Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Teknikker til at fremkalde og kvantificere cellesenescens

doi: 10.3791/55533 Published: May 1, 2017

Summary

Cellulær aldring, den irreversible tilstand af celle-cyklus arrest, kan induceres ved forskellige cellulære spændinger. Her beskriver vi protokoller til at inducere cellulær aldring og metoder til vurdering markører for senescens.

Abstract

Som reaktion på cellulær stress eller skade, kan prolifererende celler inducerer et specifikt program, der initierer en tilstand af langsigtet cellecyklus-standsning, betegnet cellulær aldring. Akkumulering af aldrende celler forekommer med organismal aldring og gennem løbende dyrkning in vitro. Aldrende celler påvirker mange biologiske processer, herunder fosterudvikling, vævsheling og regenerering, tumorsuppression, og aldring. Kendetegnende for aldrende celler indbefatter, men er ikke begrænset til, øget senescens-associerede β-galactosidaseaktivitet (SA-β-gal); p16 INK4a, p53, og p21-niveauer; højere niveauer af DNA-skade, herunder γ-H2AX; dannelsen af ​​Ældning-associeret heterochro Foci (SAHF); og erhvervelse af et Ældning-associeret Sekretorisk Fænotype (SASP), et fænomen karakteriseret ved udskillelse af en række pro-inflammatoriske cytokiner og signalmolekyler. Her beskriver vi protokoller for både replikativ ogDNA-beskadigelse-induceret senescens i dyrkede celler. Desuden fremhæver vi teknikker til at overvåge aldrende fænotype under anvendelse af adskillige senescens-associerede markører, herunder SA-β-gal, γ-H2AX og SAHF farvning, og at kvantificere protein og mRNA-niveauer af cellecyklusregulatorer og SASP faktorer. Disse fremgangsmåder kan anvendes til vurdering af senescens i forskellige modeller og væv.

Introduction

Over et halvt århundrede siden, Hayflick og kolleger beskrev, hvordan ikke-transformerede celler formere i kultur, men kun i en begrænset periode 1. Langsigtet dyrkning af humane fibroblaster forårsaget cellerne til at stoppe prolifererende; men de var metabolisk aktiv, og dette blev kaldt cellesenescens. Senescens kan være gavnligt for inhibering tumorigenese, men det kan også være skadelig, da det menes at bidrage til tab af regenerationsevne der opstår med aldring 2, 3. Aldrende celler er blevet vist at akkumuleres i væv som mennesker alder 4 og har været impliceret i en række biologiske processer, herunder fosterudvikling, sårheling, vævsreparation, og aldersrelateret inflammation 2.

Kontinuerlig passage af celler i kultur inducerer replikativ senescens, som er blevet forbundetat telomer nedslidning og genomisk ustabilitet. Forskellige celle-spændinger, herunder DNA-skade og onkogener, kan også forårsage ældning 3. Senescens forårsaget af andre end telomer nedslidning faktorer kaldes ofte stress-induceret eller for tidlig ældning og afhænger generelt af p16 INK4a / Rb pathway 5. Selvom prolifererende, utransformerede celler typisk forekommer spindlen i form, kan aldrende celler identificeres som havende visse karakteristika, herunder en flad, stor morfologi og øget senescens-associerede β-galactosidaseaktivitet (SA-β-gal) (figur 1 & 2). Aldrende celler akkumulerer også DNA damage markører, herunder γ-H2AX (figur 3) 6, og potentielt senescens-associerede heterochromatin foci (SAHF) (figur 4) 7. Aldrende celler har højere niveauer af cellecyklusregulatorer, herunder p 16 (p16 INK4a) og / eller p21 og p53 (figur 5) 8, 9. Endvidere har nylige data vist, at aldrende celler kan have ikke-selvstændige virkninger ved at udskille en række pro-inflammatoriske cytokiner og chemokiner kaldes senescens-associerede sekretorisk fænotype (SASP) 10. Selvom denne SASP fænomen kan variere fra celletype til celletype, i almindelighed påvises det ved en stigning i interleukin-6 (IL-6), IL-8, granulocyt-makrofag-kolonistimulerende faktor (GM-CSF), vækst- reguleret onkogen α (GRO-α), og GRO-β, blandt andre (figur 6). Den særlige stress eller skade, der inducerer senescens kan også påvirke den sekretoriske fænotype 11, 12, 13. SASP kan påvises ved måling af niveauerne af udskilte proteiner ved anvendelse ELISA'er eller cytokin / proteinarrayss = "xref"> 10, 14. Selvom posttranskriptionelle mekanismer kan regulere SASP proteinniveauer 11, 15, 16, 17, kan også detekteres ændringer i mRNA-niveauer i mange tilfælde. Disse ændringer er generelt mere følsomme og lettere at kvantificere end målinger proteinniveau. Andre aldrende markører kan også vurderes, herunder vedvarende DNA beskadigelse nuklear foci, kaldet DNA-segmenter med chromatin ændringer forstærkende senescens (DNA-SCARS) 18, og forskellige andre markører 3, 19, 20.

Her beskriver vi almindelige teknikker til induktion senescens i celler i kultur og også til måling af flere markører for senescens, herunder SA-β-Gal, γ-H2AX, SAHF, og proteinet og mRNA af ældesnce-associerede molekyler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Induktion Replikativ Ældning

  1. Optø lav passage humane diploide fibroblaster (fx WI-38 og IMR-90) eller andre cellelinjer.
    BEMÆRK: Her blev humane diploide fibroblaster anvendes, men disse protokoller kan anvendes til at vurdere senescens i andre celletyper, såsom endotheliale, epitheliale, eller mesenchymstamceller. Dyrkningsbetingelser kan optimeres til de forskellige celletyper, der anvendes på grund af forskellige vækstrater og vækstbetingelser.
    BEMÆRK: Cellerne skal være prolifererende og har en spindel morfologi (se figur 1 for en skematisk og figur 2 for eksempler). Ideelt set bør cellerne har en Befolkning Fordobling Level (PDL) på <30 ved starten af ​​eksperimenter for at undgå at have mulige replikative aldrende celler.
    1. Beregne PDL af cellerne under anvendelse af følgende ligning PDL = log (N f / N 0) / log2, hvor N f er det endelige celleantal og <em> N 0 er det oprindelige antal sederede celler 21.
  2. Kultur WI-38-celler i Dulbeccos modificerede Eagle-medium (DMEM) suppleret med 10% kalvefosterserum (FBS), 1% ikke-essentielle aminosyrer og 1% penicillin / streptomycin.
  3. Grow IMR-90 celler i DMEM suppleret med 10% FBS og 1% penicillin / streptomycin.
  4. Dyrk alle celler ved 37 ° C og 5% CO 2. Løbende vokse cellerne og opdele hver 2 - 4 d når cellerne når -70 - med 80% konfluens. Overvåg cellekonfluens anvendelse af et lysmikroskop. Undgå celler med højere sammenløb, da dette kan påvirke cellevækst som følge af kontakt inhibering.
  5. Overvåg cellerne under et lysmikroskop for den morfologiske udseende af aldrende celler (se figur 1 & 2) og til, når der ikke er nogen ændring i PDL fra én subkultur til den næste.

2. DNA Damage-induceret Ældning

    (fx WI-38, IMR-90, eller en anden celletype) ved en sparsom densitet (dvs. ~ 300.000 celler / 6 cm skål) i en passende skål for den type analyse (dvs. en 6 cm skål for protein / RNA markører eller en 6-brønds skål for SA-β-gal-farvning). Brug tidlig-passage-celler, som er ung og prolifererende (<30 PDL) og pladen dem således at cellerne er ca. 50 - 60% konfluente på den næste dag.
  1. Fjern vækstmediet under anvendelse af en glaspipette forbundet med en vakuumkilde og vask af cellerne ved tilsætning af 1x phosphatpufret saltvand (PBS). Gentage dette trin for i alt to vaske. Tilføje et tyndt lag af PBS (~ 750 pi for en 6 cm skål) for både en "mock" behandlet og for en ioniserende stråling (IR) behandlede tilstand.
  2. Brug en gamma strålerøret at eksponere celler til en enkelt dosis på 10 Gray (Gy) IR; dette er et typisk eksponering for de fleste cellelinjer. Under en hætte, fjern PBS og erstatte det med vækstmedium. Alternativt behandle cellerne med bleomycin ved 20 ug / ml i 2 timer.
  3. Ændre mediet på cellerne hver 48 -7 2 ​​timer og opdele cellerne om nødvendigt.
  4. Overvåg cellerne under et lysmikroskop for morfologiske ændringer (se figur 1 for en skematisk og figur 2 for repræsentative celle billeder) og assay for aldrende markører 7-10 d efter IR behandling.
    BEMÆRK: Denne protokol beskriver senescens induceret af IR. Senescens kan også induceres af andre påvirkninger, herunder bleomycin (se ovenfor for tilstande), H2O 2 22, 23, kemoterapeutiske lægemidler 24, cigaretrøg 25, transformerende vækstfaktor (TGF) -β1 26, 27, og andre metoder 21 , 28, 29.

3. Farvning Cells for Ældning-associeret β-galactosidase

  1. Før farvning, undersøge cellerne under et lysmikroskop til at overvåge de morfologiske ændringer.
    BEMÆRK: aldrende celler typisk udvidet og flad, i modsætning til prolifererende celler, som har en spindel morfologi (Se figur 1 for en skematisk og figur 2 for repræsentative resultater). Prolifererende celler kan anvendes som en negativ kontrol, og celler behandlet med IR eller en anden DNA-beskadigende middel (se afsnit 2) kan anvendes som positive kontroller.
  2. Kvantificere SA-β-gal-aktivitet under anvendelse af reagenser fra et kommercielt kit (se Materialer tabellen). Optø alle reagenser og bringe dem til stuetemperatur ved opvarmning dem op til 37 ° C.
    1. Beregn mængden af ​​farveopløsning og fikseringsopløsning nødvendig.
      BEMÆRK: Typisk er en 1 ml volumen er tilstrækkeligt til en brønd i en 6-brønds plade. Forskellige pladestørrelser kan anvendes, men en plade med 6 brønde størrelse er well velegnet til udførelse af en analyse i triplikat for hver tilstand. Denne tæthed giver normalt et tilstrækkeligt antal celler pr at tælle uden at anvende et overskud antal celler.
    2. Fortynde farveopløsningen 1:10 med destilleret vand.
    3. Fortynde fikseringsopløsning 1:10 med destilleret vand.
    4. Udgør en 20x stamopløsning af X-gal (5-brom-4-chlor-3-indolyl-β-D-galactopyranosid) i N, N-dimethylformamid (DMF; fx 20 mg X-gal i 1 ml DMF). For at maksimere anvendelsen af ​​kittet, udmåle X-gal til det nødvendige beløb for hver analyse, og derefter tilføje den beregnede mængde DMF til opløsning. Alternativt opbevares stamopløsning ved -20 ° C i en lys-beskyttet rør i en måned. Brug kun polypropylen (uigennemsigtig) rør til fortynding og opbevaring X-gal løsninger.
    5. Forberede β-gal-farvningsopløsning: 930 pi 1x farvning opløsning, 10 pi farvning supplement A, 10 pi farvning supplement B, og 50 pi 20 mg / ml xgal i DMF. Lav en master mix afhængigt af hvor mange brønde der skal farves.
  3. omhyggeligt fjerne mediet fra cellerne under anvendelse af en overførsel pipette eller tilsvarende.
  4. Forsigtigt vaske cellerne en gang med stuetemperatur 1x PBS.
  5. Tilsæt 1 ml 1x fikseringsopløsning til hver brønd og inkuberes i 10 - 15 minutter ved stuetemperatur.
  6. Fjern fiksativ løsning med en overførsel pipette.
    BEMÆRK: fikseringsopløsning (1x) indeholder 2% formaldehyd og 0,2% glutaraldehyd og skal bortskaffes som farligt affald i henhold til anbefalingerne fra det laboratorium, sikkerhed kontor.
  7. Forsigtigt vaske cellerne to gange med 1 x PBS.
  8. Fjern PBS fuldstændigt og tilføje 1x β-gal-farvning opløsning til brøndene (1 ml / brønd af en 6-brønds plade). Dæk pladen helt med aluminiumsfolie og inkuberes i 24 - 48 timer i en 37 ° C inkubator (fortrinsvis i fravær af CO 2, da dette kan sænke pH af bufferen og påvirke farvning).
    1. Tjek cellerne ved 24 h for farvning, og hvis pletten er for lys, inkuberes i yderligere 24 timer.
  9. Efter inkubationstiden fjerne β-gal-opløsning og erstatte det med 1x PBS.
    BEMÆRK: Dette trin fjerner nogle af baggrundsfarven, når billedbehandling og forhindrer også farlig spild af X-gal løsning.
    BEMÆRK: Bortskaf β-gal løsning korrekt, i overensstemmelse med anbefalingerne fra det laboratorium, sikkerhed kontor.
  10. Undersøge cellerne på et lysmikroskop med en vedhæftet kamera under anvendelse af et 10x eller højere mål; SA-β-gal-positive celler vil være blå. Erhverve det ønskede antal billeder for eksperimentet. Hvis tælle procentdelen af ​​SA-β-gal-positive celler, erhverve den rette antal billeder (> 5) til kvantificering pr. Sikre, at billederne er ikke-overlappende fra forskellige synsfelter indenfor hver brønd.
  11. Tæl antallet af SA-β-gal-positive (blå) celler versus antallet af totale cellerat beregne procent af SA-β-gal-positive celler. Tæl> 100 celler pr tilstand.
    BEMÆRK: Repræsentant billeder kan også bruges til tal. Bemærk, at celle sammenløb er kritisk, hvis tælle celler, som alt for mange celler gør det vanskeligt at skelne hver celle, og for få kan ikke give et tilstrækkeligt antal celler til kvantificering og statistik. Billeder til tallene for offentliggørelse er i den bedste opløsning, hvis gemmes som .tiff-filer, selvom .jpeg filer er også egnede. Farvebilleder bør være 300 dpi.

4. Farvning Celler til γ-H2AX

  1. Plate cellerne fra §§ 1 eller 2 på dækglas i en 24-brønds plade.
  2. Den næste dag vaskes cellerne med 1x PBS. Skyl grundigt, da aldrende celler ikke klæber godt til dækglas og kan let fjernes under vaske. Alternativt direkte fikseres cellerne uden vask.
  3. Fjern PBS og fikseres cellerne med frisk fremstillet 3,7% formaldehyd i PBS i10 minutter ved stuetemperatur.
  4. Fjern opløsningen og permeabilisere cellerne med 0,2% Triton X-100 i PBS i 10 min.
  5. Fjern opløsningen og blokeret 5% FBS i PBS i 2 timer ved stuetemperatur.
  6. Inkubere med anti-phospho γ-H2AX (Ser139) og FITC-konjugat i 5% FBS / PBS i 2 timer ved 37 ° C eller O / N ved 4 ° C. Beskyttes mod lys.
  7. Vask 3 - 6 gange med PBS ved 37 ° C i alt 30 - 60 min.
  8. Pletten med DAPI (fortyndet 1: 15.000 i PBS) i 10 minutter ved stuetemperatur.
  9. Vask 3 x med PBS.
  10. Hurtigt vaskes med vand for at fjerne saltene og montere dækglasset på et objektglas under anvendelse af 3 - 5 pi antifade reagens. Alternativt brug en monterings opløsning indeholdende DAPI.
  11. Lad det tørre O / N og visualisere de farvede celler på en fluorescerende eller konfokalt mikroskop under anvendelse af en 63X eller højere mål.
  12. Kvantificere den γ-H2AX foci ved anvendelse af enten af ​​to nedenfor beskrevne metoder. Score for enten protokol ved øjet under anvendelse af et fluorescensmikroskop. Ideelt, osea konfokalt mikroskop. Tage Z-sektioner og kondensere til en enkelt plan med henblik på at visualisere alle påviselig foci (repræsentative billeder for γ-H2AX farvning i prolifererende og aldrende celler er vist i figur 3). Tæl foci ved øjet hjælp imaging software; generelt, ~ 100 - 200 kerner er tilstrækkelige til tælling.
    1. For at kvantificere procentdelen af ​​celler, der har γ-H2AX-positive foci, tælle hver celle, der har mindst en fokus synlig og dividere med det samlede antal DAPI-farvede kerner.
    2. For at kvantificere antallet af γ-H2AX foci, tælle γ-H2AX foci per celle.
      BEMÆRK: Niveauerne af γ-H2AX kan variere afhængigt af den specifikke stressor eller skade, der inducerede senescens.

5. Farvning Celler til SAHF Markers

BEMÆRK: Menneske aldrende celler vil ofte have nukleare områder af kondenseret DNA / kromatin. I aldrende celler, disse heterochromatic regionermenes at inhibere ekspressionen af ​​proliferationsfremmende gener, såsom E2F-familiemedlemmer. SAHF kan visualiseres ved reorganisering af DAPI; ved tilstedeværelsen af ​​heterochromatin-associeret histon mærker, herunder di- og tri-methylering af Lys9 på histon H3 (H3K9Me2 og H3K9Me3); og ved chromatinforbundne omorganisering proteiner, herunder HP1 heterochromatin protein 1 (HP1), Hira (histon repressor A), og ASF1a (anti-silencing funktion-1a) til kromatin 30. Vi har valgt at bruge et onkogen-induceret ældning model (OIS), som SAHF er mere fremtrædende i OIS-modeller 30. IDH4 prolifererer i nærværelse af dexamethason på grund af tilstedeværelsen af SV40 stort T-antigen, men bliver aldrende efter fjernelsen af dexamethason fra mediet 31. SAHF kan påvises ved DAPI-farvning og ved farvning med antistoffer mod de specifikke markører anført ovenfor. Her beskriver vi DAPI og H3K9Me2 farvning for visualization af SAHF i celler 28.

  1. Vokse IDH4 celler i DMEM suppleret med 10% FBS, 1% penicillin / streptomycin, og 1 pg / ml dexamethason. For at inducere senescens, fjern dexamethason og ændre mediet, således at den indeholder kul-strippet FBS; efter dyrkning i ~ 10 dage i dette nye medie, IDH4 celler bliver aldrende 31.
  2. Plate IDH4 celler eller celler fra afsnit 1 eller 2, beskrevet ovenfor, på dækglas i en 24-brønds plade.
  3. Den næste dag vaskes cellerne med 1x PBS. Skyl grundigt, da aldrende celler ikke klæber godt til dækglas og kan nemt fjernes under vaske. Alternativt direkte fix celler uden vask.
  4. Fjern PBS og fikseres cellerne med frisk fremstillet 3,7% formaldehyd i PBS i 10 minutter ved stuetemperatur.
  5. Vask cellerne 3 gange med 1 x PBS.
  6. Fjern opløsningen og permeabilisere cellerne med 0,2% Triton X-100 i PBS i 5 minutter.
  7. Vask cellerne med 1xPBS. Fjern PBS og blokere dækglassene ved tilsætning af blokerende buffer indeholdende 3% BSA (vægt / volumen) i PBS i 5 minutter ved stuetemperatur. foretage altid opløsninger indeholdende BSA før anvendelse for at fjerne partikelformigt stof.
  8. Fjern blokeringsbufferen og inkuber cellerne med primære antistoffer mod SAHF markører, såsom anti-H3KMe2 antistoffer (figur 4; se Materialer tabel for detaljer). Fortynd antistofferne i blokeringsbuffer og inkuberes i 1 - 2 timer ved stuetemperatur.
  9. Fjern det primære antistof opløsning og vask dækglassene 3 gange med 1% (volumen / volumen) Triton X-100 i PBS.
  10. Fortynd de sekundære antistoffer i blokeringsbuffer (Materialer Table) og inkuberes i 1 time ved stuetemperatur. Beskyttes mod lys.
  11. Vask cellerne to gange med 1 x PBS. Pletten med DAPI (fortyndet 1: 15.000 i PBS; se Materialer tabel) i 10 minutter ved stuetemperatur.
  12. Vask dækglassene 3x med 1x PBS.
    1. Hurtigt vaskes med vand for at fjerne saltene ennd montere hver dækglas på et objektglas under anvendelse af 3 - 5 pi antifade reagens. Alternativt brug en monterings opløsning indeholdende DAPI.
    2. Lad tørre O / N og visualisere de farvede celler på en fluorescerende eller konfokalt mikroskop under anvendelse af en 63X eller højere mål (se Repræsentative resultater i figur 4). Kvantificere SAHF som beskrevet i afsnit 4.
      BEMÆRK: isotypekontrol primære antistoffer eller intet primært antistof (dvs. sekundært alene) bør anvendes som en negativ kontrol for immunfluorescensfarvning.

6. Analyse Ældning-associerede proteiner ved immunblotting

BEMÆRK: aldrende fænotype er kendetegnet ved opregulering af cellecyklusregulatorer, herunder p16 INK4a, p21, og p53. Denne protokol vil beskrive kvantificering af niveauerne af disse proteiner i cellelysater. Disse teknikker kan anvendes til at vurdere senescens induceret ved hjælp af forskelligefremgangsmåder 21, 28, 29.

  1. Fremkalde cellulær aldring som beskrevet i afsnit 1 og 2 eller ved en anden metode 21, 28, 29. At analysere cellulær aldring markører, udplade celler i 6 cm skåle og analysere både proteinet og RNA samtidigt (se afsnit 7 for RNA isolation instruktioner).
  2. Fjern cellekulturmediet. Sæt cellerne på en bakke med is.
    1. Vask cellerne 2 gange med kold 1x PBS. Vip skålen at sikre, at alle PBS aspireret for at være så præcis i forhold til de, der anvendes til proceduren mængder.
    2. Efter aspirering den sidste vask af PBS, tilsættes 200 pi kold 1x PBS (for en 6 cm skål) til skålen. Skrabe cellerne under anvendelse af en celleskraber.
    3. Pipette den / PBS blanding celle, i en RNase-frit rør til RNA-isolering. Tag ca. 150 &# 181; L af denne blanding og pipette det til et nyt rør. Denne portion vil blive anvendt til proteinanalyse, så sørg for at pipettere det samme beløb fra hvert rør.
  3. Lyserer cellerne ved tilsætning af 75 - 100 pi modificeret 2x Laemmli prøvebuffer (60 mM Tris-HCI pH 6,8, 12,5% glycerol, 2% SDS, 5% β-mercaptoethanol (BME), og bromphenolblåt; kan gøres op som en stor batch, alikvoteret og opbevaret ved -20 ° C indtil anvendelse) eller en tilsvarende prøvebuffer.
    1. Alternativt lysere cellerne i 75 - 100 pi lysepuffer og der centrifugeres ved 15.000 xg i 10 min ved 4 ° C for at fjerne cellerester. Fjern supernatanten og pipette til et rent rør. En Bradford-proteinassay eller et ækvivalent protein assay kan anvendes på lysater til at sikre lige så stor belastning af protein.
      BEMÆRK: Proteinassays kan ikke udføres på prøver lyseret i prøvebuffer.
    2. Tegne ~ 25 pi lysat og føje den til 15 pi 2x prøvebuffer. Pipette op og gørewn i prøvebufferen for at lysere cellerne.
      BEMÆRK: Mængder af lysisbuffer eller prøvebuffer kan justeres afhængigt af cellekonfluens. Hvis prøven er "klæbrig" som følge af nuklear lysering, tilføje mere prøvepuffer eller PBS til fortynding. Prøver kan opbevares ved -20 ° C indtil anvendelse.
  4. Kog prøverne i 5 minutter ved 95 ° C på en varmeblok (eller tilsvarende udstyr) og belastning ~ 40 pi lyseret prøve i prøvepuffer på en 18% Tris-glycin gel.
    BEMÆRK: En gradient gel (4-15%) eller en 14% Tris-glycin gel er også tilstrækkeligt til at detektere proteiner med lav molekylvægt. kan også anvendes forskellige typer af acrylamidgeler, men sikrer, at gelerne og systemet er tilstrækkelige til at detektere proteiner med lav molekylvægt.
    1. Køre ved hjælp 1x løbebuffer ved en konstant 100 V i 20 min (gennem stabelgelen) og ~ 60 minutter ved 180 V. Overvåg gelen så farvestoffronten bare løber af eller er i bunden af ​​gelen, således at den lavmolekylære tunge proteiner ikke run off af gelen.
  5. Overfør acrylamidgelen til en PVDF-membran (præopblødt med 100% methanol for at aktivere). Hvis gør en våd overførsel, der kun er brug 1 time til overførsel (versus normal ~ 1,75 time). Justere i overensstemmelse hermed for passende overførselssystemet anvendelse pre-farvede molekylvægtsmarkører kan støtte i vurderingen overførselseffektivitet.
  6. Vask membranen i vand. Brug en Ponceau pletten til at overvåge for lige lastning af prøver. Vaske Ponceau af med vand.
    1. Blokere membranen i 5% fedtfri tørmælk i TBST (50 mM Tris-HCI, pH 7,5, 150 mM NaCl og 0,1% Tween-20) i 1 time ved stuetemperatur eller O / N ved 4 ° C under omrøring.
  7. Vask duppes én gang med TBST og inkuberes med primært antistof fortyndet i 5% mælk TBST (se Materialer Table for fortyndinger og antistof anbefalinger) i 1 time ved stuetemperatur.
  8. Udføre to hurtige vaske med TBST og derefter vask to gange på et rysteapparat i alt ~ 30 min (~ 15 min hver varh).
  9. Inkuber med et sekundært antistof i 40 minutter ved stuetemperatur. Gentag trin 6.10.
  10. Der inkuberes med frisklavet Western blot substrat og udvikle filmen eller læse det på en chemiluminescens læser.
  11. Probe immunoblot med p16 INK4a antistoffer først (figur 5). Strippe membranen ved inkubation i 15 minutter med vand, 15 min med 0,2 N NaOH, og 15 min med vand. Fortsætte med trin 6.9 under anvendelse af anti-p21-antistoffer.
  12. Fratage membranen under anvendelse af 62,5 mM Tris-HCL pH 6,8 og 2% SDS med 300 pi frisk tilsat BME per 50 ml stripningsopløsningen.
  13. Inkuber ved 50 ° C i 30 minutter og vaskes grundigt med TBS og derpå TBST. Probe med anti-actin eller anti-GAPDH-antistoffer til protein-loading kontroller (Figur 5 viser repræsentative resultater).
    BEMÆRK: p53 niveauer kan også vurderes på de samme membraner. Men eftersom p53 er en højere molekylvægt, det er bedre opløst på en lavere procentdel gel (for eksempel

7. Analyse af mRNA niveauer af Ældning Markers

BEMÆRK: Når isolering af RNA, sikre, at arbejde overflader rengøres med RNase fjernelse løsninger eller tilsvarende, og at materialerne er alle RNase-fri.

  1. Ved hjælp af / PBS-blanding celle fra trin 4.2, tilsættes 1 ml RNA-ekstraktion opløsning og vortex i 30 sekunder (der bør ikke være nogen synlige klumper eller cellerester).
  2. Tilsæt 200 uL chloroform og rystes kraftigt i 15 sekunder.
  3. Centrifuge ved maksimal hastighed (> 15.000 xg) i 15 minutter ved 4 ° C.
  4. Fjern ~ 400 pi af det øverste RNA vandige lag og pipette det i et nyt mikrofugerør.
  5. Tilsættes 400 pi isopropanol (1: 1 med det totale volumen af ​​vandig fase pipetteret i det foregående trin) og 4 pi precipitant til RNA lag.
  6. Centrifuge i 15-30 min ved maksimal hastighed (> 15.000 xg) og 4 ° C for at pelletere RNA'et.
  7. Fjern supernatanten og tilsæt 1 ml 75% iskold ethanol.
  8. Centrifuge i 1 minut ved maksimal hastighed (> 15.000 xg) og 4 ° C.
  9. Fjern supernatanten og centrifugeres i 1 min ved maksimal hastighed (> 15.000 xg) og 4 ° C.
  10. Pipette ud så meget væske som muligt og lufttørring i 2 min.
  11. Resuspender i 10 pi 10x DNase-buffer, 85 pi H2O, og 5 pi DNase 1.
  12. Der inkuberes ved 37 ° C i 30 minutter.
  13. Tilsæt 200 pi NT2-buffer (50 mM Tris-HCI pH 7,4, 150 mM NaCl, 1 mM MgCl2 og 0,05% Nonidet P-40) og tilsæt 300 pi af det nedre lag af syre phenol-CHCI2.
  14. Vortex i 1 min og centrifugeres ved stuetemperatur i 5 minutter ved maksimal hastighed (> 15.000 xg).
  15. Indsamle 250 pi af den øvre RNA lag (2 x 125 pi) 25pi 3 M natriumacetat pH 5,2, 625 pi 100% iskold ethanol og 5 pi præcipitant. Bland godt og udfælde O / N ved -20 ° C.
  16. Den næste dag, blandes og centrifugering ved maksimal hastighed (> 15.000 xg) og 4 ° C i 30 minutter og kasser supernatanten.
  17. Gentag trin 6,8-6,11.
  18. Resuspender pellet i 12 pi nuclease-frit vand og opbevares ved -80 ° C indtil anvendelse.
    BEMÆRK: Andre RNA isolation procedurer og kits kan anvendes.
  19. Udføre revers transkription med vilkårlige hexamerer og SSII revers transkriptase ifølge fabrikantens protokol.
    BEMÆRK: I betragtning af den lave mængde RNA isoleret fra aldrende celler, er det bedst at bruge alle RNA (12 pi) for revers transkription syntese. Alternativt kan RNA kvantificeres ved anvendelse af et spektrofotometer, og lige store mængder RNA kan anvendes til revers transkription.
  20. Analyser mRNA-niveauerne ved anvendelse af kvantitativ realtids-qPCR (RT-qPCR) amplification og SYBR-green PCR-masterblanding med genspecifikke primere.
    1. Som i en typisk RT-qPCR reaktion fortyndes cDNA 01:30 (i RNase / DNase-frit vand) og tilsæt 3 pi til real-time 96-brønds plade til bedre pipettering nøjagtighed. Forberede en reaktion mastermix af genspecifik forward og reverse primere (2,5 uM koncentration, tilsættes 5 pi / reaktion), SYBR-green PCR-blanding (6,25 pl / reaktion; anvende mindre end producentens anbefaling) og 5,75 pi RNase / DNase-frit vand til et endeligt reaktionsvolumen på 20 pi (17 pi primere / SYBR-grønt / vand og 3 pi cDNA).
    2. Udføre RT-qPCR amplifikation under anvendelse af et realtids-PCR-maskine; Følg producentens protokol.
      BEMÆRK: En liste over validerede human forward og reverse realtid primere kan findes i tabel 1. Disse gener indbefatter SASP proteiner og andre senescens-associerede markører og / eller gener. Repræsentative resultater fra IR-induceret aldring er vist i

8. Kvantificering SASP Protein Niveauer

  1. Fremkalde aldring anvendelse §§ 1 eller 2 eller ved en anden metode. Plate cellerne på enten 6 eller 10 cm plader, som beskrevet ovenfor (~ 250.000 celler / 6 cm plade eller ~ 650.000 / 10 cm plade).
  2. Enten med celler 10 d post-IR behandling eller med replikative aldrende celler (og egnede kontrolceller), vask af cellerne tre gange med 1 x PBS og tilføje serumfrit medium med antibiotika i et lille volumen (2,5 ml til 6 cm eller 5 ml til 10 cm).
  3. Inkuber natten over ved 37 ° C og 5% CO2 i en vævsdyrkningsinkubator. Den næste dag, indsamle mediet og sætte det i en konisk rør på is.
  4. Vask cellerne 2 gange med PBS og derefter tilsættes 1 ml af trypsin (for en 6 cm skål). Tæl cellerne under anvendelse af et hæmocytometer til senere justere koncentrationerne ifølge celleantal.
  5. Centrifuge mediet i 5 minutter ved 300 x g.
  6. Filtis de medium ved anvendelse af et 0,45 um sprøjtefilter.
  7. Alikvot mediet og fryse ved -80 ° C indtil anvendelse eller analyse direkte anvendelse af ELISA eller tilsvarende assays.
  8. Beregne antallet af celler / ml koncentration ved at tage det samlede celleantal / volumen medium opsamlet.
  9. Gennemfører en passende enzymbundet immunsorbentassay (ELISA) ifølge producentens instruktioner. Se Materialer Table for anbefalet ELISA kits til assaying for IL-6, IL-8, GROa, og andre cytokiner / kemokiner (figur 6B).
  10. At sikre, at de faktorer, der måles, er inden for det lineære område for ELISA-kit, gør fortyndinger af senescentcelle medium sammenlignet med prolifererende cellemediet. Konto til disse fortyndinger og volumenet ved beregningen af ​​IL-6. At erhverve mængde IL-6 secerneret per celle per dag, beregne IL-6 værdi opnået fra sættet (i pg) pr fortyndet cellekoncentration pr ml (frabout trin 7.8).
    BEMÆRK: Andre fremgangsmåder, såsom cytokin arrays, kan anvendes til påvisning af SASP proteinniveauer og kan være egnet til screening af et stort antal SASP faktorer. Proteinniveauerne af SASP faktorer kan variere baseret på tiden efter senescens induktion, celletypen eller typen af ​​senescens induceres.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figurerne 2 - 6 viser repræsentative resultater fra SA-β-gal-farvning; farvning for γ-H2AX og SAHF; vurdering af proteinniveauer af p16 INK4a, p21, og p53; og mRNA og proteinniveauer af aldrende-associerede molekyler. Øget SA-β-gal-farvning sker med replikativ og DNA-beskadigelse-induceret aldring. Også observere de morfologiske ændringer, der sker med ældning. Cellerne bliver forstørret og flad i forhold til spindlen udseende prolifererende fibroblaster. Til denne eksperimentelle paradigme blev celler farvet og RNA / protein blev isoleret 7 d efter IR eksponering. Mere robuste resultater kan forekomme ved at vente længere efter IR eksponering (dvs. 10 d). Betingelser der skal bestemmes for hver tilstand og forsøgsopstilling. Disse resultater er repræsentative, og kan også påvises disse markører når senescens induceres ved hjælp af andre metoder.

figur 6, er gen-navne anført og svarer til CXCL1 (GROa), CXCL2 (GROP), og EFSR2 (GM-CSF). Opreguleringen af ​​mRNA-niveauer af nogle, men ikke alle, af SASP faktorer blev observeret efter IR induceret senescens i WI-38-celler. Andre senescens-associerede mRNA'er, herunder CDKN1A (koder p21) og CDKN2A (koder p16 INK4a) blev opreguleret. Andre mRNA'er (EDN1 og ANKRD1) er også medtaget og har tidligere vist sig at være højere i aldrende celler 15. Primere er anført i tabel 1.

figur 1
Figur 1: Prolifererende og ældede fibroblaster. En skematisk fremstilling af prolifererende (til venstre) og ældede (højre) fibroblaster. Eksempler på senescens inducere fremgår af Illow kassen. Begyndende alderdom er forbundet med højere niveauer af de angivne markører. SA-β-gal, senescens-associerede β-galactosidase-aktivitet; SASP, senescens-associerede sekretorisk fænotype; SAHF, senescens-associerede heterochromatin foci; DDR, DNA-skade responset. Klik her for at se en større version af dette tal

figur 2
Figur 2. Morfologiske karakteristika og Øget SA-β-gal-aktivitet af senescentceller. WI-38-celler, enten prolifererende "unge" (PDL 27), replikative aldrende (PDL 40), eller dem, der udsættes for ioniserende stråling (IR), blev farvet for SA-β-gal-aktivitet. IMR-90 celler, enten prolifererende "unge" (PDL 30), replikative aldrende (PDL 52), eller dem, der udsættes for ioniserende stråling (IR), var stained for SA-β-gal-aktivitet. §§ 1 - 2 ud beskriver induktion replikativ og DNA-beskadigelse-induceret aldring, og afsnit 3 forklarer farvning for SA-β-gal. Celler blev farvet 7 d efter IR. Con, kontrol. Målestok = 50 um. Klik her for at se en større version af dette tal.

figur 3
Figur 3. Forøget γ-H2AX Foci i aldrende celler. WI-38-celler, enten prolifererende "unge" (PDL 30) eller replikative aldrende (PDL 53), blev fikseret og farvet med anti-y-H2AX antistoffer og DAPI. Bemærk stigningen i antallet af γ-H2AX foci i aldrende celler. Billeder blev opnået på et konfokalt mikroskop. Z-snit blev taget, og den maksimale intensitet projektion blev anvendt til at opnå et enkelt plan billede at visualisere alle detektable brændpunkter. Målestokken = 20 um. Klik her for at se en større version af dette tal.

figur 4
Figur 4. Fluorescerende Farvning af SAHF i aldrende celler. (A) Prolifererende WI-38-celler (PDL 27) var ubehandlede eller udsættes for ioniserende stråling (IR). Efter 10 dage blev cellerne farvet med DAPI for at visualisere SAHF (bemærk tæt / punktformet DAPI farvning i IR-behandlede celler) (B) IDH4 blev dyrket i nærvær af dexamethason (prolifererende) eller i kul-strippet FBS at inducere senescens ( senescent). Efter 10 d blev cellerne farvet med antistoffer mod H3K9Me2 og DAPI. Billeder blev opnået på et konfokalt mikroskop. Z-snit blev taget, og den maksimale intensitet projektion blev anvendt til at opnå en enkelt-planbillede. Prolifererende celler i (A) og (B) har diffus DAPI-farvning, mens aldrende celler har punktformet DAPI-farvning. I (B), kontrolceller har diffuse, meget let farvning for H3K9Me2, hvorimod H3K9Me2 farvningen er mere robust og colokaliserer med DAPI-farvede foci i aldrende celler. Målestokken = 20 um. Klik her for at se en større version af dette tal.

figur 5
Figur 5. Kvantificering af Ældning-associerede proteiner. Protein blev isoleret fra enten prolifererende "unge" (PDL 30) IMR-90 celler (-) eller IMR-90 celler, der blev udsat for 10 Gy ioniserende stråling (IR). Mediet blev skiftet hver 48. timer, og cellerne blev lyseret 7 d efter IR. Prøver blev analyseret ved SDS-PAGE, immunoblottet med anti-p16 INK4a Antibodør, og re-probet med anti-p21 og derefter anti-p53-antistoffer. GAPDH blev anvendt som et protein loading kontrol. Klik her for at se en større version af dette tal.

figur 6
Figur 6. Kvantificering af Ældning-associerede mRNA'er og SASP Proteins. (A) RNA blev isoleret fra enten prolifererende "unge" (PDL 27 eller 34) WI-38 celler (-) eller WI-38-celler, der blev udsat for 10 Gy ioniserende stråling (IR). Mediet blev skiftet hver 48. timer, og RNA-isolering blev udført 7 d efter IR. RT-qPCR blev anvendt til at kvantificere niveauet for de angivne senescens-associerede mRNA'er under anvendelse af genspecifikke primere, der er opført i tabel 1. 18S niveauer blev anvendt til normalisering. Histogrammerne repræsenterer middelværdien normaliserede to ubehandlet ± SEM fra 5 uafhængige eksperimenter. (B) WI-38 celler (PDL 26) blev udsat for 10 Gy af IR; 10 d senere blev mediet ændret til serumfrit medium (se afsnit 7). Efter 24 timer blev konditioneret medium opsamlet og IL-6, IL-8 og GROa niveauer blev kvantificeret ved anvendelse af ELISA-assays. Histogrammet repræsenterer middelværdien ± SEM fra 3 eksperimenter. * P <0,05 og *** P <0,001 ved t-test. Klik her for at se en større version af dette tal.

humane Primere Frem Bagside
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (p21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
EFSR2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL-6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabel 1: RT-qPCR Primere til Ældning-associerede mRNA'er. Fremadrettede og reverse primere for RT-qPCR anvendelse SYBR-grøn teknologi er angivet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her har vi beskrevet fremgangsmåder til replikativ og DNA-ødelæggelse induceret aldring anvendelse af humane diploide fibroblaster. Desuden er teknikker til kvantificering protein og mRNA-niveauer af forskellige senescens-associerede proteiner indbefattet, samt farvning for SA-β-gal og for DNA-skade markør γ-H2AX. Disse protokoller kan i vid udstrækning anvendes til at vurdere aldrende fænotyper både in vitro og in vivo, selvom der findes mange advarsler til karakterisering senescens in vivo 20. Andre celler kan udtrykke ældede markører, selv om de ikke er aldrende celler. For eksempel kan celler, såsom osteoklaster og makrofager har højere niveauer af β-gal-aktivitet 32, 33. Desuden har mange kræftceller opreguleret P16 NK4a 34. Celler kan også akkumulere DNA-skade (fx γ-H2AX foci) og ikke være aldrende. SASP faktorer kan også opreguleres afforskellige normale fysiologiske eller patologiske tilstande, som måske eller måske ikke involverer aldrende celler. Derfor bør multiple senescens markører anvendes, især ved vurdering af senescens in vivo.

Selv blev fundet aldrende celler øges i normale aldring væv mere end 20 år siden 4, er det først nu, at vi er fuldt værdsætter de mange roller, som senescentceller spille i både normale væv homeostase og i patologiske tilstande. Den nylige beskæftigelse af musemodeller at eliminere p16 INK4a -positive aldrende celler har tilladt forskere til mere klart og præcist værdsætter rolle senescentceller i væv og organer 35, 36, 37. Disse modeller har afsløret, at aldrende celler bidrager til et væld af aldersrelaterede sygdomme, tumorigenese, og mus levetid 35 </ sup>, 36, 37. På baggrund af disse seneste opdagelser og validering af vigtigheden af ​​aldrende celler i fysiologi, er tiden moden til mere forskning på disse specifikke celler. For eksempel undersøgelser anvender strategier til terapeutisk fjerne aldrende celler eller til at forsinke ældning kunne være gavnligt for både healthspan og levetid undersøgelser.

For nylig vores laboratorium fandt, at metformin, et lægemiddel almindeligvis anvendes til behandling af type 2-diabetes mellitus, aftager cellulær aldring 38. Da metformin i øjeblikket er ved at blive foreslået som en anti-aging terapi og har anti-cancer egenskaber 39, 40, vil det være interessant i fremtiden at undersøge, om dette stof, eller andre aldrende interventioner, påvirker sundhedsresultater ved at modulere cellulær aldring.

Protokollerne vi diskuterer her er almindelige og udbredte enccepted teknikker til at vurdere den aldrende fænotype. For celler dyrket in vitro, er det vigtigt at overvåge celleforandringer fra en spindel-lignende til et fladtrykt morfologi for at sikre, at cellerne er senescent (Se figur 1 og 2). Hvis celler ikke er positive for SA-β-gal eller andre markører beskrevet her, vurdere ældning ved højere celle PDL'er (for replikativ senescens) eller på en forøget tid efter DNA beskadigelse-induceret aldring. Desuden kan disse protokoller skal optimeres til forskellige celletyper. Til vurdering SASP proteinniveauer er det kritisk at fjerne serum fra cellemediet, da dette vil medføre høje baggrundsniveauer i ELISA eller proteinarrays. Derfor holde dette i tankerne, når designe eksperimenter, da det ikke kan være ideel til samtidig vurdering af flere markører.

Farvning for SA-β-gal, som beskrevet her, er begrænset af det faktum, at den kræver fiksering af cellerne.Desuden har cellekonfluens vist sig at påvirke SA-β-gal-aktivitet. Protokoller er blevet udviklet til at vurdere SA-β-Gal-aktivitet ved anvendelse af et fluorogent substrat for β-gal-aktivitet, som giver mulighed for kvantificering af denne markør i levende celler under anvendelse af flowcytometri 41, 42, 43. SA-β-gal-aktivitet kan også måles i cellelysater under anvendelse af en kemiluminescerende metode 44. Derudover kan γ-H2AX også måles under anvendelse af forskellige andre metoder, herunder flowcytometri eller immunblotning af cellelysater 45.

Det skal bemærkes, at SAHF dannelse er cellelinje afhængige og er for det meste forbundet med onkogen-induceret aldring 20, 30, 46. Derfor kan SAHF ikke være til stede i alle senescens modeller. Nytten afSAHF som en aldrende markør i musemodeller kan også begrænses ved, at SAHF generelt ikke observeret i muse aldrende celler 30, 46, 47. Her blev antistoffer mod H3K9Me2 anvendes, men der kan anvendes andre molekylære markører for SAHF, herunder macroH2A, højmobilitetsgruppe A (HMGA) proteiner, og tri-methylerede lysin 9 histon H3 (H3K9Me3) og bundne HP1 proteiner. Derudover kan chromatin immunofældningsassays anvendes til at vurdere histon mærker eller sammenslutningen af ​​kromatin bindingsproteiner til E2F målgener.

Man skal være opmærksom på, at der er forskellige begrænsninger for at karakterisere ældning, herunder heterogenitet for markører og det faktum, at disse markører ikke udelukkende udtrykkes i aldrende celler. Multiple (almindeligvis 2 - 3) markører bør anvendes til at vurdere senescens, herunder markører ikke er beskrevet her. Fx DNA-SCARS, telomerskade, og / eller DNA-skader signalering kan også kvantificeres. Desuden som senescens og navnlig SASP fænotype, for nylig er blevet vist, at blive påvirket af den specifikke stressor eller skade, der inducerer senescens 11, 12, 13, er det vigtigt at vurdere flere markører i hver eksperimentel paradigme.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Denne undersøgelse blev støttet af Intramural forskningsprogram af National Institutes of Health, National Institute on Aging. Forfatterne vil gerne takke Myriam Gorospe og Kotb Abdelmohsen for mange nyttige diskussioner om ældning og Kotb Abdelmohsen til også kritisk læsning af manuskriptet. Vi takker også vores laboratorium medlemmer, især Douglas Dluzen til kritisk læsning af manuskriptet.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Teknikker til at fremkalde og kvantificere cellesenescens
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter