Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Technieken voor het induceren en te kwantificeren Cellulaire senescentie

doi: 10.3791/55533 Published: May 1, 2017

Summary

Cellular veroudering, de onomkeerbare toestand van de celcyclus, kan worden geïnduceerd door verschillende cellulaire stress. Hier beschrijven we protocollen bij cellulaire veroudering en methoden ertoe te brengen markers van veroudering te beoordelen.

Abstract

In reactie op cellulaire stress of beschadiging, kan woekerende cellen van een specifiek programma dat een toestand van langdurige celcyclus initieert, de zogenaamde cellulaire veroudering veroorzaken. Accumulatie van verouderde cellen optreedt met organismal veroudering en door voortdurende kweken in vitro. Verouderde cellen beïnvloeden vele biologische processen, waaronder embryonale ontwikkeling, weefselherstel en regeneratie, tumor onderdrukking, en veroudering. Kenmerken van verouderde cellen omvatten, maar zijn niet beperkt tot, verhoogde senescentie-geassocieerde β-galactosidase-activiteit (SA-β-gal); p16 INK4A, p53 en p21 niveaus; hogere niveaus van DNA schade, waaronder γ-H2AX; de vorming van senescentie-geassocieerde Heterochromatine Foci (SAHF); en het verwerven van een senescentie geassocieerde fenotype secreet (SASP), een verschijnsel gekenmerkt door de secretie van een aantal pro-inflammatoire cytokines en signaalmoleculen. Hier beschrijven we protocollen voor zowel replicatieve enDNA schade geïnduceerde senescentie in gekweekte cellen. Daarnaast hebben we aandacht technieken om de senescent fenotype monitoren met behulp van verschillende senescentie-geassocieerde markers, inclusief SA-β-gal, γ-H2AX en SAHF kleuring, en eiwit- en mRNA-niveaus van celcyclus regulatoren en SASP factoren kwantificeren. Deze werkwijzen kunnen worden toegepast voor de beoordeling van senescentie in diverse uitvoeringen en weefsels.

Introduction

Meer dan een halve eeuw geleden, Hayflick en collega's beschreven hoe getransformeerde cellen vermeerderen in cultuur, maar slechts voor een beperkte periode 1. Lange-termijn kweken van menselijke fibroblasten veroorzaakt de cellen te stoppen uitdijende; echter, waren zij metabolisch actief, en dit werd cellulaire veroudering genoemd. Veroudering kan nuttig zijn voor het remmen van tumorigenese, maar het kan ook schadelijk zijn, aangezien het verondersteld bij te dragen aan het verlies van regeneratieve capaciteit die zich voordoet bij het ouder 2, 3. Verouderde cellen bleken te accumuleren in weefsels mens van 4 en zijn betrokken bij een aantal biologische processen, waaronder embryonale ontwikkeling, wondgenezing, weefselherstel, en leeftijdsgebonden ontsteking 2.

Continue passage van de cellen in de cultuur induceert replicatieve veroudering, die is gekoppeldom het natuurlijk verloop en genomische instabiliteit telomeer. Diverse cel onderstreept waaronder DNA schade en oncogenen, kunnen ook senescentie 3 veroorzaken. Veroudering aan andere oorzaken dan telomeerattritie factoren vaak stress geïnduceerde of voortijdige senescentie en afhankelijk van de p16 INK4A / Rb pathway 5 algemeen. Hoewel prolifererende ongetransformeerde cellen verschijnen typisch spindel vorm, kan verouderde cellen worden geïdentificeerd als zijnde bepaalde kenmerken, waaronder een vlak, groot morfologie en verhoogde senescentie geassocieerde β-galactosidase-activiteit (SA-β-gal) (figuren 1 en 2). Verouderde cellen accumuleren ook DNA- beschadiging merkers, waaronder γ-H2AX (figuur 3) 6, en mogelijk senescentie-geassocieerde heterochromatine foci (SAHF) (figuur 4) 7. Verouderde cellen hogere niveaus van celcyclus regulatoren, zoals p 16 (p16 INK4A) en / of p21 en p53 (Figuur 5) 8, 9. Bovendien hebben recente gegevens aangetoond dat verouderde cellen niet autonome effecten kunnen hebben door het afscheiden van een aantal pro-inflammatoire cytokines en chemokines genoemd senescentie-geassocieerde secretoir fenotype (SASP) 10. SASP hoewel dit verschijnsel kan van celtype tot celtype in het algemeen wordt aangetoond door een toename van Interleukine-6 ​​(IL-6), IL-8, granulocyt-macrofaag koloniestimulerende factor (GM-CSF), groei- gereguleerde α oncogen (GRO-α), en GRO-β, onder andere (figuur 6). De bijzondere stress of schade induceert senescentie kunnen ook invloed op de secretoire fenotype 11, 12, 13. SASP kan worden gedetecteerd door het meten van de niveaus van uitgescheiden eiwitten via ELISA of cytokine / eiwitarrayss = "xref"> 10 14. Hoewel posttranscriptionele mechanismen SASP eiwitniveaus 11, kan reguleren 15, 16, 17, veranderingen in mRNA-niveaus kunnen worden gedetecteerd in vele gevallen. Deze veranderingen zijn over het algemeen gevoeliger en eenvoudiger te kwantificeren dan eiwitgehalte metingen. Andere verouderend merkers kunnen ook worden beoordeeld, waaronder blijvende DNA-beschadiging nucleaire foci, genoemd DNA-segmenten met chromatine wijzigingen versterkende veroudering (DNA-SCARS) 18, en verschillende andere markers 3, 19, 20.

We beschrijven gebruikelijke technieken voor het induceren senescentie van cellen in kweek alsook voor het meten van verscheidene merkers van veroudering, met inbegrip SA-β-Gal, γ-H2AX, SAHF en het eiwit en mRNA van senescence-geassocieerde moleculen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. inducerende Replicatieve Veroudering

  1. Dooi weinig overgezette humane diploïde fibroblasten (bijvoorbeeld, WI-38 en IMR-90) of andere cellijnen.
    OPMERKING: Hier humane diploïde fibroblasten werden gebruikt, maar deze protocollen kunnen worden gebruikt voor senescentie in andere celtypen, zoals endotheelcellen, epitheelcellen of mesenchymale stamcellen bepalen. Kweekomstandigheden kunnen worden geoptimaliseerd voor verschillende celtypen gebruikt vanwege verschillende groeisnelheden en groeiomstandigheden.
    Opmerking: De cellen moeten prolifereren en een spindel morfologie (zie figuur 1 voor een schematische en figuur 2 voor voorbeelden). Idealiter zou de cellen een populatie Verdubbeling Level (PDL) van <30 hebben aan het begin van de experimenten om te voorkomen dat mogelijke replicatieve verouderde cellen.
    1. Bereken de PDL van de cellen met de volgende vergelijking PDL = log (Nf / N 0) / log2, waarin Nf het eindcelaantal en <em> N 0 is het oorspronkelijke aantal gezaaide cellen 21.
  2. Cultuur WI-38 cellen in Dulbecco's Gemodificeerd Eagle Medium (DMEM) aangevuld met 10% foetaal runderserum (FBS), 1% niet-essentiële aminozuren en 1% penicilline / streptomycine.
  3. Groeien IMR-90-cellen in DMEM aangevuld met 10% FBS en 1% penicilline / streptomycine.
  4. Alle cellen groeien bij 37 ° C en 5% CO 2. Continu groeien de cellen gesplitst om de 2-4 d wanneer de cellen bereikt ~ 70-80% confluentie. Monitor cel samenvloeiing met behulp van een lichtmicroscoop. Vermijd cellen met hogere confluentie, omdat dit celgroei als gevolg van contact inhibitie beïnvloeden.
  5. Bewaken van de cellen onder een lichtmicroscoop het morfologische uiterlijk van verouderde cellen (zie figuren 1 en 2) en wanneer er geen verandering in de PDL van de ene naar de volgende subkweek.

2. DNA-schade geïnduceerde senescentie

    (bijvoorbeeld, WI-38, IMR-90, of een ander celtype) op een dun dichtheid (dwz ~ 300.000 cellen / 6 cm schaal) in een geschikt gerecht voor het soort analyse (een 6 cm schaal voor eiwithoudende / RNA markers of 6 putjes voor SA-β-gal kleuring). Gebruik vroege passage cellen die jonge en prolifererende (<30 PDL) zijn en plaat ze zodanig dat de cellen ongeveer 50-60% confluent de volgende dag.
  1. Verwijder het groeimedium met een glazen pipet verbonden met een vacuümbron en was de cellen door het toevoegen van 1 x met fosfaat gebufferde zoutoplossing (PBS). Herhaal deze procedure voor een totaal van twee wasbehandelingen. Voeg een dun laagje PBS (~ 750 ul voor een 6 cm schaal) voor zowel een "mock" behandelde en voor ioniserende straling (IR) behandelde aandoening.
  2. Met een gamma bestralingsinrichting cellen bloot te stellen aan een enkele dosis van 10 Gray (Gy) IR; dit is een typisch exposure voor de meeste cellijnen. In een kap, verwijder de PBS en vervangen door kweekmedium. Alternatief behandelen cellen met bleomycin bij 20 ug / ml gedurende 2 uur.
  3. Verander het medium op de cellen elke 48 -7 2 ​​uur en splitsing van de cellen indien nodig.
  4. Bewaken van de cellen onder een lichtmicroscoop morfologische veranderingen (zie figuur 1 voor een schematische en figuur 2 voor representatieve celbeelden) en test op verouderde markers 7-10 d na de behandeling IR.
    Opmerking: Dit protocol beschrijft senescentie geïnduceerd door IR. Veroudering kan ook worden geïnduceerd door andere belastingen, zoals bleomycine (zie hierboven voor aandoeningen), H2 O 2 22, 23, 24 chemotherapeutische geneesmiddelen, sigarettenrook 25, transformerende groeifactor (TGF) -β1 26, 27, en andere methoden 21 , 28, 29.

3. Kleuring CelLS Senescentie-geassocieerde β-galactosidase

  1. Voorafgaand aan kleuring, onderzoekt de cellen onder een lichtmicroscoop om de morfologische veranderingen te controleren.
    OPMERKING: verouderde cellen worden typisch vergroot en plat, in tegenstelling prolifererende cellen, die een spil morfologie (zie figuur 1 voor een schematische en figuur 2 voor representatieve resultaten) hebben. Prolifererende cellen kan worden toegepast als een negatieve controle, en cellen behandeld met IR of een ander DNA beschadigend middel (zie hoofdstuk 2) kan worden gebruikt als positieve controles.
  2. Kwantificeren SA-β-gal-activiteit onder toepassing van reagentia van een commerciële kit (zie Materials Table). Ontdooien alle reagentia en breng ze naar kamertemperatuur opwarmen door ze tot 37 ° C.
    1. Bereken de hoeveelheid kleuroplossing en fixeeroplossing nodig.
      OPMERKING: Typisch wordt een 1 ml volume is voldoende voor een putje in een 6-wells plaat. De verschillende plaat maten kunnen worden gebruikt, maar een 6-wells plaat grootte is well geschikt om een ​​bepaling uit te voeren in drievoud voor elke conditie. Deze dichtheid verschaft gewoonlijk een voldoende aantal cellen per veld te tellen zonder een overmaat aantal cellen.
    2. Verdun de kleuroplossing 1:10 met gedestilleerd water.
    3. Verdun de fixeeroplossing 1:10 met gedestilleerd water.
    4. Vormen een 20x voorraadoplossing van X-gal (5-broom-4-chloor-3-indolyl-β-D-galactopyranoside) in N, N- dimethylformamide (DMF, bijvoorbeeld 20 mg X-gal in 1 mL DMF). Om het gebruik van de kit te maximaliseren, afmeten van X-gal aan de voor elke assay hoeveelheid en voeg de berekende hoeveelheid DMF op te lossen. Alternatief bewaar de stockoplossing bij -20 ° C in een licht-beschermde buis gedurende één maand. Uitsluitend polypropyleen (opaak) buizen voor het verdunnen en opslaan van X-gal oplossing.
    5. Bereid β-gal kleuroplossing: 930 pl 1x kleuroplossing, 10 pl kleuring supplement A, 10 pl kleuring supplement B, en 50 pl 20 mg / ml X-gal in DMF. Maak een master mix afhankelijk van hoeveel putten moeten worden gekleurd.
  3. Verwijder voorzichtig het medium van de cellen met behulp overdracht pipet of equivalent.
  4. Voorzichtig te wassen de cellen eenmaal met kamertemperatuur 1x PBS.
  5. Voeg 1 mL 1 x fixeeroplossing aan elk putje en incubeer gedurende 10 - 15 min bij KT.
  6. Verwijder de fixeeroplossing met een transferpipet.
    OPMERKING: De fixerende oplossing (1x) bevat 2% formaldehyde en 0,2% glutaaraldehyde en moet worden afgevoerd als gevaarlijk afval volgens de aanbevelingen van de laboratoriumveiligheid kantoor.
  7. Voorzichtig te wassen de cellen tweemaal met 1x PBS.
  8. Verwijder de PBS volledig toevoegen 1x β-gal kleuroplossing aan de putjes (1 ml / putje van een 6-wells plaat). Bedek de plaat volledig met aluminiumfolie en incubeer gedurende 24-48 uur in een 37 ° C incubator (bij voorkeur in afwezigheid van CO 2, omdat dit de pH van de buffer kan verlagen en beïnvloeden kleuring).
    1. Controleer de cellen op 24 uur voor het kleuren, en als de vlek is te licht, incubeer gedurende nog eens 24 uur.
  9. Na de incubatietijd, verwijder de β-gal oplossing en vervangen met 1x PBS.
    LET OP: Deze stap verwijdert een deel van de achtergrondkleur wanneer imaging en voorkomt ook gevaarlijke morsen van de X-gal oplossing.
    LET OP: Gooi de β-gal oplossing goed, in overeenstemming met de aanbevelingen van de veiligheid laboratorium kantoor.
  10. Onderzoek de cellen op een lichtmicroscoop met een aangrenzende camera met een 10x objectief of hoger; SA-β-gal-positieve cellen wordt blauw. Het verwerven van de gewenste aantal beelden voor het experiment. Het tellen van het percentage SA-β-gal-positieve cellen verwerven het juiste aantal beelden (> 5) voor het kwantificeren per putje. Zorgen dat de beelden elkaar niet overlappen van verschillende gezichtsvelden in elk putje.
  11. Tel het aantal SA-β-gal-positieve (blauw) cellen tegen het aantal totale cellenom het percentage van SA-β-gal-positieve cellen te berekenen. Count> 100 cellen per conditie.
    OPMERKING: Representatieve foto's kunnen ook worden gebruikt voor de cijfers. Merk op dat de cel confluentie is van cruciaal belang als het tellen van cellen, zoals te veel cellen maken het moeilijk om elke cel te differentiëren en te weinig kan niet een voldoende aantal cellen voor kwantificering en statistieken. Foto's voor cijfers voor publicatie zijn op de beste resolutie als deze is opgeslagen als .tiff-bestanden, hoewel de JPEG-bestanden zijn ook geschikt. Afbeeldingen in kleur zou moeten zijn 300 dpi.

4. kleuring Cellen voor γ-H2AX

  1. Plaat de cellen van de punten 1 of 2 op glazen dekglaasjes in een 24-wells plaat.
  2. De volgende dag, was de cellen met 1x PBS. Roer voorzichtig als verouderde cellen niet goed aan dekglaasjes en kan gemakkelijk tijdens wassen worden verwijderd. Alternatief direct de cellen herstellen zonder wassen.
  3. Verwijder de PBS en zet de cellen met vers bereide 3,7% formaldehyde in PBS gedurende10 min bij kamertemperatuur.
  4. Verwijder de oplossing en permeabel de cellen met 0,2% Triton X-100 in PBS gedurende 10 min.
  5. Verwijder de oplossing en blok 5% FBS in PBS gedurende 2 uur bij kamertemperatuur.
  6. Incuberen met anti-fosfo-γ H2AX (Ser139) en FITC-conjugaat in 5% FBS / PBS gedurende 2 uur bij 37 ° C of O / N bij 4 ° C. Beschermen tegen licht.
  7. Was 3 - 6x met PBS bij 37 ° C gedurende in totaal 30 - 60 min.
  8. Kleuring met DAPI (verdund 1: 15000 in PBS) gedurende 10 minuten bij kamertemperatuur.
  9. Was 3x met PBS.
  10. Snel wassen met water om de zouten te verwijderen en monteren dekglaasje op een glasplaatje behulp 3-5 pi van antifade reagens. Als alternatief gebruikt een bevestigingsoplossing met DAPI.
  11. Laten drogen O / N en breng de gekleurde cellen op een fluorescerende of confocale microscoop met een 63x objectief of hoger.
  12. Kwantificeren γ-H2AX foci door een van twee methoden die hieronder worden beschreven. Scoren voor hetzij protocol oog met behulp van een fluorescentiemicroscoop. Idealiter onsea confocale microscoop. Take Z-secties en condenseren in een enkel vlak om alle detecteerbare foci zichtbaar (representatieve beelden van γ-H2AX kleuring in prolifererende en verouderde cellen worden getoond in Figuur 3). Tel de brandpunten op het oog met behulp van imaging software; in het algemeen, ~ 100-200 kernen zijn voldoende voor het tellen.
    1. Het percentage cellen die γ-H2AX-positieve foci kwantificeren hebben, tellen elke cel die ten minste één Focus zichtbaar en delen door het totaal aantal DAPI gekleurde kernen heeft.
    2. Om het aantal γ-H2AX foci kwantificeren, de telling van de γ-H2AX foci per cel.
      OPMERKING: De niveaus van γ-H2AX kan variëren naargelang de specifieke stress of schade geïnduceerde senescentie.

5. kleuring Cellen voor SAHF Markers

OPMERKING: Menselijke verouderde cellen hebben vaak kerngebieden van gecondenseerd DNA / chromatine. In verouderde cellen, deze heterochromatic regioMen denkt dat de expressie van proliferatie bevorderen van genen, zoals E2F familieleden remmen. SAHF kan worden gevisualiseerd door de reorganisatie van DAPI; door de aanwezigheid van heterochromatine-geassocieerde histon markeringen, inclusief di- en tri-methylatie van histon H3 op Lys9 (H3K9Me2 en H3K9Me3); en door chromatine-reorganisatie eiwitten, waaronder HP1 heterochromatine-eiwit 1 (HP1), HIRA (histon repressor A) en ASF1a (anti-silencing functie-1a) tot 30 chromatine. We hebben ervoor gekozen om een oncogen-geïnduceerde senescentie model (OIS) te gebruiken, omdat SAHF is meer prominent in OIS modellen 30. IDH4 cellen prolifereren bij aanwezigheid van dexamethason door de aanwezigheid van SV40 grote T antigen maar worden verouderde na verwijdering van dexamethason uit het medium 31. SAHF kan worden gedetecteerd door DAPI kleuring en door kleuring met antilichamen tegen de hierboven genoemde specifieke merkers. We beschrijven hier DAPI en H3K9Me2 kleuring voor de visualizatIon van SAHF in cellen 28.

  1. Groeien IDH4 cellen in DMEM aangevuld met 10% FBS, 1% penicilline / streptomycine en 1 ug / ml dexamethason. Senescentie te induceren, verwijder de dexamethason en verander het medium zodanig dat deze kool gestript FBS; na een groei van ~ 10 dagen in dit nieuwe medium, IDH4 cellen worden senescent 31.
  2. Plaat IDH4 cellen of cellen van de punten 1 of 2 hierboven beschreven op glazen dekglaasjes in een 24-wells plaat.
  3. De volgende dag, was de cellen met 1x PBS. Roer voorzichtig als verouderde cellen niet goed aan dekglaasjes en kunnen gemakkelijk worden verwijderd tijdens wasbeurten. Als alternatief direct vast cellen zonder te wassen.
  4. Verwijder de PBS en zet de cellen met vers bereide 3,7% formaldehyde in PBS gedurende 10 minuten bij kamertemperatuur.
  5. Was de cellen 3 maal met 1x PBS.
  6. Verwijder de oplossing en permeabel de cellen met 0,2% Triton X-100 in PBS gedurende 5 minuten.
  7. Was de cellen met 1xPBS. Verwijder de PBS en blokkeren de dekglaasjes door toevoeging van blokkerende buffer die 3% BSA (w / v) in PBS gedurende 5 minuten bij kamertemperatuur. filter altijd oplossingen met BSA vóór gebruik om deeltjes te verwijderen.
  8. Verwijder de blokkerende buffer en incubeer de cellen met primaire antilichamen tegen SAHF merkers zoals anti-H3KMe2 antilichamen (Figuur 4, zie Materialen tabel voor details). Verdun de antilichamen in blokkeerbuffer en incubeer gedurende 1-2 uur bij kamertemperatuur.
  9. Verwijder het primaire antilichaamoplossing en was de dekglaasjes 3 maal met 1% (v / v) Triton X-100 in PBS.
  10. Verdun het secundaire antilichamen in blokkeerbuffer (Materials Table) en incubeer gedurende 1 uur bij kamertemperatuur. Beschermen tegen licht.
  11. Was de cellen tweemaal met 1x PBS. Kleuring met DAPI (verdund 1: 15000 in PBS, zie Materialen Table) gedurende 10 minuten bij kamertemperatuur.
  12. Was de dekglaasjes 3x met 1x PBS.
    1. Snel wassen met water om de zouten te verwijderennd zet elk dekglaasje op een glasplaatje behulp 3-5 pi van antifade reagens. Als alternatief gebruikt een bevestigingsoplossing met DAPI.
    2. Laten drogen O / N en breng de gekleurde cellen op een fluorescerende of confocale microscoop met een 63x objectief of hoger (zie Representatieve resultaten in Figuur 4). Kwantificeren SAHF zoals beschreven in Sectie 4.
      OPMERKING: isotype controle primaire antilichamen of geen primair antilichaam (dwz secundaire alone) worden gebruikt als negatieve controle voor immunofluorescentie kleuring.

6. Analyse Senescentie-geassocieerde eiwitten door immunoblotting

OPMERKING: De verouderde fenotype gekenmerkt door de opregulatie van celcyclus regulatoren, zoals p16 INK4A, p21 en p53. Dit protocol zal het kwantificeren van de niveaus van deze eiwitten in cellysaten beschrijven. Deze technieken kunnen worden gebruikt om veroudering te beoordelen geïnduceerd met behulp van een verscheidenheid aanwerkwijzen 21, 28, 29.

  1. Induceert cellulaire senescentie, zoals beschreven in de punten 1 en 2 of met een andere methode 21, 28, 29. Analyseren cellulaire senescentie tellers, plaat cellen in 6 cm schalen en zowel het eiwit en het RNA tegelijkertijd geanalyseerd (zie hoofdstuk 7. RNA isolatie instructies).
  2. Verwijder de celcultuur medium. Zet de cellen op een dienblad met ijs.
    1. Was de cellen 2 maal met koude 1x PBS. Kantel het gerecht om ervoor te zorgen dat alle PBS wordt afgezogen teneinde een zo nauwkeurig in termen van de volumes die voor de procedure.
    2. Na afzuigen van de laatste wasbeurt PBS, voeg 200 ul koude 1x PBS (voor een 6 cm schaaltje) van de schaal. Schraap de cellen met behulp van een cel schraper.
    3. Pipetteer de cellen / PBS mengsel in een RNase-vrije buis voor RNA isolatie. Neem ongeveer 150 &# 181; l dit mengsel en Pipetteer in een nieuwe buis. Deze hoeveelheid wordt gebruikt voor eiwitanalyse, dus zorg ervoor dat evenveel pipet uit elk buisje.
  3. Lyseren de cellen door toevoeging van 75-100 pl gemodificeerde 2x Laemmli monsterbuffer (60 mM Tris-HCl pH 6,8, 12,5% glycerol, 2% SDS, 5% β-mercaptoethanol (BME) en broomfenolblauw, kan worden gemaakt als een grote partij, in porties verdeeld en bewaard bij -20 ° C tot gebruik) of een equivalent monsterbuffer.
    1. Alternatief lyseren van de cellen in 75-100 pl lysisbuffer en centrifugeer bij 15.000 xg gedurende 10 min bij 4 ° C om de celresten te verwijderen. Verwijder het supernatant en pipet in een schone buis. Een eiwitbepaling volgens Bradford of een equivalent eiwit assay kan worden gebruikt op lysaten de gelijke belading van eiwit te garanderen.
      OPMERKING: Protein assays kan niet worden uitgevoerd op monsters gelyseerd in monsterbuffer.
    2. Zetten ~ 25 pl lysaat toevoegen aan 15 pl van 2x monsterbuffer. Pipet op en doewn in de monsterbuffer om de cellen te lyseren.
      OPMERKING: Volumes lysisbuffer of monsterbuffer kan worden aangepast afhankelijk van celconfluentie. Als het monster "kleverige" als gevolg van de nucleaire lyseren, voeg meer monster buffer of PBS te verdunnen. Monsters kunnen worden opgeslagen bij -20 ° C tot gebruik.
  4. Kook de monsters gedurende 5 minuten bij 95 ° C op een verwarmingsblok (of equivalente apparatuur) en load ~ 40 pi van gelyseerde monster in monsterbuffer op een 18% Tris-Glycine gel.
    Opmerking: Een gradiënt gel (4-15%) of 14% Tris-Glycine gel ook voldoende voor het detecteren van eiwitten met laag molecuulgewicht. Verschillende soorten acrylamide gels kunnen ook worden gebruikt, maar zorg ervoor dat de gels en het systeem geschikt voor het detecteren van eiwitten met laag molecuulgewicht.
    1. Bij het gebruik van 1 x loopbuffer bij een constante 100 V gedurende 20 minuten (via de stacking gel) en ~ 60 minuten bij 180 V. Controleer de gel zodat het kleurstoffront net wegvloeit of aan de onderkant van de gel, zodat laagmoleculaire gewicht eiwitten niun af van de gel.
  5. Breng de acrylamidegel naar een PVDF-membraan (voorgeweekt met 100% methanol te activeren). Als het doen van een natte overdracht, is slechts 1 uur nodig voor de overdracht (ten opzichte van de normale ~ 1.75 uur). Dienovereenkomstig aanpassen van de juiste overdrachtsysteem; met vooraf gekleurde molecuulgewichtmerkers kunnen helpen bij de beoordeling overdrachtsrendement.
  6. Wassen van het membraan in water. Gebruik een Ponceau vlek om te letten op de gelijke belading van monsters. Was de Ponceau af met water.
    1. Blokkeer het membraan in 5% vetvrije droge melk in TBST (50 mM Tris-HCl pH 7,5, 150 mM NaCl en 0,1% Tween-20) gedurende 1 uur bij kamertemperatuur of O / N bij 4 ° C onder roeren.
  7. Wassen blot eenmaal met TBST en geïncubeerd met primair antilichaam verdund in 5% melk TBST (zie Materialen Tafel voor verdunningen en antilichamen aanbevelingen) gedurende 1 uur bij kamertemperatuur.
  8. Voeren twee snelle wassingen met TBST en was daarna tweemaal op een schudder totaal ~ 30 min (~ 15 min elk wash).
  9. Incubeer met een secundair antilichaam gedurende 40 minuten bij kamertemperatuur. Herhaal stap 6.10.
  10. Incubeer met vers gemaakte Western blot substraat en de film ontwikkelen of te lezen op een chemiluminescentie reader.
  11. Probe immunoblot met p16 INK4A antilichamen eerst (Figuur 5). Strip de membraan door incuberen gedurende 15 min met water, 15 min met 0,2 N NaOH en 15 min met water. Ga verder met stap 6.9 met behulp van anti-p21 antilichamen.
  12. Strip de membraan onder toepassing van 62,5 mM Tris-HCl pH 6,8 en 2% SDS met 300 pl vers toegevoegde BME per 50 ml stripoplossing.
  13. Incubeer bij 50 ° C gedurende 30 minuten en was uitgebreid met TBS en vervolgens TBST. Probe met anti-actine of anti-GAPDH antilichamen voor eiwitten laden (Afbeelding 5 toont representatieve resultaten).
    LET OP: p53 niveaus kunnen ook worden beoordeeld op dezelfde membranen. Aangezien p53 een hoger molecuulgewicht wordt beter gescheiden op een lager percentage gel (bv

7. Analyse van de mRNA niveaus van senescentie Markers

OPMERKING: Bij het isoleren van RNA, waardoor het werk oppervlakken gereinigd met RNase verwijderingsoplossingen of een gelijkwaardig en de materialen zijn RNase-vrij.

  1. Met de cel / PBS mengsel uit stap 4.2, voeg 1 ml RNA extractieoplossing en vortex gedurende 30 seconden (er mogen geen zichtbare klonten of celafval).
  2. Voeg 200 ul chloroform en schud krachtig gedurende 15 seconden.
  3. Centrifuge bij maximale snelheid (> 15.000 x g) gedurende 15 min bij 4 ° C.
  4. Verwijder ~ 400 pi van de bovenste RNA waterlaag en pipet in een nieuwe microfugebuis.
  5. Voeg 400 ul isopropanol (1: 1 met het totale volume waterige laag gepipetteerd in de vorige stap) en 4 pl precipitant aan het RNA-laag.
  6. Centrifugeer 15-30 minuten bij maximale snelheid (> 15.000 x g) en 4 ° C tot de RNA pellet.
  7. Verwijder het supernatant en voeg 1 ml 75% ijskoude ethanol.
  8. Centrifugeren gedurende 1 minuut bij maximale snelheid (> 15.000 x g) en 4 ° C.
  9. Verwijder het supernatant en centrifugeren gedurende 1 minuut bij maximale snelheid (> 15.000 x g) en 4 ° C.
  10. Pipet zo veel mogelijk vloeistof en drogen gedurende 2 min.
  11. Resuspendeer in 10 ui 10X DNase-buffer, 85 pi H2O en 5 ul DNase 1.
  12. Incubeer bij 37 ° C gedurende 30 minuten.
  13. Voeg 200 ul NT2-buffer (50 mM Tris-HCl pH 7,4, 150 mM NaCl, 1 mM MgCl2 en 0,05% Nonidet P-40) en voeg 300 ul van de benedenlaag zuur fenol-CHCl 2.
  14. Vortex gedurende 1 minuut en centrifugeer bij kamertemperatuur gedurende 5 minuten bij maximale snelheid (> 15.000 x g).
  15. Verzamel 250 pi van de bovenste laag RNA (2 x 125 pl) 25pl 3 M natriumacetaat pH 5,2, 625 pl 100% ijskoude ethanol en 5 pi neerslagmiddel. Meng goed en precipiteren O / N bij -20 ° C.
  16. De volgende dag, mengen en centrifugeren op maximale snelheid (> 15.000 x g) en 4 ° C gedurende 30 min en gooi het supernatant.
  17. Herhaal stap 6,8-6,11.
  18. Resuspendeer de pellet in 12 ul nuclease-vrij water en bewaar bij -80 ° C tot gebruik.
    OPMERKING: Andere RNA-isolatie procedures en kits kunnen ook worden gebruikt.
  19. Voeren reverse transcriptie met willekeurige hexameren en SSII reverse transcriptase volgens het protocol van de fabrikant.
    OPMERKING: Gezien de lage hoeveelheid RNA geïsoleerd uit verouderde cellen, is het het beste om alle RNA (12 pl) gebruikt voor reverse transcriptie synthese. Als alternatief kan RNA worden gekwantificeerd met een spectrofotometer, en gelijke hoeveelheden RNA kan worden gebruikt voor reverse transcriptie.
  20. Analyseer de mRNA niveaus met behulp van real-time kwantitatieve qPCR (RT-qPCR) amplificatie en SYBR-groene PCR master mix met genspecifieke primers.
    1. Zoals in een typische RT-qPCR reactie Verdun het cDNA 01:30 (in RNase / DNase-vrij water) en voeg 3 pi aan de real-time plaat met 96 putjes nauwkeurigheid te verbeteren pipetteren. Bereid een reactiemengsel master mix van genspecifieke forward en reverse primers (2,5 uM concentratie, voeg 5 ul / reactie), SYBR-groene PCR mix (6,25 ul / reactie; gebruiken minder dan aanbevelingen van de fabrikant) en 5,75 pl RNase / DNase-vrij water voor een uiteindelijk reactievolume van 20 pi (17 pl primers / SYBR-groen / water en 3 pl cDNA).
    2. Uitvoeren van RT-qPCR amplificatie onder gebruikmaking van een real-time PCR machine; volgen protocol van de fabrikant.
      LET OP: Een lijst van gevalideerde menselijke vooruit en achteruit real-time primers is te vinden in tabel 1. Deze genen omvatten SASP eiwitten en andere senescentie-geassocieerde markers en / of genen. Representatieve resultaten van IR-geïnduceerde senescentie wordt in

8. kwantificeren SASP Protein Levels

  1. Induceert senescentie behulp afdelingen 1 of 2 of met een andere methode. Plaat de cellen op 6 of 10 cm platen, zoals hierboven (~ 250.000 cellen / 6 cm plaat of ~ 650.000 / 10 cm plaat) beschreven.
  2. Hetzij met cellen 10 d na de IR behandeling of replicatieve verouderde cellen (en geschikte controlecellen), driemaal wassen van de cellen met 1x PBS en voeg serumvrij medium met antibiotica in een klein volume (2,5 ml 6 cm of 5 mL 10 cm).
  3. Incubeer overnacht bij 37 ° C en 5% CO2 in een weefselkweek incubator. De volgende dag, verzamel het medium en het in een conische buis op ijs.
  4. Was de cellen 2x met PBS en voeg 1 ml trypsine (een 6 cm schaaltje). Tel de cellen met behulp van een hemocytometer om later de concentraties aanpassen aan celaantal.
  5. Centrifugeer het medium gedurende 5 minuten bij 300 x g.
  6. Filter het medium onder gebruikmaking van een 0,45 urn spuitfilter.
  7. Aliquot het medium en bevriezen bij -80 ° C tot gebruik of assay direct via ELISA of gelijkwaardige assays.
  8. Bereken het aantal cellen / ml concentratie door de totale celaantal / volume medium verzameld.
  9. Voer een geschikte enzymgekoppelde immunosorbent assay (ELISA) volgens de instructies van de fabrikant. Zie Materialen tabel voor de aanbevolen ELISA kits voor het testen op IL-6, IL-8, GROa, en andere cytokinen / chemokinen (Figuur 6B).
  10. Opdat de factoren die gemeten binnen het lineaire traject van de ELISA kit, maakt verdunningen van het ouder wordende celmedium vergelijking met de prolifererende celmedium. Vertegenwoordigen deze verdunningen en het volume bij de berekening van IL-6. De hoeveelheid IL-6 afgescheiden per cel per dag te verkrijgen, berekent de IL-6 die verkregen uit de set (in pg) per verdund celconcentratie per ml (frOM stap 7.8).
    NB: Andere methoden, zoals cytokine-arrays kunnen worden gebruikt om eiwitniveaus SASP detecteren en kan geschikt zijn voor het screenen van een groot aantal factoren SASP. De eiwitniveaus van SASP factoren kunnen variëren op basis van de tijd na senescentie inductie, het celtype of het type geïnduceerde senescentie.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figuren 2-6 tonen representatieve resultaten van SA-β-gal kleuring; kleuring op γ-H2AX en SAHF; beoordeling van eiwitniveaus van p16 INK4A, p21 en p53; en mRNA en eiwitniveaus van ouder wordende-geassocieerde moleculen. Verhoogde SA-β-gal kleuring optreedt met replicatieve en DNA-schade geïnduceerde senescentie. Let er ook op de morfologische veranderingen die optreden bij veroudering. Cellen worden vergroot en stabiel in vergelijking met de spil verschijnen prolifererende fibroblasten. Voor deze experimentele paradigma werden cellen gekleurd en RNA / eiwit geïsoleerd 7 dagen na blootstelling aan IR. Robuustere resultaten kan plaatsvinden door iets langer na blootstelling IR (dwz 10 d). Voorwaarden moeten worden bepaald voor elke conditie en experimentele opstelling. Deze resultaten zijn representatief en deze markers kunnen ook worden gedetecteerd wanneer senescentie geïnduceerd met andere methoden.

figuur 6, zijn gennamen vermeld evenals op CXCL1 (GROa), CXCL2 (GROP) en CB 2. (GM-CSF). De opregeling van mRNA niveaus van sommige, maar niet alle, van de SASP factoren werden na IR geïnduceerde senescentie bij WI-38 cellen. Andere senescentie-geassocieerde mRNA, waaronder CDKN1A (p21 codeert) en CDKN2A (p16 codeert INK4A) werden opgereguleerd. Andere mRNA (EDN1 en ANKRD1) zijn ook opgenomen en eerder is aangetoond dat hoger in verouderde cellen 15. Primers worden in tabel 1.

Figuur 1
Figuur 1: prolifererende en Ouder wordende fibroblasten. Schematisch prolifererende (links) en verouderde (rechts) fibroblasten. Voorbeelden van senescentie inductoren wordt in yellow vak. Veroudering is geassocieerd met hogere niveaus van de vermelde merkers. SA-β-gal, senescentie-geassocieerde β-galactosidase-activiteit; SASP, senescentie-geassocieerde secretoire fenotype; SAHF, senescentie-geassocieerde heterochromatine brandpunten; DDR, DNA-schade reactie. Klik hier om een grotere versie van deze afbeelding te bekijken

Figuur 2
Figuur 2. Morfologische Kenmerken en Verhoogde SA-β-gal activiteit van verouderde cellen. WI-38 cellen, hetzij prolifererende "jonge" (PDL 27), replicatieve verouderde (PDL 40), of die worden blootgesteld aan ioniserende straling (IR), werden gekleurd voor SA-β-gal-activiteit. IMR-90-cellen, hetzij prolifererende "jonge" (PDL 30), replicatieve verouderde (PDL 52), of die worden blootgesteld aan ioniserende straling (IR) werden stained voor SA-β-gal-activiteit. Secties 1-2 beschrijven inducerende replicatieve en DNA-schade geïnduceerde senescentie, en sectie 3 wordt uitgelegd kleuring voor SA-β-gal. Cellen werden gekleurd 7 dagen na IR. Con, controle. Schaalstaaf = 50 urn. Klik hier om een grotere versie van deze afbeelding te bekijken.

figuur 3
Figuur 3. Meer γ-H2AX Foci in verouderde cellen. WI-38 cellen, ofwel delende "jonge" (PDL 30) of replicatieve verouderde (PDL 53), werden gefixeerd en gekleurd met anti-γ-H2AX antilichamen en DAPI. Let op de toename van het aantal γ-H2AX foci in verouderde cellen. Beelden werden verkregen op een confocale microscoop. Z-secties werden genomen, en de maximum intensiteitsprojectie werd gebruikt om een ​​enkel vlak te verkrijgen tot alle detec visualiserentable brandpunten. Schaalstaaf = 20 urn. Klik hier om een grotere versie van deze afbeelding te bekijken.

figuur 4
Figuur 4. Fluorescente kleuring van SAHF in verouderde cellen. (A) prolifererende WI-38 cellen (PDL 27) werden niet behandeld of blootstelling aan ioniserende straling (IR). Na 10 dagen werden de cellen gekleurd met DAPI te visualiseren SAHF (merk dichte / punctata DAPI kleuring IR-behandelde cellen) (B) IDH4 werden gekweekt in aanwezigheid van dexamethason (prolifererende) of houtskool gestript FBS senescentie te induceren ( senescent). Na 10 d werden de cellen gekleurd met antilichamen tegen H3K9Me2 en DAPI. Beelden werden verkregen op een confocale microscoop. Z-secties werden genomen, en de maximum-intensiteitsprojectie werd gebruikt om een ​​enkel vlak te verkrijgenbeeld. Prolifererende cellen (A) en (B) diffuus DAPI kleuring, terwijl verouderde cellen hebben puntvormige DAPI kleuring. In (B), controle cellen diffuus, zeer lichte kleuring voor H3K9Me2, terwijl H3K9Me2 kleuring robuuster en colokaliseert met DAPI gekleurde foci in verouderde cellen. Schaalstaaf = 20 urn. Klik hier om een grotere versie van deze afbeelding te bekijken.

figuur 5
Figuur 5. Kwantificering van senescentie-geassocieerde eiwitten. Eiwit werd geïsoleerd uit hetzij prolifererende "jonge" (PDL 30) IMR-90 cellen (-) of IMR-90-cellen die werden blootgesteld aan 10 Gy ioniserende straling (IR). Het medium werd elke 48 uur en de cellen werden gelyseerd 7 dagen na IR. Monsters werden geanalyseerd door SDS-PAGE, immunoblotting met anti-p16 INK4A Antibomatrijzen en opnieuw gesondeerd met anti-p21 en anti-p53-antilichamen. GAPDH werd gebruikt als een eiwit ladingcontrole. Klik hier om een grotere versie van deze afbeelding te bekijken.

figuur 6
Figuur 6. Kwantificering van senescentie-geassocieerde mRNA's en eiwitten SASP. (A) RNA werd geïsoleerd uit hetzij prolifererende "jonge" (PDL 27 of 34) WI-38 cellen (-) of WI-38 cellen die waren blootgesteld aan 10 Gy ioniserende straling (IR). Het medium werd elke 48 uur en RNA-isolatie werd uitgevoerd 7 dagen na IR. RT-qPCR gebruikt om de niveaus van de aangegeven senescentie-geassocieerde mRNA met de genspecifieke primers in tabel 1 kwantificeren. 18S niveaus werden gebruikt voor normalisatie. De histogrammen geven de gemiddelde genormaliseerde to onbehandeld ± SEM van 5 onafhankelijke experimenten. (B) WI-38 cellen (PDL 26) werden blootgesteld aan 10 Gy IR; 10 d later werd het medium vervangen door serumvrij medium (zie hoofdstuk 7). Na 24 uur werd geconditioneerd medium verzameld en IL-6, IL-8 en GROa niveaus werden gekwantificeerd met behulp van ELISA assays. Het histogram vertegenwoordigt het gemiddelde ± SEM van 3 experimenten. * P <0,05 en *** P <0,001 door t-test van Student. Klik hier om een grotere versie van deze afbeelding te bekijken.

Human Primers Vooruit Omgekeerde
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (p21) ACCACT GAC GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CB 2. (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL-6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabel 1: RT-qPCR primers voor senescentie-geassocieerde mRNA. Voorwaartse en reverse primers voor RT-qPCR gebruikt SYBR-groene techniek aangegeven.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier hebben wij werkwijzen beschreven voor replicatieve en DNA-schade geïnduceerde senescentie waarbij menselijke diploïde fibroblasten. Bovendien kunnen technieken voor het kwantificeren van eiwit en mRNA-niveaus van verschillende senescentie-geassocieerde eiwitten zijn opgenomen, alsmede kleuring voor SA-β-gal en de DNA-schade merker γ-H2AX. Deze protocollen kan wijd om verouderende fenotypen zowel in vitro als in vivo te evalueren, hoewel veel restricties aanwezig voor het karakteriseren senescentie in vivo 20. Andere cellen kunnen verouderde markers te uiten, zelfs als ze niet verouderde cellen. Bijvoorbeeld cellen zoals osteoclasten en macrofagen hogere niveaus van β-gal-activiteit 32, 33. Daarnaast hebben veel kankercellen p16 INK4A 34 opgereguleerd. Cellen kunnen ook ophopen DNA-schade (bijv γ-H2AX foci) en niet verouderende zijn. SASP factoren kunnen ook worden opgereguleerd doorverschillende normale fysiologische of pathologische aandoeningen die al dan niet verouderde cellen omvatten. Daarom moet senescentie meerdere merkers worden gebruikt, in het bijzonder bij de beoordeling van senescentie in vivo.

Hoewel verouderde cellen bleken meer dan 20 jaar geleden 4 worden verhoogd in de normale veroudering van weefsels, het is nu pas dat we volledig waarderen de overvloed aan rollen die verouderde cellen spelen in zowel normale weefsel homeostase en in pathologische omstandigheden. De recente inzet van muismodellen voor p16 INK4A -positieve verouderde cellen te elimineren heeft onderzoekers om duidelijker toegestaan en nauwkeurig waarderen de rol van verouderde cellen in weefsels en organen 35, 36, 37. Deze modellen hebben ontdekt dat verouderde cellen bijdragen aan een veelheid van aan leeftijd gerelateerde pathologieën, tumorigenese en muis levensduur 35 </ sup>, 36, 37. Gezien deze recente ontdekkingen en de validatie van het belang van de verouderde cellen in de fysiologie, de tijd rijp is voor meer onderzoek naar deze specifieke cellen. Bijvoorbeeld, studies gebruik van strategieën om therapeutisch te verwijderen verouderde cellen of uitstellen senescentie voordelig voor zowel healthspan en levensduur studies zijn.

Onlangs heeft ons laboratorium bleek dat metformine, een geneesmiddel dat vaak gebruikt voor de behandeling van type 2 diabetes mellitus, vermindert cellulaire veroudering 38. Omdat metformine is momenteel als een anti-aging therapie wordt voorgesteld en heeft anti-kanker eigenschappen 39, 40, zal het interessant zijn in de toekomst om te ontdekken of dit geneesmiddel of andere veroudering interventies invloed op de gezondheidssituatie door het moduleren van cellulaire veroudering.

De protocollen die we hier bespreken komen vaak voor en op grote schaal eenccepted technieken om de ouder wordende fenotype te beoordelen. Voor cellen gekweekt in vitro, is het essentieel om cel verandert van een spindelachtig een afgeplatte morfologie te controleren om te verzekeren dat de cellen senescent (zie figuren 1 en 2). Indien cellen niet positief voor SA-β-gal of andere markers beschreven, beoordeelt senescentie bij hogere cel PDL (voor replicatieve senescentie) of een verhoogd na DNA-schade geïnduceerde senescentie. Bovendien kunnen deze protocollen moeten worden geoptimaliseerd voor verschillende celtypen. Voor controle SASP eiwitniveaus, is het essentieel om het serum uit het celmedium verwijderd, omdat deze hoge achtergrondniveaus in de ELISA of eiwitarrays veroorzaken. Daarom, daar rekening mee houden bij het ontwerpen van experimenten, omdat het niet ideaal voor het gelijktijdig beoordelen van meerdere markers kunnen zijn.

Kleuring op SA-β-gal, zoals hier beschreven, wordt beperkt door het feit dat de fixatie van de cellen vereist.Daarnaast is celconfluentie aangetoond beïnvloeden SA-β-gal-activiteit. Protocollen ontwikkeld voor SA-β-Gal-activiteit bepalen met behulp van een fluorogeen substraat voor β-gal-activiteit, die het mogelijk maakt de kwantificering van deze merker in levende cellen via flowcytometrie 41, 42, 43. SA-β-gal-activiteit kan ook worden gemeten in cellysaten met behulp van een chemiluminescentie methode 44. Bovendien kan γ-H2AX ook worden gemeten onder toepassing van verschillende andere werkwijzen, zoals doorstroomcytometrie of immunoblotting van cellysaten 45.

Opgemerkt wordt dat SAHF formatie cellijn afhankelijk en wordt meestal geassocieerd met oncogen geïnduceerde senescentie 20, 30, 46. Daarom kan SAHF niet aanwezig zijn in alle veroudering modellen. Het nut vanSAHF als verouderende merker in muismodellen kan ook beperkt doordat SAHF algemeen niet waargenomen in muizen verouderde cellen 30, 46, 47. Hier antilichamen tegen H3K9Me2 gebruikt, maar andere moleculaire merkers van SAHF kan worden gebruikt, waaronder macroH2A, hoge mobiliteit groep A (HMGA) eiwitten en tri-gemethyleerd histon H3 lysine 9 (H3K9Me3) en gebonden eiwitten HP1. Bovendien kan chromatine immunoprecipitatie assays worden gebruikt voor histon markeringen of de associatie van chromatine bindende eiwitten aan E2F doelgenen bepalen.

Men moet zich bewust dat er verschillende beperkingen op de karakterisering van veroudering, met inbegrip van heterogeniteit voor markers en het feit dat deze markers niet uitsluitend worden uitgedrukt in verouderde cellen. Multiple (in het algemeen, 2-3) markers moeten worden gebruikt om veroudering te beoordelen, met inbegrip van markers hier niet beschreven. Bijvoorbeeld DNA-littekens, telomeerschade en / of DNA-schade signalering kan worden gekwantificeerd. Zoals senescentie en met name de SASP fenotype, is onlangs aangetoond worden beïnvloed door de specifieke stress of schade die senescentie 11, 12, 13 veroorzaakt, is het belangrijk om meerdere markers beoordelen elke experimentele paradigma.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Deze studie werd ondersteund door de Intramurale Research Program van de National Institutes of Health, National Institute on Aging. De auteurs willen Myriam Gorospe en Kotb Abdelmohsen bedanken voor de vele nuttige discussies over veroudering en Kotb Abdelmohsen voor ook het kritisch lezen van het manuscript. We danken ook ons ​​laboratorium leden, met name Douglas Dluzen voor het kritisch lezen van het manuscript.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Technieken voor het induceren en te kwantificeren Cellulaire senescentie
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter