة الخلوية. الشيخوخة يمكن أن تكون مفيدة لتثبيط تكون الأورام، ولكن أيضا يمكن أن يكون ضارا، كما هو يعتقد أن تساهم في فقدان القدرة على التجدد الذي يحدث مع الشيخوخة 2 و 3. وقد تبين أن خلايا هرمة تتراكم في الأنسجة كما البشر سن 4 و قد تورطت في عدد من العمليات البيولوجية، بما في ذلك التطور الجنيني، التئام الجروح، وإصلاح الأنسجة، والمتعلقة بالعمر التهاب 2.

الركض المستمر للخلايا في ثقافة يدفع الشيخوخة تنسخي، والتي تم ربطهالالتيلومير الاستنزاف وعدم الاستقرار الجيني. الضغوط الخلايا المختلفة، بما في ذلك الحمض النووي من التلف والمسرطنة، ويمكن أيضا أن يسبب الشيخوخة 3. الشيخوخة التي تسببها العوامل الأخرى من الاستنزاف التيلومير وغالبا ما تسمى التوتر الناجم عن الشيخوخة المبكرة أو وعموما يعتمد على INK4A P16 / الروبيديوم مسار 5. وعلى الرغم من الانتشار، تظهر خلايا هو دون تغيير عادة المغزل في الشكل، ويمكن تحديد خلايا هرمة وجود بعض الخصائص، بما في ذلك شقة، مورفولوجيا كبير وزيادة النشاط β غالاكتوزيداز المرتبطة الشيخوخة (SA-β-غال) (الشكلان 1 و 2). كما تتراكم خلايا هرمة علامات الحمض النووي من التلف، بما في ذلك γ-H2AX (الشكل 3) وربما، المرتبط الشيخوخة المغاير بؤر (SAHF) (الشكل 4) 7. خلايا هرمة لديهم مستويات أعلى من المنظمين دورة الخلية، بما في ذلك ع 16 (INK4A P16) و / أو P21 والبروتين p53 (الشكل 5) 9. وعلاوة على ذلك، أظهرت بيانات حديثة أن خلايا هرمة يمكن أن يكون لها آثار غير المتمتعة بالحكم الذاتي عن طريق إفراز عدد من السيتوكينات الموالية للالتهابات وكيموكينات يسمى المرتبطة الشيخوخة إفرازية النمط الظاهري (SASP) 10. على الرغم من أن هذه الظاهرة SASP قد تختلف من نوع من الخلايا إلى نوع من الخلايا، بصفة عامة، ويتجلى ذلك من خلال زيادة انترلوكين 6 (IL-6)، IL-8،-محببة بلعم مستعمرة عامل تحفيز (GM-CSF)، النمو- α منظم الجين الورمي (GRO-α)، واللائحة العامة للمنظمة، β، من بين أمور أخرى (الشكل 6). الإجهاد معين أو الضرر الذي يسبب الشيخوخة قد تؤثر أيضا على النمط الظاهري إفرازية 11 و 12 و 13. يمكن الكشف عن SASP عن طريق قياس مستويات البروتينات يفرز باستخدام ELISAs أو صفائف خلوى / البروتينالصورة = "XREF"> 10 و 14. على الرغم من أن آليات ما بعد النسخي يمكن تنظيم مستويات البروتين SASP 11، 15، 16، 17، والتغيرات في مستويات مرنا ويمكن أيضا أن يتم الكشف في كثير من الحالات. هذه التغيرات عادة ما تكون أكثر حساسية وأسهل لتحديد من قياسات مستوى البروتين. ويمكن أيضا أن يتم تقييم علامات هرمة الأخرى، بما فيها بؤر الحمض النووي من التلف المستمر النووي، ودعا شرائح DNA مع بعض التعديلات لونين تعزيز الشيخوخة (DNA-ندوب) 18، والعديد من علامات أخرى 3 و 19 و 20.

هنا، نحن تصف التقنيات الشائعة لإحداث الشيخوخة في الخلايا في الثقافة وأيضا لقياس العديد من علامات الشيخوخة، بما في ذلك SA-β-غال، γ-H2AX، SAHF، والبروتين ومرنا من senesceجزيئات الامتحانات التنافسية الوطنية المصاحب.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. حمل تنسخي الشيخوخة

  1. ذوبان الجليد-مرور منخفض الليفية مضاعفا الإنسان (على سبيل المثال، WI-38 و IMR-90) أو خطوط الخلايا الأخرى.
    ملاحظة: هنا، تم استخدام الخلايا الليفية مضاعفا الإنسان، ولكن هذه البروتوكولات يمكن استخدامها لتقييم الشيخوخة في أنواع الخلايا الأخرى، مثل البطانية، الظهارية، أو الخلايا الجذعية الوسيطة. قد يكون الأمثل ظروف زراعة لأنواع مختلفة من الخلايا المستخدمة نظرا لمعدلات النمو المختلفة أو ظروف النمو.
    ملاحظة: يجب أن تكون الخلايا المتكاثرة ولها مورفولوجيا المغزل (انظر الشكل رقم 1 لالتخطيطي والشكل 2 للحصول على أمثلة). من الناحية المثالية، ينبغي أن يكون للخلايا سكان مضاعفة مستوى (PDL) من <30 في بداية التجارب لتفادي وجود خلايا هرمة تنسخي الممكنة.
    1. حساب PDL من الخلايا باستخدام المعادلة التالية PDL = سجل (N و / N 0) / log2، حيث N و هو عدد الخلايا النهائي و<م> N 0 هو عدد أولي خلايا المصنف 21.
  2. ثقافة WI-38 الخلايا في Dulbecco لتعديل النسر المتوسطة (DMEM) تستكمل مع 10٪ مصل بقري جنيني (FBS)، 1٪ من الأحماض الأمينية غير الأساسية، و 1٪ البنسلين / الستربتومايسين.
  3. تنمو IMR-90 الخلايا في DMEM تستكمل مع 10٪ FBS و 1٪ البنسلين / الستربتومايسين.
  4. تنمو جميع الخلايا عند 37 درجة مئوية و 5٪ CO 2. تنمو باستمرار الخلايا وتقسيم كل 2-4 د عندما تصل الخلايا ~ 70-80٪ التقاء. مراقبة التقاء الخلايا باستخدام المجهر الضوئي. تجنب الخلايا مع أعلى نقطة التقاء، وهذا يمكن أن يؤثر على نمو الخلايا بسبب الاتصال كبت.
  5. مراقبة الخلايا تحت المجهر الضوئي لظهور الصرفي خلايا هرمة (انظر الشكلين 1 و 2) وعندما لا يكون هناك تغيير في PDL من ثقافة فرعية واحدة إلى أخرى.

2. DNA الشيخوخة الناجمة عن الأضرار

    (على سبيل المثال، WI-38، IMR-90، أو نوع من الخلايا آخر) في مناطق ذات كثافة قليلة (أي ~ 300000 خلية / 6 سم طبق) في طبق مناسب لنوع من التحليل (أي طبق 6 سم للبروتين / علامات RNA أو صحن 6 جيدا لتلطيخ SA-β-غال). استخدام الخلايا المبكر مرور التي هي الشباب والمتكاثرة (<30 PDL) ولوحة منها بحيث الخلايا تقريبا 50-60٪ متموجة في اليوم التالي.
  1. إزالة المتوسطة النمو باستخدام ماصة الزجاج متصلة فراغ وغسل الخلايا بإضافة مخزنة الفوسفات 1X المالحة (PBS). كرر هذه الخطوة ما مجموعه اثنين من يغسل. إضافة طبقة رقيقة من PBS (~ 750 ميكرولتر لطبق 6 سم) لكل حالة "وهمية" المعالجة ولإشعاع المؤين (IR) المعالجة.
  2. استخدام irradiator غاما للكشف عن الخلايا إلى جرعة واحدة من 10 غراي (غراي) من الأشعة تحت الحمراء. هذا هو التعرض نموذجية بالنسبة لمعظم خطوط الخلايا. في غطاء محرك السيارة، وإزالة PBS واستبدالها المتوسطة النمو. بدلا من ذلك، وعلاج الخلايا مع بleomycin في 20 ميكروغرام / مل لمدة 2 ساعة.
  3. تغيير المتوسطة على الخلايا كل ساعة 48 -7 2 ​​وتقسيم الخلايا إذا لزم الأمر.
  4. مراقبة الخلايا تحت المجهر الضوئي للتغيرات شكلية (انظر الشكل رقم 1 لالتخطيطي والشكل 2 للصور خلية تمثيلية) وفحص لعلامات هرمة 7-10 د بعد العلاج IR.
    ملاحظة: يصف هذا البروتوكول الشيخوخة الناجمة عن الأشعة تحت الحمراء. ويمكن أيضا أن الشيخوخة الناجمة عن الضغوط الأخرى، بما في ذلك بليوميسين (انظر أعلاه للشروط)، H 2 O 2 22، 23، 24 أدوية العلاج الكيميائي، ودخان السجائر 25، وتحويل عامل النمو (TGF) -β1 26 و 27، وغيرها من الأساليب 21 و 28 و 29.

3. تلطيخ سلليرة سورية للالمرتبطة الشيخوخة-β غالاكتوزيداز

  1. قبل التلوين، فحص الخلايا تحت المجهر الضوئي لرصد التغيرات المورفولوجية.
    وعادة ما يتم توسيع هرمة الخلايا وشقة، على عكس الخلايا المتكاثرة، التي لديها مورفولوجيا المغزل (انظر الشكل رقم 1 لالتخطيطي والشكل 2 لنتائج ممثل): ملاحظة. الخلايا المتكاثرة يمكن استخدامها كعنصر تحكم السلبية، والخلايا تعامل مع الأشعة تحت الحمراء أو وكيل آخر الضارة DNA (انظر القسم 2) ويمكن استخدام الضوابط الإيجابية.
  2. قياس النشاط SA-β-غال باستخدام الكواشف من مجموعة تجارية (انظر الجدول المواد). ذوبان الجليد عن الكواشف وتقديمهم إلى درجة حرارة الغرفة قبل ارتفاع درجات الحرارة بها إلى 37 درجة مئوية.
    1. حساب كمية حل تلطيخ والحل تثبيتي اللازمة.
      ملاحظة: عادة، وحجم 1 مل يكفي لبئر واحدة في لوحة 6 جيدا. الأحجام لوحة مختلفة يمكن استخدامها، ولكن حجم لوحة 6 جيدا هو أهلا وسهلال-مناسبة لإجراء فحص في ثلاث نسخ لكل حالة. عادة ما تقدم هذه الكثافة عدد كاف من الخلايا في الحقل لحساب دون استخدام عدد الزائد من الخلايا.
    2. تمييع الحل 1:10 تلطيخ مع الماء المقطر.
    3. تمييع الحل تثبيتي 01:10 بالماء المقطر.
    4. تشكل حلا 20x وتقييم X-غال (5-برومو-4-كلورو-3-indolyl-β-D-galactopyranoside) في N، N-ثنائي ميثيل الفورماميد (DMF، على سبيل المثال، 20 ملغ من X-غال في 1 مل من DMF). لتعظيم استخدام عدة، وقياس من X-غال لكمية المطلوبة لكل فحص ومن ثم إضافة كمية محسوبة من DMF إلى حل. بدلا من ذلك، تخزين الحل السهم عند -20 درجة مئوية في أنبوب محمية خفيفة لمدة شهر واحد. استخدام الوحيد البولي بروبلين (مبهمة) أنابيب للتمييع وتخزين حلول X-غال.
    5. إعداد بيتا غال تلطيخ الحل: 930 ميكرولتر من محلول تلطيخ 1X 10 ميكرولتر من تلطيخ الملحق A، 10 ميكرولتر من تلطيخ الملحق B، و 50 ميكرولتر من 20 ملغ / مل X-gal في DMF. جعل مزيج الرئيسي اعتمادا على عدد الآبار تحتاج إلى أن تكون ملطخة.
  3. إزالة بعناية متوسطة من الخلايا باستخدام ماصة نقل أو ما يعادلها.
  4. غسل بلطف خلايا مرة واحدة مع درجة حرارة الغرفة 1X PBS.
  5. إضافة 1 مل من 1X تثبيتي حل كل بئر واحتضان لمدة 10-15 دقيقة في RT.
  6. إزالة الحل تثبيتي مع ماصة نقل.
    ملاحظة: الحل تثبيتي (1X) تحتوي على 2٪ الفورمالديهايد و 0.2٪ غلوتارالدهيد، وينبغي التخلص منها باعتبارها نفايات خطرة وفقا لتوصيات مكتب سلامة المختبرات.
  7. يغسل بلطف الخلايا مرتين مع 1X PBS.
  8. إزالة PBS تماما وإضافة 1X β-غال حل تلطيخ إلى الآبار (1 مل / بئر من لوحة 6 جيدا). تغطية لوحة تماما مع رقائق الألومنيوم واحتضان لمدة 24 - 48 ساعة في الحاضنة 37 درجة مئوية (ويفضل في حالة عدم وجود CO وهذا يمكن أن تقلل من درجة الحموضة في المخزن المؤقت وتؤثر على تلطيخ).
    1. تحقق الخلايا في 24 ساعة لتلطيخ، وإذا كان وصمة عار خفيفة جدا، واحتضان لمدة 24 ساعة أخرى.
  9. بعد فترة حضانة، وإزالة الحل β-غال واستبدالها مع 1X PBS.
    ملاحظة: هذه الخطوة يزيل بعض من لون الخلفية عند التصوير، ويمنع أيضا إراقة الخطرة من الحل X-غال.
    ملاحظة: تخلص من الحل β-غال بشكل صحيح، وفقا لتوصيات مكتب سلامة المختبرات.
  10. فحص الخلايا على مجهر الضوء مع كاميرا مثبتة باستخدام الهدف 10X أو أعلى. خلايا SA-بيتا-غال إيجابية ستكون الأزرق. الحصول على العدد المطلوب من الصور للتجربة. إذا عد النسبة المئوية للخلايا SA-β-غال إيجابية، والحصول على العدد المناسب من الصور لتقدير (5>) لكل بئر. تأكد من أن الصور هي غير متداخلة من مختلف المجالات وجهة نظر داخل كل بئر.
  11. حساب عدد الحاملين لSA-β-غال (الأزرق) خلايا مقابل العدد الإجمالي للخلايالحساب النسبة المئوية للخلايا SA-β-غال إيجابية. عد> 100 خلية لكل حالة.
    ملاحظة: يمكن أيضا التمثيلية الصور أن تستخدم لشخصيات. لاحظ أن confluency الخلية أمر بالغ الأهمية إذا خلايا العد، وخلايا كثيرة تجعل من الصعب تمييز كل خلية وعدد قليل جدا قد لا تعطي عدد كاف من الخلايا للالكمي والاحصاءات. صور لشخصيات للنشر هي في أفضل قرار إذا حفظها كملفات TIFF.، على الرغم من ملفات بامتداد .jpeg هي أيضا مناسبة. يجب أن تكون الصور الملونة 300 نقطة في البوصة.

4. خلايا تلطيخ لγ-H2AX

  1. لوحة الخلايا من الأقسام 1 أو 2 على coverslips الزجاج في 24 لوحة جيدا.
  2. في اليوم التالي، وغسل الخلايا مع برنامج تلفزيوني 1X. شطف بعناية، وخلايا هرمة لا تلتزم بشكل جيد لcoverslips ويمكن بسهولة إزالة أثناء يغسل. بدلا من ذلك، مباشرة إصلاح الخلايا دون غسل.
  3. إزالة برنامج تلفزيوني وإصلاح الخلايا مع الطازجة الفورمالديهايد بنسبة 3.7٪ في برنامج تلفزيوني ل10 دقيقة في RT.
  4. إزالة الحل وpermeabilize الخلايا مع 0.2٪ تريتون X-100 في برنامج تلفزيوني لمدة 10 دقيقة.
  5. إزالة الحل وكتلة في 5٪ FBS في برنامج تلفزيوني لمدة 2 ساعة في RT.
  6. احتضان مع مكافحة الفوسفات γ-H2AX (Ser139) وFITC المترافقة في 5٪ FBS / PBS لمدة 2 ساعة عند 37 ° C أو O / N عند 4 درجات مئوية. احم من الضوء.
  7. يغسل 3 - 6X مع PBS عند 37 درجة مئوية لمدة ما مجموعه 30 - 60 دقيقة.
  8. وصمة عار مع دابي (المخفف 1: 15،000 في PBS) لمدة 10 دقيقة في RT.
  9. غسل 3X مع برنامج تلفزيوني.
  10. يغسل بسرعة بالماء لإزالة الأملاح وجبل ساترة على شريحة زجاجية باستخدام 3-5 ميكرولتر من antifade كاشف. بدلا من ذلك، استخدام حل المتصاعدة التي تحتوي دابي.
  11. السماح لها الجافة O / N وتصور الخلايا الملون على المجهر الفلورسنت أو متحد البؤر باستخدام الهدف 63X أو أعلى.
  12. تحديد بؤر γ-H2AX باستخدام أي من طريقتين موضح أدناه. يسجل لأي بروتوكول بالعين باستخدام المجهر الفلورسنت. من الناحية المثالية، لناعصام المجهر متحد البؤر. خذ Z-أقسام وتتكثف في طائرة واحدة من أجل رؤية جميع البؤر كشفها (صور تمثيلية لتلطيخ γ-H2AX في نشر وهرمة الخلايا هو موضح في الشكل 3). عد البؤر بالعين باستخدام برنامج التصوير. بشكل عام، ~ 100-200 نوى كافية لفرز الأصوات.
    1. لتحديد النسبة المئوية للخلايا التي لديها بؤر جاما-H2AX إيجابية، عد كل خلية لديها تركيز واحد على الأقل وضوحا والقسمة على العدد الكلي للنواة ملطخة دابي.
    2. لتحديد عدد من البؤر γ-H2AX، والاعتماد على بؤر γ-H2AX لكل خلية.
      ملاحظة: قد تختلف مستويات γ-H2AX اعتمادا على الضغوطات معين أو الضرر الذي يتسبب الشيخوخة.

5. خلايا تلطيخ لSAHF علامات

ملاحظة: خلايا هرمة الإنسان وغالبا ما يكون المناطق النووية المكثف DNA / لونين. في خلايا هرمة، هذه المناطق كروماتين مغايرويعتقد أن تحول دون التعبير عن الجينات الداعمة للانتشار، مثل أفراد الأسرة E2F. SAHF التي يمكن تصور إعادة تنظيم دابي. من خلال وجود علامات هيستون المرتبطة المغاير، بما في ذلك DI- وثلاثي مثيلة من Lys9 على هيستون H3 (H3K9Me2 وH3K9Me3)؛ والبروتينات إعادة تنظيم الكروماتين، بما في ذلك HP1 البروتين المغاير 1 (HP1)، هيرا (هيستون كاظمة A)، وASF1a (مكافحة إسكات وظيفة-1A) لونين 30. لقد اخترت استخدام نموذج الشيخوخة الناجمة عن الجين الورمي (OIS)، كما SAHF هو أكثر بروزا في نماذج OIS 30. خلايا IDH4 تتكاثر في وجود ديكساميثازون بسبب وجود SV40 كبير T مستضد ولكنها تصبح هرمة بعد زوال ديكساميثازون من متوسط 31. يمكن الكشف عن SAHF التي كتبها دابي تلطيخ وتلطيخ مع الأجسام المضادة ضد علامات محددة المذكورة أعلاه. هنا، نحن تصف دابي وH3K9Me2 تلطيخ لvisualizatأيون من SAHF في الخلايا 28.

  1. زراعة خلايا IDH4 في DMEM تستكمل مع 10٪ FBS، 1٪ البنسلين / الستربتومايسين، و 1 ميكروغرام / مل ديكساميثازون. للحث على الشيخوخة، وإزالة ديكساميثازون وتغيير المتوسطة بحيث يحتوي جردت الفحم FBS. بعد تزايد ل~ 10 يوما في هذه الوسيلة الجديدة، والخلايا IDH4 تصبح هرمة 31.
  2. خلايا IDH4 لوحة أو خلايا من الأقسام 1 أو 2، وصفت أعلاه، على coverslips الزجاج في 24 لوحة جيدا.
  3. في اليوم التالي، وغسل الخلايا مع برنامج تلفزيوني 1X. شطف بعناية، وخلايا هرمة لا تلتزم بشكل جيد لcoverslips ويمكن إزالتها بسهولة أثناء يغسل. بدلا من ذلك، مباشرة إصلاح الخلايا دون غسل.
  4. إزالة برنامج تلفزيوني وإصلاح الخلايا مع الطازجة الفورمالديهايد بنسبة 3.7٪ في برنامج تلفزيوني لمدة 10 دقيقة في RT.
  5. غسل الخلايا 3 مرات مع برنامج تلفزيوني 1X.
  6. إزالة الحل وpermeabilize الخلايا مع 0.2٪ تريتون X-100 في برنامج تلفزيوني لمدة 5 دقائق.
  7. غسل الخلايا مع 1XPBS. إزالة برنامج تلفزيوني ومنع لل coverslips بإضافة عازلة تمنع تحتوي على 3٪ BSA (ث / ت) في برنامج تلفزيوني لمدة 5 دقائق في RT. تصفية دائما الحلول التي تحتوي على قبل BSA لاستخدامها لإزالة الجسيمات.
  8. إزالة عازلة تمنع واحتضان الخلايا مع الأجسام المضادة الأولية ضد علامات SAHF مثل أضداد H3KMe2 (الشكل 4، انظر الجدول المواد للحصول على التفاصيل). تمييع الأجسام المضادة في المخزن الحجب واحتضان لمدة 1-2 ساعة عند RT.
  9. إزالة حل الأجسام المضادة الأولية وغسل لل coverslips 3 مرات مع 1٪ (ت / ت) تريتون X-100 في برنامج تلفزيوني.
  10. تمييع الأجسام المضادة الثانوية في عرقلة العازلة (مواد الجدول)، واحتضان لمدة 1 ساعة على RT. احم من الضوء.
  11. غسل الخلايا مرتين مع 1X PBS. وصمة عار مع دابي (المخفف 1: 15000 في برنامج تلفزيوني، انظر الجدول مواد) لمدة 10 دقيقة في RT.
  12. غسل لل coverslips 3X مع برنامج تلفزيوني 1X.
    1. يغسل بسرعة بالماء لإزالة الأملاح منالثانية تركيب كل ساترة على شريحة زجاجية باستخدام 3-5 ميكرولتر من antifade كاشف. بدلا من ذلك، استخدام حل المتصاعدة التي تحتوي دابي.
    2. دعونا O جاف / N وتصور الخلايا الملون على المجهر الفلورسنت أو متحد البؤر باستخدام الهدف 63X أو أعلى (انظر ممثل النتائج في الشكل 4). قياس SAHF كما هو موضح في القسم 4.
      ملاحظة: الأجسام المضادة الأولية isotype السيطرة أو أي الأجسام المضادة الأولية (أي الثانوية وحدها) وينبغي أن تستخدم كعنصر تحكم السلبية لتلطيخ المناعي.

6. تحليل البروتينات المرتبطة الشيخوخة عن طريق Immunoblotting

ملاحظة: يتميز النمط الظاهري الشيخوخي من upregulation من المنظمين دورة الخلية، بما في ذلك INK4A P16، P21، والبروتين p53. وهذا البروتوكول وصف الكمي لمستويات هذه البروتينات في الخلية لست]. هذه التقنيات يمكن استخدامها لتقييم الشيخوخة الناجمة عن استخدام مجموعة متنوعة منالأساليب 21 و 28 و 29.

  1. حمل الشيخوخة الخلوية كما هو موضح في البندين 1 و 2 أو باستخدام طريقة أخرى 21 و 28 و 29. لتحليل علامات الشيخوخة الخلوية، لوحة الخلايا في 6 سم أطباق وتحليل كل من البروتين والحمض النووي الريبي في وقت واحد (انظر القسم 7 للحصول على تعليمات RNA العزلة).
  2. إزالة مستنبت الخلية. وضع الخلايا على صينية من الجليد.
    1. غسل الخلايا 2 مرات مع برنامج تلفزيوني 1X البارد. إمالة طبق لضمان أن جميع PBS ويستنشق وذلك لتكون دقيقا من حيث الكميات المستخدمة لهذا الإجراء.
    2. بعد الشفط غسل الماضي من برنامج تلفزيوني، إضافة 200 ميكرولتر من البرد برنامج تلفزيوني 1X (لطبق 6 سم) إلى الطبق. تتخلص من الخلايا باستخدام مكشطة الخلية.
    3. ماصة الخلية / PBS الخليط في أنبوب ريبونوكلياز خالية لعزل الحمض النووي الريبي. يستغرق ما يقرب من 150 و# 181؛ L من هذا الخليط وماصة عليه في أنبوب جديد. وسيتم استخدام هذا قسامة لتحليل البروتين، لذا يجب التأكد من ماصة نفس الكمية من كل أنبوب.
  3. ليز الخلايا بإضافة 75-100 ميكرولتر من عينة العازلة 2X Laemmli لتعديل (60 ملي تريس، حمض الهيدروكلوريك درجة الحموضة 6.8، 12.5٪ الجلسرين، 2٪ SDS، 5٪ β-المركابتويثانول (BME)، وبرموفينول الأزرق، ويمكن أن تكون على النحو دفعة كبيرة، aliquoted، وتخزينها في -20 درجة مئوية حتى الاستخدام) أو عينة العازلة ما يعادلها.
    1. بدلا من ذلك، ليز الخلايا في 75-100 ميكرولتر من تحلل العازلة وأجهزة الطرد المركزي في 15000 x ج لمدة 10 دقيقة في 4 درجات مئوية لإزالة الحطام الخلية. إزالة وطاف ماصة في أنبوب نظيفة. بروتين فحص برادفورد أو فحص البروتين يعادل يمكن استخدامها على لست] لضمان تحميل متساو من البروتين.
      لا يمكن إجراء فحوصات على عينات البروتين هي lysed في المخزن عينة: ملاحظة.
    2. أخرج ~ 25 ميكرولتر من المحللة وإضافته إلى 15 ميكرولتر من عينة العازلة 2X. ماصة والقيامسفل في المخزن المؤقت عينة لليز الخلايا.
      ملاحظة: يمكن تعديل وحدات التخزين من تحلل العازلة أو عينة العازلة اعتمادا على التقاء الخلايا. إذا كانت العينة "لزج" بسبب الناشر النووي، إضافة المزيد من عينة العازلة أو برنامج تلفزيوني لتخفيف. ويمكن تخزين العينات في -20 درجة مئوية حتى الاستخدام.
  4. تغلي العينات لمدة 5 دقائق في 95 درجة مئوية في كتلة الحرارة (أو المعدات ما يعادلها) وتحميل ~ 40 ميكرولتر من العينة هي lysed في المخزن العينة على 18٪ هلام تريس، الجلايسين.
    ملاحظة: جل الانحدار (4-15٪) أو 14٪ هلام تريس، جليكاين هي أيضا كافية للكشف عن انخفاض البروتينات الوزن الجزيئي. ويمكن أيضا أنواع مختلفة من المواد الهلامية الأكريلاميد يمكن استخدامها، ولكن تأكد من أن المواد الهلامية ونظام كافية للكشف عن انخفاض البروتينات الوزن الجزيئي.
    1. تشغيل باستخدام 1X عازلة على التوالي في ثابت 100 فولت لمدة 20 دقيقة (من خلال هلام التراص) و~ 60 دقيقة في 180 V. مراقبة هلام حتى الجبهة صبغ يعمل قبالة أو في الجزء السفلي من هلام بحيث انخفاض الجزيئية البروتينات الوزن لا صالامم المتحدة الخروج من هلام.
  5. نقل هلام الأكريلاميد إلى غشاء PVDF (قبل غارقة مع الميثانول بنسبة 100٪ لتنشيط). إذا فعل نقل الرطب، وهناك حاجة فقط 1 ساعة لنقل (مقابل العادي ~ 1.75 ح). ضبط وفقا لنظام النقل المناسب. يمكن استخدام علامات الوزن الجزيئي الملون قبل مساعدة في تقييم كفاءة النقل.
  6. يغسل الغشاء في الماء. استخدام وصمة عار الشقائقية لمراقبة التحميل على قدم المساواة من العينات. غسل الشقائقية قبالة مع الماء.
    1. منع الغشاء في الحليب الجاف 5٪ الخالي من الدسم في TBST (50 ملي تريس، حمض الهيدروكلوريك 7.5 درجة الحموضة، 150 مم كلوريد الصوديوم، و 0.1٪ توين 20) لمدة 1 ساعة عند RT أو O / N عند 4 درجات مئوية مع الإثارة.
  7. غسل وصمة عار مرة واحدة مع TBST واحتضان مع الأجسام المضادة الأولية مخففة في 5٪ الحليب TBST (انظر الجدول مواد التخفيفات والتوصيات الضد) لمدة 1 ساعة عند RT.
  8. إجراء عمليتين يغسل سريعة مع TBST ثم يغسل مرتين على شاكر لمجموعه ~ 30 دقيقة (~ 15 دقيقة كان كلح).
  9. احتضان مع الأجسام المضادة الثانوية لمدة 40 دقيقة في RT. كرر الخطوة 6.10.
  10. احتضان مع تقدم طازجة الركيزة طخة غربية وتطوير الفيلم أو قراءتها على القارئ التوهج.
  11. طخة مناعية التحقيق مع P16 INK4A الأجسام المضادة أولا (الشكل 5). تجريد الغشاء التي يحتضنها لمدة 15 دقيقة مع الماء، لمدة 15 دقيقة مع 0.2 N هيدروكسيد الصوديوم، و 15 دقيقة بالماء. تواصل مع الخطوة 6.9 باستخدام الأجسام المضادة لمكافحة P21.
  12. تجريد الغشاء باستخدام 62.5 ملي تريس، HCL الرقم الهيدروجيني 6.8 و 2٪ SDS مع 300 ميكرولتر من أضاف حديثا BME لكل 50 مل من تجريد الحل.
  13. احتضان عند 50 درجة مئوية لمدة 30 دقيقة ويغسل نطاق واسع مع TBS ثم TBST. التحقيق مع أضداد أكتين أو مكافحة GAPDH لعناصر البروتين التحميل (يبين الشكل 5 نتائج ممثل).
    ويمكن أيضا أن يتم تقييم مستويات البروتين p53 على نفس الأغشية: ملاحظة. ومع ذلك، منذ البروتين p53 هو الوزن الجزيئي العالي، وأفضل حل هو على هلام نسبة أقل (على سبيل المثال،

7. تحليل مستويات مرنا من الشيخوخة علامات

ملاحظة: عندما عزل RNA، تأكد من أن أسطح العمل يتم تنظيف مع حلول إزالة ريبونوكلياز أو ما يعادلها وأن المواد كلها ريبونوكلياز خالية.

  1. باستخدام خلية / PBS خليط من الخطوة 4.2، إضافة 1 مل من الحمض النووي الريبي حل استخراج ودوامة لمدة 30 ثانية (يجب أن يكون هناك كتل مرئية أو الحطام الخلوي).
  2. إضافة 200 ميكرولتر من كلوروفورم ويهز بقوة لمدة 15 ثانية.
  3. أجهزة الطرد المركزي في أقصى سرعة (> 15000 x ج) لمدة 15 دقيقة على 4 درجات مئوية.
  4. إزالة ~ 400 ميكرولتر من الطبقة المائية كبار RNA وماصة عليه في أنبوب microfuge جديدة.
  5. إضافة 400 ميكرولتر من الأيزوبروبانول (1: 1 مع الحجم الكلي للطبقة المائية pipetted في الخطوة السابقة) و 4 ميكرولتر من العلاقات العامةecipitant إلى طبقة RNA.
  6. الطرد المركزي لمدة 15-30 دقيقة في أقصى سرعة (> 15000 x ج) و 4 ° C إلى بيليه RNA.
  7. إزالة طاف وإضافة 1 مل من الايثانول 75٪ الجليد الباردة.
  8. أجهزة الطرد المركزي لمدة 1 دقيقة في أقصى سرعة (> 15000 x ج) و 4 ° C.
  9. إزالة طاف وأجهزة الطرد المركزي لمدة 1 دقيقة على السرعة القصوى (> 15000 x ج) و 4 ° C.
  10. ماصة للخروج الكثير من السوائل وقت ممكن والهواء الجاف لمدة 2 دقيقة.
  11. اعادة تعليق في 10 ميكرولتر من 10X العازلة الدناز، 85 ميكرولتر من H 2 O، و 5 ميكرولتر من الدناز 1.
  12. احتضان عند 37 درجة مئوية لمدة 30 دقيقة.
  13. إضافة 200 ميكرولتر عازلة NT2 (50 ملي تريس، حمض الهيدروكلوريك 7.4 درجة الحموضة، 150 مم كلوريد الصوديوم، 1 ملم MgCl و 0.05٪ Nonidet P-40) وإضافة 300 ميكرولتر من الطبقة السفلى من حامض الفينول CHCl 2.
  14. دوامة لمدة 1 دقيقة وأجهزة الطرد المركزي في درجة حرارة الغرفة لمدة 5 دقائق على السرعة القصوى (> 15000 x ج).
  15. جمع 250 ميكرولتر من الطبقة العليا RNA (2 × 125 ميكرولتر)، إضافة 25ميكرولتر من 3 M خلات الصوديوم الرقم الهيدروجيني 5.2، 625 ميكرولتر من الإيثانول بنسبة 100٪ المثلج، و 5 ميكرولتر من مرسب. تخلط جيدا ويعجل O / N عند درجة حرارة -20 درجة مئوية.
  16. في اليوم التالي، مزيج وتدور في أقصى سرعة (> 15000 x ج) و 4 درجات مئوية لمدة 30 دقيقة، وتجاهل طاف.
  17. كرر الخطوات من 6،8-6،11.
  18. إعادة تعليق بيليه في 12 ميكرولتر من nuclease خالية من المياه وتخزينها في -80 درجة مئوية حتى الاستخدام.
    ملاحظة: يمكن أن تستخدم الإجراءات ومجموعات RNA العزلة أخرى كذلك.
  19. أداء النسخ العكسي مع hexamers عشوائي وSSII عكس الناسخ وفقا لبروتوكول الشركة المصنعة.
    ملاحظة: نظرا لكمية قليلة من الحمض النووي الريبي معزولة عن خلايا هرمة، فمن الأفضل لاستخدام كل من الحمض النووي الريبي (12 ميكرولتر) لتركيب النسخ العكسي. بدلا من ذلك، RNA يمكن قياسها كميا باستخدام مقياس الطيف الضوئي، وكميات متساوية من RNA يمكن أن تستخدم في النسخ العكسي.
  20. تحليل مستويات مرنا في الوقت الحقيقي باستخدام كمية QPCR (RT-QPCR) amplificأوجه وPCR مزيج الرئيسي-SYBR الأخضر مع الاشعال الجينات المحددة.
    1. كما هو الحال في نموذجي رد فعل RT-QPCR، تمييع [كدنا 01:30 (في ريبونوكلياز / المياه خالية من الدناز) وإضافة 3 ميكرولتر إلى الوقت الحقيقي لوحة 96-جيدا لتحسين دقة pipetting ل. إعداد مزيج رد فعل سيد جين معين إلى الأمام وعكس الاشعال (تركيز 2.5 ميكرومتر، إضافة 5 ميكرولتر / رد فعل)، مزيج PCR-SYBR الأخضر (6.25 ميكرولتر / رد فعل، واستخدام أقل من توصية الشركة الصانعة)، و 5.75 ميكرولتر من ريبونوكلياز / المياه خالية من الدناز لحجم رد الفعل النهائي من 20 ميكرولتر (17 ميكرولتر من الاشعال /-SYBR الأخضر / المياه و 3 ميكرولتر من [كدنا]).
    2. أداء RT-QPCR التضخيم باستخدام الوقت الحقيقي PCR الآلة؛ اتبع بروتوكول الشركة المصنعة.
      ملاحظة: قائمة الإنسان المصادق إلى الأمام وعكس الاشعال الوقت الحقيقي يمكن العثور عليها في الجدول رقم 1. وتشمل هذه الجينات البروتينات SASP وغيرها من علامات الشيخوخة المرتبطة و / أو الجينات. وتظهر نتائج تمثيلية من الشيخوخة الناجمة عن الأشعة تحت الحمراء في

8. مستويات البروتين تحديد مقدار SASP

  1. حمل الشيخوخة باستخدام أقسام 1 أو 2 أو باستخدام طريقة أخرى. لوحة الخلايا إما 6 أو 10 سم لوحات، على النحو المبين أعلاه (~ 250000 خلية / 6 سم لوحة أو ~ 650،000 / 10 سم لوحة).
  2. إما مع خلايا 10 د بعد IR العلاج أو مع خلايا هرمة تنسخي (وخلايا المراقبة المناسبة)، وغسل الخلايا ثلاث مرات مع برنامج تلفزيوني 1X وإضافة المصل خالية المتوسطة مع المضادات الحيوية في حجم صغير (2.5 مل لمدة 6 سم أو 5 مل لمدة 10 سم).
  3. احتضان ليلا 37 درجة مئوية و 5٪ CO 2 في حاضنة زراعة الأنسجة. في اليوم التالي، وجمع المتوسطة ووضعها في أنبوب مخروطي على الجليد.
  4. غسل الخلايا 2 مرات مع برنامج تلفزيوني ثم قم بإضافة 1 مل من التربسين (لطبق 6 سم). عد الخلايا باستخدام عدادة الكريات لضبط وقت لاحق من التركيزات وفقا لعدد الخلايا.
  5. أجهزة الطرد المركزي في المتوسط ​​لمدة 5 دقائق في 300 × ز.
  6. FILTإيه المتوسطة باستخدام فلتر حقنة 0.45 ميكرون.
  7. قسامة المتوسطة وتجميد في -80 درجة مئوية حتى استخدامها أو الفحص مباشرة باستخدام ELISA أو فحوصات مماثلة.
  8. حساب عدد الخلايا تركيز / مل من خلال اتخاذ مجموع عدد الخلايا / حجم المتوسطة التي تم جمعها.
  9. إجراء الفحص المناسب انزيم مرتبط المناعي (ELISA) وفقا لتعليمات الشركة الصانعة. انظر الجدول مواد لمجموعات ELISA الموصى بها لمعايرة لIL-6، IL-8، GROα، وغيرها من السيتوكينات / كيموكينات (الشكل 6B).
  10. للتأكد من أن العوامل التي يتم قياسها ضمن نطاق خطية من عدة ELISA، وجعل التخفيفات من المتوسط ​​خلية الشيخوخي مقارنة المتوسطة خلية المتكاثرة. حساب لهذه التخفيفات وحجم عند حساب كمية IL-6. للحصول على كمية من IL-6 يفرز للخلية يوميا، وحساب قيمة IL-6 التي تم الحصول عليها من عدة (في الحكم) في تركيز خلية المخفف لكل مليلتر (الابام الخطوة 7.8).
    ملاحظة: أساليب أخرى، مثل المصفوفات خلوى، ويمكن استخدامها للكشف عن مستويات البروتين SASP وقد تكون مناسبة لفحص عدد كبير من العوامل SASP. مستويات البروتين من العوامل SASP قد تختلف بناء على الوقت بعد تحريض الشيخوخة، ونوع من الخلايا، أو نوع من الشيخوخة التي يسببها.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

أرقام 2-6 تظهر نتائج ممثلة من تلطيخ SA-β-غال. تلطيخ لγ-H2AX وSAHF. تقييم مستويات البروتين من INK4A P16، P21، والبروتين p53. ومرنا ومستويات البروتين من جزيئات هرمة المصاحب. تحدث زيادة تلطيخ SA-β-غال مع تنسخي والحمض النووي الناجم عن الضرر الشيخوخة. أيضا، لاحظ التغيرات المورفولوجية التي تحدث مع الشيخوخة. تصبح الخلايا الموسع ومسطحة بالمقارنة مع ظهور المغزل من الخلايا الليفية المتكاثرة. لهذا النموذج التجريبي، وكانت ملطخة الخلايا والحمض النووي الريبي / البروتين تم عزل 7 أيام بعد التعرض IR. قد تحدث نتائج أكثر قوة عن طريق الانتظار فترة أطول بعد التعرض IR (أي 10 د). لا بد من تحديدها لكل حالة والإعداد التجريبية الظروف. هذه النتائج هي ممثل ويمكن أيضا الكشف عن هذه العلامات عند الناجم عن الشيخوخة باستخدام طرق أخرى.

her.within الصفحات = "1"> للشكل 6، يتم سرد أسماء الجينات وتتوافق مع CXCL1 (GROα)، CXCL2 (GROβ)، وCSF2 (GM-CSF). وقد لوحظت upregulation من مستويات مرنا من بعض، ولكن ليس كل شيء، من العوامل SASP بعد الشيخوخة الناجمة عن الأشعة تحت الحمراء في WI-38 الخلايا. من mRNAs المرتبطة الشيخوخة الأخرى، بما في ذلك CDKN1A (يشفر P21) وCDKN2A (يشفر P16 INK4A)، وupregulated. وقد أدرجت أيضا من mRNAs الأخرى (EDN1 وANKRD1)، وقد أظهرت في السابق أن تكون أعلى في خلايا هرمة 15. وترد الاشعال في الجدول 1.

شكل 1
الشكل 1: المتكاثرة وهرمة الخلايا الليفية. تمثيل تخطيطي لالمتكاثرة (يسار) وهرمة (يمين) الليفية. وترد أمثلة من محرضات الشيخوخة في أيهامربع llow. ويرتبط الشيخوخة مع مستويات أعلى من العلامات المشار إليها. SA-β-غال، المرتبط الشيخوخة النشاط β غالاكتوزيداز. SASP، المرتبط الشيخوخة إفرازية النمط الظاهري. SAHF، المرتبط الشيخوخة المغاير البؤر. DDR، استجابة الحمض النووي الضرر. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم

الشكل 2
الشكل 2. الخصائص المورفولوجية وزيادة نشاط SA-β-غال خلايا هرمة. WI-38 الخلايا، إما المتكاثرة "الشباب" (PDL 27)، هرمة تنسخي (PDL 40)، أو الذين يتعرضون للإشعاع المؤين (IR)، كانت ملطخة للنشاط SA-β-غال. IMR-90 الخلايا، إما المتكاثرة "الشباب" (PDL 30)، هرمة تنسخي (PDL 52)، أو أولئك الذين تعرضوا للإشعاع (IR) المؤينة، كانت ستاINED للنشاط SA-β-غال. أقسام 1-2 وصف حمل تنسخي والحمض النووي الناجم عن الضرر الشيخوخة، والقسم 3 يفسر تلطيخ لSA-β-غال. كانت ملطخة خلايا 7 أيام بعد IR. يخدع، ومراقبة. شريط مقياس = 50 ميكرومتر. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. عزز γ-H2AX بؤر في خلايا هرمة. WI-38 الخلايا، إما المتكاثرة "الشباب" (PDL 30) أو هرمة تنسخي (PDL 53)، كانت ثابتة وملطخة أضداد γ-H2AX ودابي. لاحظ زيادة في عدد بؤر γ-H2AX في خلايا هرمة. تم الحصول على الصور على المجهر متحد البؤر. اتخذت Z-أقسام، وكان يستخدم أقصى الإسقاط كثافة للحصول على صورة طائرة واحدة لتصور كل DETECبؤر الجدول. شريط مقياس = 20 ميكرومتر. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (4)
الشكل 4. تلطيخ فلوري SAHF في خلايا هرمة. (A) كانت تنتشر WI-38 الخلايا (PDL 27) دون علاج أو تعرضها للإشعاع المؤين (IR). بعد 10 يوما، كانت ملطخة الخلايا مع دابي لتصور SAHF (لاحظ كثيفة / منقط تلطيخ دابي في الخلايا المعالجة IR) (B) كانت تزرع IDH4 بحضور ديكساميثازون (المتكاثرة) أو في جردت الفحم FBS للحث على الشيخوخة ( هرمة). بعد 10 د، وكانت ملطخة الخلايا مع أجسام مضادة ضد H3K9Me2 ودابي. تم الحصول على الصور على المجهر متحد البؤر. اتخذت Z-أقسام، وكان يستخدم الإسقاط أقصى كثافة للحصول على طائرة واحدة،صورة. الخلايا المتكاثرة في (A) و (B) لديها منتشر تلطيخ دابي، في حين أن خلايا هرمة لها منقط تلطيخ دابي. في (B)، الخلايا السيطرة لها منتشر، وتلطيخ خفيف جدا لH3K9Me2، في حين H3K9Me2 تلطيخ هو أكثر قوة وcolocalizes مع بؤر ملطخة دابي في خلايا هرمة. شريط مقياس = 20 ميكرومتر. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 5
الشكل 5. الكمي من البروتينات المرتبطة الشيخوخة. تم عزل البروتين من أي المتكاثرة "الشباب" (PDL 30) IMR-90 الخلايا (-) أو IMR-90 الخلايا التي تعرضت ل10 غراي من الإشعاع المؤين (IR). تم تغيير المتوسطة كل ساعة 48 وكانت هي lysed الخلايا 7 أيام بعد IR. وقد تم تحليل العينات بواسطة SDS-PAGE، immunoblotted مع anti-P16 INK4A antiboيموت، وإعادة بحثها مع مكافحة P21 ثم أضداد البروتين p53. وقد استخدم GAPDH كعنصر تحكم البروتين التحميل. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (6)
الشكل 6. الكمي لمن mRNAs المرتبطة الشيخوخة وSASP البروتينات. تم عزل (A) RNA من أي المتكاثرة "الشباب" (PDL 27 أو 34) خلايا WI-38 (-) أو WI-38 الخلايا التي تعرضت ل10 غراي من الإشعاع المؤين (IR). تم تغيير المتوسط ​​كل 48 ساعة وRNA العزلة تم تنفيذ 7 أيام بعد IR. وقد استخدم RT-QPCR لقياس مستويات من mRNAs المرتبطة الشيخوخة أشارت باستخدام بادئات الجينات المحددة المدرجة في الجدول 1. تم استخدام مستويات 18S للتطبيع. تمثل رسوم بيانية ر تطبيع متوسطس ± غير المعالجة SEM من 5 تجارب مستقلة. تعرضت (B) خلايا WI-38 (PDL 26) إلى 10 غراي من الأشعة تحت الحمراء. بعد مرور 10 د، تم تغيير المتوسطة والمتوسطة المصل الحرة (انظر القسم 7). بعد 24 ساعة، تم جمع المتوسطة مكيفة ووكميا مستويات IL-6، IL-8، وGROα باستخدام فحوصات ELISA. يمثل الرسم البياني يعني ± SEM من 3 تجارب. * P <0.05 و*** P <0.001 كتبها t-الطالب اختبار. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الاشعال الإنسان إلى الأمام عكسي
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (P21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (P16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

الجدول 1: RT-QPCR الاشعال لمن mRNAs المرتبطة الشيخوخة. يشار إلى الأمام وعكس الاشعال لRT-QPCR باستخدام تكنولوجيا SYBR الأخضر.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

هنا، التي وصفناها طرق تنسخي والحمض النووي الضرر الناجم عن الشيخوخة باستخدام الخلايا الليفية مضاعفا الإنسان. وبالإضافة إلى ذلك، يتم تضمين تقنيات لقياس البروتين ومستويات مرنا من مختلف البروتينات المرتبطة الشيخوخة، فضلا عن تلطيخ لSA-β-غال ولDNA-الضرر علامة γ-H2AX. هذه البروتوكولات يمكن استخدامها على نطاق واسع لتقييم الظواهر هرمة سواء في التجارب المختبرية والحية، على الرغم من أن العديد من المحاذير وجود لوصف الشيخوخة في الجسم الحي 20. خلايا أخرى يمكن أن يعبر عن علامات هرمة، حتى لو أنها ليست خلايا هرمة. على سبيل المثال، الخلايا مثل الخلايا الآكلة والضامة لديهم مستويات أعلى من النشاط β-غال 32 و 33. وبالإضافة إلى ذلك، فقد upregulated العديد من الخلايا السرطانية P16 INK4A 34. يمكن أيضا خلايا تتراكم الحمض النووي من التلف (على سبيل المثال، γ-H2AX البؤر) وألا تكون هرمة. ويمكن أيضا أن العوامل SASP أن upregulated بواسطةمختلف الفسيولوجية الطبيعية أو الحالات المرضية التي قد أو قد لا تنطوي على خلايا هرمة. ولذلك، ينبغي أن تستخدم علامات الشيخوخة متعددة، وخاصة عند تقييم الشيخوخة في الجسم الحي.

وعلى الرغم من العثور على خلايا هرمة إلى زيادة في الأنسجة الشيخوخة الطبيعية منذ أكثر من 20 سنوات فمن الآن فقط أننا نقدر تماما عدد كبير من الأدوار التي تلعب خلايا هرمة في كل من توازن الأنسجة العادية وفي الحالات المرضية. وقد سمح توظيف مؤخرا نماذج الماوس للقضاء على P16 INK4A خلايا هرمة -positive للباحثين أكثر وضوحا وتحديدا نقدر دور خلايا هرمة في الأنسجة والأعضاء 35 و 36 و 37. وقد كشفت هذه النماذج أن خلايا هرمة تساهم في العديد من الأمراض المرتبطة بالتقدم في السن، تكون الأورام، والفأرة عمر 35 </ سوب>، 36، 37. ونظرا لهذه الاكتشافات الحديثة والمصادقة على أهمية خلايا هرمة في علم وظائف الأعضاء، أن الوقت قد حان لمزيد من البحوث حول هذه الخلايا المحددة. على سبيل المثال، ودراسات توظف استراتيجيات لإزالة علاجيا خلايا هرمة أو لتأخير الشيخوخة يمكن أن تكون مفيدة لكلا الدراستين healthspan وعمر.

في الآونة الأخيرة، وجدت مختبرنا أن ميتفورمين، وهو دواء يستخدم عادة لعلاج النوع 2 من داء السكري، ويقلل الشيخوخة الخلوية 38. كما هو مقترح الميتفورمين حاليا باعتبارها العلاج المضادة للشيخوخة، ولها خصائص مضادة للسرطان 39، 40، سيكون من المثير للاهتمام في المستقبل لاستكشاف ما إذا كان هذا الدواء، أو التدخلات الشيخوخة أخرى، تؤثر على النتائج الصحية عن طريق تحوير الشيخوخة الخلوية.

البروتوكولات نناقش هنا هي مشتركة وعلى نطاق واسعتقنيات ccepted لتقييم النمط الظاهري الشيخوخي. للخلايا المزروعة في المختبر، فمن الأهمية بمكان لرصد التغيرات خلية من مثل المغزل إلى التشكل بالارض من أجل التأكد من أن الخلايا هي هرمة (انظر الشكلين 1 و 2). إذا كانت الخلايا ليست إيجابية لSA-β-غال أو علامات أخرى وصفها هنا، تقييم الشيخوخة في PDLs خلية أعلى (لالشيخوخة تنسخي) أو في زيادة وقت بعد DNA الناجم عن الضرر الشيخوخة. وبالإضافة إلى ذلك، قد تكون هناك حاجة إلى أن يكون الأمثل لأنواع مختلفة من الخلايا هذه البروتوكولات. لتقييم مستويات البروتين SASP، فمن الأهمية بمكان لإزالة الدم من وسط الخلية، وهذا سوف يسبب مستويات خلفية عالية في ELISA أو صفائف البروتين. ولذلك، تضع ذلك في الاعتبار عند تصميم التجارب، لأنها قد لا تكون مثالية لتقييم في وقت واحد علامات متعددة.

تلطيخ لSA-β-غال، كما هو موضح هنا، محدودة بسبب حقيقة أنه يتطلب تثبيت للخلايا.وبالإضافة إلى ذلك، فقد تبين التقاء خلية للتأثير على النشاط SA-β-غال. وقد تم تطوير بروتوكولات لتقييم النشاط SA-β-غال باستخدام الركيزة الفلورة للنشاط β-غال، والذي يسمح لتقدير حجم هذه العلامة في الخلايا الحية باستخدام التدفق الخلوي 41 و 42 و 43. كما يمكن قياس النشاط SA-β-غال في الخلية لست باستخدام طريقة chemiluminescent 44. وبالإضافة إلى ذلك، كما يمكن قياس γ-H2AX باستخدام طرق أخرى مختلفة، بما في ذلك التدفق الخلوي أو immunoblotting من الخلية لست] 45.

وتجدر الإشارة إلى أن تشكيل SAHF هو خلية خط يعتمد ويرتبط في الغالب مع الجين الورمي الناجم عن الشيخوخة 20، 30، 46. ولذلك، SAHF قد لا تكون موجودة في جميع نماذج الشيخوخة. فائدةSAHF كعلامة هرمة في نماذج الفئران يمكن أيضا أن يكون محدودا بسبب حقيقة أن SAHF عموما لم يلاحظ في الماوس خلايا هرمة 30 و 46 و 47. هنا، تم استخدام الأجسام المضادة ضد H3K9Me2، ولكن الواسمات الجزيئية أخرى من SAHF يمكن استخدامها، بما في ذلك macroH2A، مجموعة التنقل عالية A (HMGA) البروتينات، وثلاثي ميثليته يسين 9 هيستون H3 (H3K9Me3) والبروتينات HP1 المربوطة. وبالإضافة إلى ذلك، فحوصات مناعي لونين يمكن استخدامها لتقييم علامات هيستون أو رابطة لونين البروتينات ملزمة لالجينات المستهدفة E2F.

ينبغي للمرء أن يكون على علم بأن هناك حدودا مختلفة لتميز الشيخوخة، بما في ذلك عدم التجانس للعلامات، وحقيقة أن هذه العلامات ليست أعرب حصرا في خلايا هرمة. متعددة (بشكل عام، 2-3) وينبغي استخدام علامات لتقييم الشيخوخة، بما في ذلك علامات وليس وصفها هنا. على سبيل المثال، DNA-الندوب، التيلوميرويمكن أيضا أن الضرر، و / أو الحمض النووي من التلف مما يشير الى أن كميا. وعلاوة على ذلك، والشيخوخة، وعلى وجه الخصوص، النمط الظاهري SASP، وقد تم مؤخرا أظهرت أن تتأثر الإجهاد معين أو الضرر الذي يسبب الشيخوخة 11، 12، 13، فمن المهم تقييم علامات متعددة في كل نموذج تجريبي.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

وأيد هذه الدراسة من قبل برنامج بحوث جماعية من المعاهد الوطنية للصحة، والمعهد الوطني للشيخوخة. الكتاب أود أن أشكر ميريام غوروسب وقطب عبدالمحسن بالنسبة لكثير من المناقشات المفيدة حول الشيخوخة وقطب عبدالمحسن للأيضا قراءة نقدية للمخطوطة. كما نشكر أعضاء المختبر لدينا، خاصة دوغلاس دلوزين لقراءة نقدية للمخطوطة.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
تقنيات للحث وتحديد الخلوي الشيخوخة
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter