Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Techniken zur Induktion und Quantify Zelluläre Seneszenz

doi: 10.3791/55533 Published: May 1, 2017

Summary

Zelluläre Seneszenz, der irreversible Zustand der Zellzyklusarrest, kann durch verschiedene Zellspannungen induziert werden. Hier beschreiben wir Protokolle zelluläre Seneszenz und Methoden zu induzieren Marker für Seneszenz zu beurteilen.

Abstract

In Reaktion auf zellulärem Stress oder Schädigung, proliferierenden Zellen kann ein spezifisches Programm induzieren, die einen Zustand der Langzeit-Zellzyklusarrest einleitet, zelluläre Seneszenz bezeichnet. Akkumulation von seneszenten Zellen erfolgt mit organismal Altern und durch kontinuierliche Kultivierung in vitro. Seneszenten Zellen beeinflussen zahlreiche biologische Prozesse, einschließlich der embryonalen Entwicklung, Gewebereparatur und -regeneration, Tumorunterdrückung und Alterung. Kennzeichnend für seneszenten Zellen umfassen, sind aber nicht darauf beschränkt, erhöhte Seneszenz-assoziierte β-Galactosidase-Aktivität (SA-β-gal); p16 INK4A, p53, p21 und Ebene; höhere Niveaus von DNA-Schäden, einschließlich γ-H2AX; die Bildung der Seneszenz-assoziierte Heterochromatin Foci (SAHF); und der Erwerb eines Seneszenz-assoziierte Sekretorische Phenotype (PUSA), ein Phänomen, das durch die Sekretion einer Anzahl von pro-inflammatorischen Cytokinen und Signalmolekülen charakterisiert. Hier beschreiben wir Protokolle sowohl für replikativen undDNA Seneszenz in kultivierten Zellen-Schädigung induziert. Außerdem markieren Techniken, die wir den seneszenten Phänotyp mit mehreren Seneszenz-assoziierte Marker, einschließlich SA-β-gal, γ-H2AX und SAHF Färbung und zu quantifizieren Protein und mRNA-Spiegel von Zellzyklusregulatoren und SASP Faktoren zu überwachen. Diese Methoden können zur Beurteilung der Seneszenz in verschiedenen Modellen und Geweben angewandt werden.

Introduction

Mehr als vor einem halben Jahrhundert, Hayflick und Kollegen beschrieben , wie nicht - transformierten Zellen in Kultur vermehren, aber nur für einen begrenzten Zeitraum 1. Langzeitkultivierung von humanen Fibroblasten verursacht die Zellen vermehren zu stoppen; jedoch waren sie metabolisch aktiv, und wurde dieser zelluläre Seneszenz bezeichnet. Seneszenz können zur Hemmung der Tumorgenese von Vorteil sein, sie kann aber auch nachteilig sein, wie es angenommen wird , auf den Verlust der Regenerationsfähigkeit beizutragen , die mit dem Altern auftritt , 2, 3. Seneszenten Zellen wurden in Geweben akkumulieren gezeigt , wie Menschen im Alter von 4 und in einer Reihe von biologischen Prozessen, einschließlich der Embryonalentwicklung, Wundheilung, Gewebereparatur und altersbedingte Entzündung 2 in Verbindung gebracht.

Kontinuierliche Passagierung der Zellen in Kultur induziert replikative Seneszenz, die in Verbindung gebracht wurdezu der Telomere Abrieb und genomische Instabilität. Verschiedene Zellspannungen, einschließlich DNA - Schädigung und Onkogenen, können auch Seneszenz 3 verursachen. Seneszenz verursacht durch andere Faktoren als Telomer Abrieb wird oft spannungsinduzierte oder vorzeitige Seneszenz bezeichnet und hängt im Allgemeinen von der p16 INK4A / Rb - Weg 5. Obwohl proliferierenden, typischerweise nicht - transformierten Zellen spindelförmig erscheinen, können seneszenten Zellen mit bestimmten Merkmalen identifiziert werden, einschließlich einer flache, große Morphologie und erhöhte Seneszenz-assoziierte β-Galactosidase - Aktivität (SA-β-gal) (Abbildungen 1 und 2). Seneszenten Zellen akkumulieren auch DNA - Schädigung Marker, einschließlich γ-H2AX (Abbildung 3) 6, und möglicherweise Seneszenz-assoziierte Heterochromatin Foci (SAHF) (4) 7. Seneszenten Zellen höhere Zellzyklusregulatoren, einschließlich p 16 (p16 INK4A) und / oder p21 und p53 (Figur 5) 8, 9. Darüber hinaus haben jüngste Daten gezeigt , dass seneszenten Zellen nicht autonome Wirkungen durch eine Reihe von pro-inflammatorischen Zytokinen und Chemokinen sezer die Seneszenz-assoziierte sekretorischen Phänotyp (SASP) 10 genannt haben. Obwohl dieses Phänomen SASP von Zelltyp zu Zelltyp, im allgemeinen unterschiedlich sein kann, ist es durch eine Erhöhung der Interleukin-6 (IL-6), IL-8, Granulozyten-Makrophagen-Kolonie-stimulierender Faktor (GM-CSF) gezeigt, wachstums- regulierter Onkogen α (GRO-α) und GRO-β, unter anderem (Abbildung 6). Die besondere Beanspruchung oder Schäden , die Seneszenz induziert können auch Einfluss auf die sekretorischen Phänotyp 11, 12, 13. SASP kann durch Messung der Mengen an sezernierten Proteinen unter Verwendung von ELISAs oder Zytokin / Protein-Arrays detektiert werdens = "xref"> 10, 14. Obwohl posttranskriptionale Mechanismen können SASP Proteinspiegel 11 regulieren, 15, 16, 17, Veränderungen in der mRNA - Spiegel können auch in vielen Fällen nachgewiesen werden. Diese Änderungen sind in der Regel empfindlicher und leichter zu quantifizieren als Proteinebene Messungen. Andere seneszenten Marker können auch beurteilt werden, einschließlich DNA - Schädigung persistent Kern Foci, genannt DNA - Segmente mit Chromatin Veränderungen Verstärkungs Seneszenz (DNA-SCARS) 18, und verschiedene andere Marker 3, 19, 20.

Hier beschreiben wir gemeinsame Techniken für die Seneszenz in Zellen in Kultur zu induzieren und auch für mehrere Marker die Seneszenz zu messen, einschließlich SA-β-Gal, γ-H2AX, SAHF, und das Protein und mRNA von alternNOA-assoziierte Moleküle.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Inducing replikative Seneszenz

  1. Auftau - low-Passage humane diploide Fibroblasten (zB, WI-38 und IMR-90) oder ein anderes Zelllinie.
    HINWEIS: Hier menschliche diploide Fibroblasten wurden verwendet, aber diese Protokolle können verwendet werden, Seneszenz in anderen Zelltypen, wie Endothel, Epithel oder mesenchymalen Stammzellen zu bewerten. Kultivierungsbedingungen können für die verschiedenen Zelltypen verwendet, aufgrund der unterschiedlichen Wachstumsraten oder Wachstumsbedingungen optimiert werden.
    HINWEIS: Die Zellen sollten eine Spindel Morphologie sein wuchernden und haben (siehe Abbildung 1 für eine schematische und 2 für Beispiele). Idealerweise sollten die Zellen haben eine Populationsverdopplungs Ebene (PDL) von <30 zu Beginn der Versuche mit möglichen replikativen seneszenten Zellen zu vermeiden.
    1. Berechnen Sie die PDL der Zellen unter Verwendung der folgenden Gleichung PDL = log (N f / N 0) / log2, wobei N f die endgültige Zellzahl und <em> N 0 die anfängliche Anzahl der ausgesäten Zellen 21.
  2. Kultur WI-38-Zellen in Dulbecco modifiziertem Eagle-Medium (DMEM) mit 10% fötalen Rinderserum (FBS), 1% nicht-essentiellen Aminosäuren und 1% Penicillin / Streptomycin.
  3. Wachsen IMR-90-Zellen in DMEM, supplementiert mit 10% FBS und 1% Penicillin / Streptomycin.
  4. Wachsen alle Zellen bei 37 ° C und 5% CO 2 Kontinuierlich die Zellen wachsen und teilen alle 2 bis 4 d , wenn die Zellen erreichen ~ 70-80% Konfluenz. Überwachen Sie Zellkonfluenz mit einem Lichtmikroskop. Vermeiden Sie Zellen mit höherer Einmündung, da dies durch das Zellwachstum beeinflussen kann Hemmung kontaktieren.
  5. Überwachen der Zellen unter einem Lichtmikroskop für die morphologische Erscheinungsbild von seneszenten Zellen (siehe Abbildungen 1 und 2) und für die, wenn es keine Änderung in der PDL von einer Subkultur auf den nächsten ist.

2. DNA-Damage-induzierte Seneszenz

    (zB WI-38, IMR-90, oder eine andere Typ - Zelle) bei einer sparse Dichte (dh ~ 300.000 Zellen / 6 cm Schale) in einer geeigneten Schal für die Art der Analyse (dh eine 6 cm - Schale für das Protein / RNA-Marker oder eine 6-Well-Platte für die SA-β-gal-Färbung). Früh Passage Zellen verwenden, die jung sind und wuchernden (<30 PDL) und die Platte sie so, dass die Zellen etwa 50 sind - 60% konfluent am nächsten Tag.
  1. Entfernen des Wachstumsmediums mit einer Glaspipette mit einem Vakuum verbunden und unter Verwendung von waschen die Zellen durch Zugabe von 1x phosphatgepufferter Kochsalzlösung (PBS). Wiederholen Sie diesen Schritt für insgesamt zwei Wäschen. Fügen Sie eine dünne Schicht aus PBS (~ 750 & mgr; L für eine 6 cm Schale) sowohl für eine „mock“ behandelt und einer ionisierenden Strahlung (IR) behandelten Zustand.
  2. Verwenden eines Gamma-Bestrahler Zellen auf eine einzige Dosis von 10 Gray (Gy) von IR zu exponieren; dies ist eine typische Belichtung für die meisten Zelllinien. In einer Haube, entfernen Sie den PBS und ersetzen sie durch Wachstumsmedium. Alternativ behandeln die Zellen mit bleomycin bei 20 & mgr; g / ml für 2 Stunden.
  3. Ändern Sie das Medium auf den alle 48 -7 2 ​​h Zellen und teilen Sie die Zellen, wenn nötig.
  4. Überwachen Sie die Zellen unter einem Lichtmikroskop auf morphologische Veränderungen (siehe Abbildung 1 eine schematische und Figur 2 für repräsentative Zellbildern) und Assay für seneszenten Marker 7 bis 10 d nach der IR - Behandlung.
    Hinweis: Dieses Protokoll beschreibt IR-induzierte Seneszenz. Seneszenz kann auch durch andere Spannungen induziert werden, einschließlich Bleomycin (siehe oben für Bedingungen), H 2 O 2 22, 23, 24 chemotherapeutischen Arzneimitteln, Zigarettenrauch 25, transformierendem Wachstumsfaktor (TGF) -β1 26, 27, 21 und andere Methoden , 28, 29.

3. Die Färbung Cells für Seneszenz-assoziierte β-Galactosidase

  1. Vor der Färbung, untersuchen Sie die Zellen unter einem Lichtmikroskop der morphologischen Veränderungen zu überwachen.
    HINWEIS: alternde Zellen werden typischerweise vergrößert und flach ist , im Gegensatz zu proliferierenden Zellen, die eine Spindel Morphologie aufweisen (siehe Abbildung 1 für eine schematische und Figur 2 für repräsentative Ergebnisse). Proliferierenden Zellen können als negative Kontrolle verwendet werden, und mit IR oder einem anderen DNA-schädigende Mitteln behandelten Zellen (siehe Abschnitt 2) als positive Kontrollen verwendet werden.
  2. Quantifizieren SA-β-gal Aktivität Reagenzien von einem kommerziellen Kits (siehe Werkstoff - Tabelle). Tauen Sie alle Reagenzien und bringen sie durch Erwärmen sie auf Raumtemperatur bis 37 ° C.
    1. Berechnen Sie die Menge der Färbelösung und Fixierungslösung notwendig.
      HINWEIS: In der Regel wird ein 1 ml-Volumen ist ausreichend, um für eine Vertiefung in einer Platte mit 6 Vertiefungen. Verschiedene Plattengrößen können verwendet werden, aber eine 6-Well-Platte Größe ist well geeignet einen Assay in dreifacher Ausfertigung für jede Bedingung durchzuführen. Diese Dichte stellt in der Regel eine ausreichende Anzahl von Zellen pro Feld, ohne eine übermäßige Anzahl von Zellen zu zählen.
    2. Verdünnen Sie die Färbelösung 1:10 mit destilliertem Wasser.
    3. Verdünnen Sie die Fixierungslösung 1:10 mit destilliertem Wasser.
    4. Make a 20x Stammlösung von X-gal bis (5-Brom-4-chlor-3-indolyl-β-D-galactopyranosid) in N, N-Dimethylformamid (DMF, zB 20 mg X-gal in 1 ml DMF). Um die Verwendung des Kits, auszumessen X-gal auf die Menge für jeden Assay benötigt und fügen Sie dann die berechnete Menge an DMF zu maximieren aufzulösen. Alternativ speichert die Stammlösung bei -20 ° C in einem lichtgeschützten Rohr für einen Monat. Nur Polypropylen (opaque) Rohre zum Verdünnen und X-gal Lösungen speichern.
    5. Bereiten β-gal-Färbelösung: 930 & mgr; l 1x Färbelösung werden 10 ul Anfärbung Supplement A, 10 & mgr; l der Anfärbung Ergänzung B, und 50 ul 20 mg / ml X-Gal in DMF. Machen Sie einen Master-Mix je nachdem, wie viele Brunnen müssen gefärbt werden.
  3. Entfernen Sie vorsichtig das Medium von den Zellen, die eine Transferpipette oder das Äquivalent verwendet wird.
  4. Die Zellen vorsichtig wäscht einmal mit Raumtemperatur 1x PBS.
  5. 1 ml 1x Fixierungslösung in jede Vertiefung und Inkubation für 10 bis 15 min bei RT.
  6. Entfernen Sie die Fixierungslösung mit einer Transferpipette.
    HINWEIS: Die Fixierungslösung (1x) enthält 2% Formaldehyd und 0,2% Glutaraldehyd und sollte als Sondermüll entsorgt werden entsprechend den Empfehlungen der Laborsicherheit Büro.
  7. Die Zellen vorsichtig wäscht zweimal mit 1x PBS.
  8. Entfernen Sie die PBS vollständig und hinzufügen 1x β-gal Färbelösung in die Vertiefungen (1 ml / Well einer 6-Well-Platte). Bedecken die Platte vollständig mit Aluminiumfolie und Inkubation für 24 bis 48 h in einem 37 ° C - Inkubator (vorzugsweise in Abwesenheit von CO 2, da dies den pH - Wert des Puffers senken kann und beeinflussen Färbung).
    1. Überprüfen Sie die Zellen bei 24 h für die Färbung, und wenn der Fleck zu hell ist, Inkubation für weitere 24 Stunden.
  9. Nach der Inkubationszeit, entfernen Sie die β-gal-Lösung und ersetzen sie durch 1x PBS.
    HINWEIS: Dieser Schritt entfernt einen Teil der Hintergrundfarbe bei der Abbildung und verhindert auch gefährliche Vergießen der X-gal-Lösung.
    HINWEIS: Entsorgen Sie das β-gal-Lösung richtig, entsprechend den Empfehlungen des Sicherheitslabor Büro.
  10. Untersuchen der Zellen auf einem Lichtmikroskop mit einer daran befestigten Kamera eines 10-fach oder höher Ziel verwendet wird; SA-β-gal-positive Zellen werden blau sein. Erwerben Sie die gewünschte Anzahl der Bilder für das Experiment. Wenn der Anteil der SA-β-gal-positive Zellen zu zählen, pro Vertiefung der entsprechende Anzahl der Bilder (> 5) für die Quantifizierung erwerben. Stellen Sie sicher, dass die Bilder aus verschiedenen Blickfeldern innerhalb jeder Vertiefung nicht überlappend sind.
  11. Zähle die Anzahl der SA-β-gal-positiven (blauen) Zellen im Vergleich zu der Anzahl der gesamten Zellenden Prozentsatz der SA-β-gal-positive Zellen zu berechnen. Count> 100 Zellen pro Bedingung.
    HINWEIS: Repräsentative Bilder können auch für Zahlen verwendet werden. Beachten Sie, dass Zellkonfluenz wenn Zählen der Zellen entscheidend ist, da zu viele Zellen es schwierig machen, jede Zelle zu differenzieren und zu wenig kann nicht eine ausreichende Anzahl von Zellen für die Quantifizierung und Statistiken geben. Bilder Zahlen für die Veröffentlichung sind bei der besten Auflösung, wenn sie als TIFF-Dateien gespeichert, obwohl Jpeg-Dateien geeignet sind. Farbbilder sollten 300 dpi sein.

4. Anfärben der Zellen für γ-H2AX

  1. Platte, die die Zellen, die aus den Abschnitten 1 oder 2 auf Glasdeckgläschen in einer 24-Well-Platte.
  2. Am nächsten Tag, waschen Sie die Zellen mit 1x PBS. Spülen Sie sorgfältig, wie seneszenten Zellen haften nicht gut auf Deckgläser und leicht während der Wäschen entfernt werden kann. Alternativ fixiert die Zellen direkt ohne Waschen.
  3. Entfernen Sie die PBS und fixieren die Zellen mit frisch zubereiteten 3,7% Formaldehyd in PBS für10 min bei RT.
  4. Entfernen der Lösung und Permeabilisierung der Zellen mit 0,2% Triton X-100 in PBS für 10 min.
  5. Entfernen der Lösung und in Block 5% FBS in PBS für 2 h bei RT.
  6. Inkubieren mit Anti-Phospho γ-H2AX (Ser139) und FITC-Konjugat in 5% FBS / PBS für 2 h bei 37 ° C oder O / N bei 4 ° C. Vor Licht schützen.
  7. Waschen 3 - 6x mit PBS bei 37 ° C für insgesamt 30 - 60 min.
  8. Fleck mit DAPI (verdünnt 1: 15.000 in PBS) für 10 min bei RT.
  9. Waschen 3x mit PBS.
  10. Schnell mit Wasser waschen, die Salz und montieren das Deckglas auf einem Glasobjektträger unter Verwendung von 3 zu entfernen, - 5 & mgr; L Antifade-Reagens. Alternativ dazu verwenden, um eine Befestigungslösung DAPI enthält.
  11. Trocknen lassen O / N und visualisieren die gefärbten Zellen auf einem Fluoreszenzmikroskop oder ein konfokales 63X oder höher Ziel verwenden.
  12. Quantifizierung der γ-H2AX Foci durch ein von zwei Verfahren nachstehend beschrieben werden. Ergebnis für beiden Protokolle mit dem Auge eines Fluoreszenzmikroskop. Idealerweise unsea Konfokalmikroskop. Nehmen Z-Abschnitte und kondensieren in einer einzigen Ebene , um alle nachweisbaren Foci sichtbar zu machen (repräsentative Bilder für γ-H2AX Färbung in proliferierenden und seneszenten Zellen werden in 3 gezeigt). Zählen Sie die Foci durch das Auge unter Verwendung von Bildbearbeitungssoftware; in der Regel ~ 100-200 Kerne sind zum Zählen ausreichend.
    1. Um den Prozentsatz der Zellen zu quantifizieren, die γ-H2AX-positive Foci haben, zählen jede Zelle, die mindestens einen Fokus sichtbar und Dividieren durch die Gesamtzahl der DAPI-gefärbten Zellkernen aufweist.
    2. Um die Anzahl der γ-H2AX Foci zu quantifizieren, zählen die γ-H2AX Foci pro Zelle.
      HINWEIS: Die Pegel des γ-H2AX auf den spezifischen Stressoren oder Schäden variieren, die Seneszenz induziert.

5. Anfärben der Zellen für SAHF Marker

HINWEIS: Human seneszenten Zellen werden oft Kernregionen kondensierten DNA / Chromatin haben. In seneszenten Zellen, wobei diese heterochromatischen Regionensind gedacht, um die Expression von proliferationsfördernde Gene, wie E2F Familienmitglieder zu hemmen. SAHF kann durch die Reorganisation von DAPI sichtbar gemacht werden; durch die Anwesenheit von Heterochromatin-assoziierte Histonmarkierungen, einschließlich der Di- und Tri-Methylierung von Lys9 auf Histon H3 (H3K9Me2 und H3K9me3); und durch Chromatin-Reorganisation Proteine, einschließlich HP1 heterochromatin protein 1 (HP1), HIRA (Histon - Repressor - A), und ASF1a (anti-Silencing - Funktion-1a) an dem Chromatin 30. Wir haben uns entschieden ein Onkogen-induzierte Seneszenz - Modell (OIS) zu verwenden, wie SAHF prominenteren in OIS Modelle 30 ist. IDH4 Zellen proliferieren in Gegenwart von Dexamethason aufgrund der Anwesenheit von SV40 large T - Antigen , aber nach der Entfernung von Dexamethason aus dem Medium 31 seneszenten werden. SAHF kann oben aufgeführten, mit Antikörpern gegen den spezifischen Marker durch DAPI-Färbung und durch Färben nachgewiesen werden. Hier haben wir DAPI und H3K9Me2 Färbung für die visualizat beschreibenIon SAHF in Zellen 28.

  1. Wachsen IDH4 Zellen in DMEM mit 10% FBS, 1% Penicillin / Streptomycin und 1 ug / ml Dexamethason. Seneszenz zu induzieren, entfernen Sie das Dexamethason und das Medium ändern, so dass es charcoal-stripped FBS enthält; nach wächst für ~ 10 Tage in diesem neuen Medium, werden IDH4 Zellen seneszenten 31.
  2. Platte IDH4 Zellen oder Zellen, die von den Abschnitten 1 oder 2, wie oben beschrieben, auf Glasdeckgläschen in einer 24-Well-Platte.
  3. Am nächsten Tag, waschen Sie die Zellen mit 1x PBS. Spülen Sie sorgfältig, wie seneszenten Zellen haften nicht gut auf Deckgläser und leicht während Waschungen entfernt werden können. Alternativ direkt fixieren Zellen ohne Waschen.
  4. Entfernen Sie die PBS und fixieren die Zellen mit frisch zubereiteten 3,7% Formaldehyd in PBS für 10 min bei RT.
  5. Waschen Sie die Zellen 3-mal mit 1x PBS.
  6. Entfernen der Lösung und Permeabilisierung der Zellen mit 0,2% Triton X-100 in PBS für 5 min.
  7. Waschen Sie die Zellen mit 1xPBS. Entfernen Sie die PBS und blockieren die Deckgläser durch Zugabe von Blockierungspuffer enthaltend 3% BSA (w / v) in PBS für 5 min bei RT. Immer Filterlösungen, enthaltend BSA vor der Verwendung Feststoffteilchen zu entfernen.
  8. Entfernen des Blockierungspuffers und Inkubieren der Zellen mit primären Antikörpern gegen SAHF Marker wie anti-H3KMe2 Antikörper (Abbildung 4, der Werkstoffe Tabelle für Details). Verdünnen Sie die Antikörper in Blocking-Puffer und Inkubation für 1 bis 2 h bei RT.
  9. Entfernen Sie die primäre Antikörperlösung und wäscht die Deckgläser 3 mal mit 1% (v / v) Triton X-100 in PBS.
  10. Verdünne die sekundären Antikörper in Blockierungspuffer (Material Table) und Inkubation für 1 h bei RT. Vor Licht schützen.
  11. Waschen Sie die Zellen zweimal mit 1x PBS. 10 min bei RT;: Fleck mit DAPI (15.000 in PBS siehe Tabelle 1 Materialien verdünnt).
  12. Waschen Sie die Deckgläser mit 1x PBS 3x.
    1. Schnell mit Wasser wäscht die Salze entfernen einnd montiert jedes Deckglas auf einem Glasobjektträger unter Verwendung von 3 bis 5 & mgr; L Antifade-Reagens. Alternativ dazu verwenden, um eine Befestigungslösung DAPI enthält.
    2. Trocknen lassen O / N und visualisieren die gefärbten Zellen auf einem Fluoreszenzmikroskop oder ein konfokales 63X oder höher Ziel (siehe die repräsentativen Ergebnisse in Abbildung 4). Quantifizierung der SAHF wie in Abschnitt 4 beschrieben.
      HINWEIS: Isotypkontrollreagenzien primäre Antikörper oder kein primärer Antikörper (dh sekundäre allein) sollte als eine negative Kontrolle für die Immunfluoreszenzfärbung verwendet werden.

6. Analysieren von Seneszenz-assoziierte Proteine ​​durch Immunoblotting

HINWEIS: Der seneszenten Phänotyp wird durch die Hochregulation von Zellzyklusregulatoren charakterisiert, einschließlich p16 INK4A, p21 und p53. Dieses Protokoll wird die Quantifizierung der Mengen dieser Proteine ​​in Zelllysaten beschreiben. Diese Techniken können verwendet werden, Seneszenz zu beurteilen induziert mit einer Vielzahl vonVerfahren 21, 28, 29.

  1. Induzieren zelluläre Seneszenz , wie beschrieben in den Abschnitten 1 und 2 oder durch Verwendung eines anderen Verfahrens 21, 28, 29. Zur Analyse zellulärer Seneszenz Marker, um die Zellen in 6 cm-Schalen Platte und sowohl das Protein analysieren und die RNA gleichzeitig (Abschnitt 7 zur RNA-Isolierung Anleitung).
  2. Entfernen Sie das Zellkulturmedium. Legen Sie die Zellen auf einem Tablett aus Eis.
    1. Waschen Sie die Zellen 2 mal mit kaltem 1x PBS. Kippen Sie das Gericht, um sicherzustellen, dass das gesamte PBS abgesaugt wird, um so präzise in Bezug auf die Mengen für das Verfahren verwendet werden.
    2. Nach der letzten Waschung PBS Aspirieren, 200 & mgr; L kaltem PBS 1x (für eine 6 cm Schale) in die Schale. Schaben die Zellen eine Zellschaber.
    3. Pipette, um die Zellen / PBS-Mischung in ein RNase-freien Röhrchen für die RNA-Isolierung. Nehmen Sie etwa 150 &# 181; l dieser Mischung und Pipette in ein neues Röhrchen. Diese Aliquot wird für die Proteinanalyse verwendet werden, so sicher sein, um die gleiche Menge von jedem Röhrchen pipettieren.
  3. Lyse der Zellen durch Zugabe von 75 bis 100 & mgr; l von modifizierten 2x Laemmli Probenpuffer (60 mM Tris-HCl pH 6,8, 12,5% Glycerin, 2% SDS, 5% β-Mercaptoethanol (BME) und Bromphenolblau, kann als nachgeholt werden eine große Charge, aliquotiert und bei -20 ° C bis zur Verwendung) oder einen äquivalenten Probenpuffer gespeichert.
    1. Alternativ lysieren die Zellen in 75 bis 100 & mgr; l Lysepuffer und Zentrifuge bei 15.000 xg für 10 min bei 4 ° C, um die Zelltrümmer zu entfernen. Entfernen Sie den Überstand und Pipette in ein sauberes Röhrchen. Ein Bradford-Protein-Assay oder ein äquivalentes Protein Assay kann auf Lysaten verwendet werden, um die gleiche Beladung des Proteins zu gewährleisten.
      HINWEIS: Protein-Assays kann nicht an Proben durchgeführt werden, in Probenpuffer lysiert.
    2. Nehmen Sie ~ 25 & mgr; l Lysat und fügen Sie es zu 15 & mgr; l 2x Probenpuffer. Pipettieren und tunwn im Probenpuffer, um die Zellen zu lysieren.
      HINWEIS: Die Volumina Lysepuffer oder Probenpuffer eingestellt werden kann, je nach Zellkonfluenz. Wenn die Probe „gooey“ durch Kern Lysiereinrichtung ist, mehr Probenpuffer oder PBS hinzufügen zu verdünnen. Die Proben können bei -20 ° C bis zur Verwendung gelagert werden.
  4. Koche die Proben für 5 min bei 95 ° C auf einem Heizblock (oder äquivalente Ausrüstung) und Last ~ 40 ul lysierter Probe in Probenpuffer auf einem 18% Tris-Glycine Gel.
    HINWEIS: Ein Gradientengel (4-15%) oder ein 14% Tris-Glycine Gel auch ausreichend für die niedermolekularen Proteine ​​zu detektieren. Verschiedene Arten von Acrylamidgelen können auch verwendet werden, aber dafür sorgen, dass die Gele und System sind ausreichend für niedermolekulare Proteine ​​zu detektieren.
    1. Führen 1x Laufpuffer unter Verwendung von mit einem konstanten 100 V für 20 min (durch das Stapelgel) und ~ 60 min bei 180 V. Überwachen, das Gels, so dass die Farbstofffront gerade abläuft oder ist an der Unterseite des Gels, so daß die niedermolekular Gewicht Proteine ​​nicht run off des Gels.
  5. Übertragen das Acrylamidgel auf ein PVDF-Membran (vorgetränkt mit 100% Methanol zu aktivieren). Wenn eine nasse Übertragung zu tun, nur 1 Stunde für die Übertragung benötigt wird (im Vergleich zu dem normalen ~ 1,75 h). Entsprechend anpassen, für das entsprechende Übertragungssystem; unter Verwendung von vorgefärbten Molekulargewichtsmarker kann bei der Beurteilung der Übertragungseffizienz unterstützen.
  6. Waschen der Membran in Wasser. Verwenden, um eine Ponceau-Färbung für die gleiche Beladung von Proben zu überwachen. Waschen Sie die Ponceau mit Wasser ab.
    1. Blockiert die Membran in 5% fettfreier Trockenmilch in TBST (50 mM Tris-HCl pH 7,5, 150 mM NaCl und 0,1% Tween-20) für 1 h bei RT oder O / N bei 4 ° C unter Rühren.
  7. Wash - Blot einmal mit TBST und mit primärem Antikörper , verdünnt in 5% Milch TBST (siehe Tabelle Material für Verdünnungen und Antikörper - Empfehlungen) für 1 h bei RT inkubiert.
  8. Führen Sie zwei schnellen Waschungen mit TBST und dann waschen Sie zweimal auf einem Schüttler für insgesamt ~ 30 min (~ 15 min je warh).
  9. Inkubieren mit einem Sekundärantikörper für 40 min bei RT. Wiederholen Sie Schritt 6.10.
  10. Inkubieren mit frisch Western-Blot-Substrat hergestellt und den Film entwickeln oder auf einem Chemilumineszenz-Leser lesen.
  11. Sonde Immunoblot mit Antikörpern p16 INK4A ersten (Abbildung 5). Streifen, die Membran mit Wasser für 15 min inkubiert, 15 min mit 0,2 N NaOH und 15 min mit Wasser. Fahren Sie mit Schritt 6.9 unter Verwendung von anti-p21-Antikörper.
  12. Streifen die Membran 62.5 mM Tris-HCL pH 6,8 und 2% SDS mit 300 & mgr; l frisch zugegebenem BME pro 50 ml Stripping-Lösung.
  13. Inkubieren bei 50 ° C für 30 min und wäscht ausgiebig mit TBS und dann TBST. Sonde mit anti-Aktin oder anti-GAPDH - Antikörper für Protein-Ladesteuerungen (Abbildung 5 zeigt repräsentative Ergebnisse).
    HINWEIS: p53 Ebene können auch auf den gleichen Membranen bewertet werden. Da jedoch p53 ein höheres Molekulargewicht ist, ist es besser , sich auf einem niedrigeren Prozentsatz Gel gelöst ist (zB

7. Analyse der mRNA-Spiegel der Seneszenz Markers

HINWEIS: Bei der Isolierung von RNA, sicherzustellen, dass die Arbeitsflächen mit RNase Entfernungslösungen gereinigt werden oder einem gleichwertigen und dass die Materialien all RNase-frei sind.

  1. Unter Verwendung der Zelle / PBS-Mischung aus Schritt 4.2, 1 mL RNA-Extraktionslösung und vortex für 30 s (es sollte keine sichtbaren Klumpen oder Zelldebris sein).
  2. In 200 ul Chloroform und kräftig schütteln für 15 s.
  3. Zentrifuge bei Höchstgeschwindigkeit (> 15.000 x g) für 15 min bei 4 ° C.
  4. Entfernen Sie ~ 400 & mgr; l der oberen RNA wässrige Schicht und Pipette in ein neues Mikrozentrifugenröhrchen.
  5. Zugabe von 400 & mgr; l Isopropanol (1: 1 mit dem Gesamtvolumen der wässrigen Schicht in dem vorherigen Schritt pipettiert) und 4 ul precipitant an die RNA-Schicht.
  6. Zentrifuge für 15-30 min bei maximaler Geschwindigkeit (> 15.000 x g) und 4 ° C, um die RNA zu pelletieren.
  7. Entfernen Sie den Überstand und 1 mL 75% eiskaltem Ethanol.
  8. Zentrifuge für 1 min bei Maximalgeschwindigkeit (> 15.000 x g) und 4 ° C.
  9. Entfernen Sie den Überstand und zentrifugiert für 1 min bei Maximalgeschwindigkeit (> 15.000 x g) und 4 ° C.
  10. Pipette aus so viel Flüssigkeit wie möglich, und der Luft trocknen lassen für 2 min.
  11. Resuspendieren in 10 ul 10fach DNase - Puffer, 85 ul H & sub2; O und 5 ul DNase 1.
  12. für 30 min bei 37 ° C inkubieren.
  13. Füge 200 & mgr; L NT2 - Puffer (50 mM Tris-HCl pH 7,4, 150 mM NaCl, 1 mM MgCl 2 und 0,05% Nonidet P-40) und 300 & mgr; l der unteren Schicht von Säure Phenol-CHCl 2.
  14. Vortex für 1 min und Zentrifuge bei Raumtemperatur für 5 min bei maximaler Geschwindigkeit (> 15.000 x g).
  15. Sammle 250 ul der oberen RNA Schicht (2 x 125 ul), fügen 25ul 3 M Natriumacetat pH 5.2, 625 ul 100% eiskaltem Ethanol und 5 & mgr; l an Fällmittel. Gut mischen und O / N bei -20 ° C ausgefällt.
  16. Am nächsten Tag, mischte und Spin bei maximaler Geschwindigkeit (> 15.000 xg) und 4 ° C für 30 min und den Überstand verwerfen.
  17. Wiederholen Sie die Schritte 6,8-6,11.
  18. Resuspendieren des Pellets in 12 & mgr; l Nuklease-freiem Wasser und bei -80 ° C bis zur Verwendung.
    Hinweis: andere RNA-Isolierungsverfahren und Kits können ebenfalls verwendet werden.
  19. Führen Sie die reverse Transkription mit Zufallshexameren und SSII-Reverse-Transkriptase gemäß dem Protokoll des Herstellers.
    HINWEIS: Aufgrund der geringen Menge an RNA aus seneszenten Zellen isoliert, ist es am besten, alle von der RNA (12 & mgr; l) für die reverse Transkription Synthese zu verwenden. Alternativ kann RNA mit einem Spektralphotometer quantifiziert werden, und gleiche Mengen von RNA für die reverse Transkription verwendet werden.
  20. Analysieren Sie die mRNA-Spiegel mit Echtzeit quantitative qPCR (RT-qPCR) amplification und SYBR-Grün PCR Master-Mix mit Gen-spezifischen Primer.
    1. Wie in einem typischen Reaktions RT-qPCR, verdünnen, um die cDNA 01.30 (in RNase / DNase-freien Wasser) und 3 & mgr; l 96-Well-Platte auf die Echtzeit für eine bessere Pipettiergenauigkeit hinzuzufügen. Vorbereiten eines Reaktions Mastermix von genspezifischen Vorwärts- und Rückwärts-Primer (2,5 & mgr; M Konzentration, werden 5 & mgr; l / Reaktion), SYBR-Grün PCR-Mix (6,25 & mgr; l / Reaktion, verwenden weniger als die Empfehlung des Herstellers), und 5,75 & mgr; l RNase / DNase-freies Wasser für eine endgültigen Reaktionsvolumen von 20 & mgr; l (17 & mgr; l der Primer / SYBR-grün / Wassers und 3 & mgr; l cDNA).
    2. Führen Sie RT-qPCR-Amplifikation eine Echtzeit-PCR-Maschine; folgt dem Protokoll des Herstellers.
      HINWEIS: Eine Liste von validierten menschlichen vorwärts und Echtzeit - Reverse - Primer kann in Tabelle 1 gefunden werden. Diese Gene umfassen SASP Proteine ​​und anderen Seneszenz-assoziierte Marker und / oder die Gene. Repräsentative Ergebnisse aus IR-induzierte Seneszenz sind in

8. Quantifizierung SASP Protein Levels

  1. Induce Seneszenz Abschnitte 1 oder 2 oder unter Verwendung eines anderen Verfahrens. Platte, die die Zellen auf 6 oder 10-cm-Platten, wie oben (~ 250.000 Zellen / 6 cm Platte oder ~ 650.000 / 10 cm Platte) beschrieben.
  2. Entweder mit Zellen 10 d nach dem IR-Behandlung oder mit replikativen seneszenten Zellen (und entsprechenden Kontrollzellen), waschen die Zellen dreimal mit 1x PBS gewaschen und serumfreies Medium, mit Antibiotika in einem kleinen Volumen (2,5 ml für 6 cm oder 5 ml hinzufügen für 10 cm).
  3. Inkubiere über Nacht bei 37 ° C und 5% CO 2 in einem Gewebekultur - Inkubator. Am nächsten Tag, sammelt das Medium und setzt es in einem konischen Röhrchen auf Eis.
  4. Waschen Sie die Zellen 2 mal mit PBS und füge dann 1 ml Trypsin (für eine 6 cm Schale). Zählen Sie die Zellen unter Verwendung eines Hämozytometers später einzustellen, die Konzentrationen nach Zellzahl.
  5. Zentrifuge das Medium für 5 min bei 300 x g.
  6. Filter das Medium unter Verwendung eines 0,45 & mgr; m-Spritzenfilter.
  7. Aliquot das Medium und gefrier bei -80 ° C bis zur Verwendung oder direkt mittels ELISA-Assay oder äquivalenten Assays.
  8. Berechnen der Anzahl von Zellen / mL Konzentration durch die gesamte Zellzahl / Volumen Medium gesammelt Einnahme.
  9. Führen eines geeigneten enzyme-linked immunosorbent assay (ELISA) gemäß den Anweisungen des Herstellers. Siehe die Tabelle Material für empfohlene ELISA - Kits zum Testen auf IL-6, IL-8, GRO & agr und anderen Zytokinen / Chemokinen (6B).
  10. Um sicherzustellen, dass die Faktoren, die gemessen werden, im linearen Bereich der ELISA-Kits sind, machen Verdünnungen des seneszenten Zellen Mediums gegenüber dem wuchernde Zellmedium. Account für diese Verdünnungen und das Volumen, wenn die Menge von IL-6 zu berechnen. die Menge an IL-6 pro Zelle pro Tag, berechnet den IL-6-Wert aus dem Satz (in pg) pro verdünnter Zellkonzentration pro ml (fr erhaltenen sekretierte zu erwerbenom Schritt 7.8).
    Hinweis: andere Methoden, wie Zytokin-Arrays können verwendet werden SASP-Proteinspiegel zu erkennen und kann zum Screening einer großen Anzahl von SASP Faktoren geeignet sein. Die Proteinniveaus von SASP Faktoren können von der Zeit nach Induktion der Seneszenz, der Zelltyp oder die Art der Seneszenz induziert variieren.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Die Figuren 2 - 6 repräsentative Ergebnisse von SA-β-gal - Färbung zeigen; Anfärben für γ-H2AX und SAHF; Beurteilung der Proteinspiegel von p16 INK4A, p21 und p53; und mRNA und Protein-Ebene von seneszenten-assoziierte Moleküle. Erhöhter SA-β-gal-Färbung erfolgt mit replikativen und DNA-Schädigung induzierte Seneszenz. Auch beachten Sie die morphologischen Veränderungen, die mit Seneszenz auftreten. Die Zellen werden vergrößert und flach im Vergleich zu den Spindel Auftreten von wuchernden Fibroblasten. Aus diesem experimentellen Paradigma wurden die Zellen gefärbt und RNA / Protein wurde 7 d nach dem IR-Bestrahlung isoliert. Robustere Ergebnisse durch das Warten mehr nach IR - Bestrahlung (dh 10 d) auftreten können. Bedingungen müssen für jede Bedingung und Versuchsaufbau bestimmt werden. Diese Ergebnisse sind repräsentativ und diese Markierungen können auch nachgewiesen werden, wenn Seneszenz wird mit anderen Methoden induziert.

6 sind Gen - Namen aufgelistet und entsprechen CXCL1 (GRO & agr;), CXCL2 (GRO) und CSF2 (GM-CSF). Die Hochregulation von mRNA-Konzentrationen von einigen, aber nicht alle der SASP Faktoren wurden nach IR-induzierter Seneszenz in WI-38-Zellen beobachtet. Andere Seneszenz-assoziierte mRNAs, einschließlich CDKN1A (kodiert p21) und CDKN2A (p16 kodiert INK4A) wurden nach oben reguliert. Andere mRNAs (EDN1 und ANKRD1) werden ebenfalls berücksichtigt und werden zuvor in seneszenten Zellen 15 höher sein gezeigt. Primer sind in Tabelle 1 aufgelistet.

Abbildung 1
Abbildung 1: Proliferierende und Seneszente Fibroblasts. Eine schematische Darstellung (links) und seneszenten (rechts) Fibroblasten proliferieren. Beispiele für Seneszenz Induktoren sind in der gezeigten yellow Box. Seneszenz mit höheren Ebenen des angegebenen Markers zugeordnet ist. SA-β-gal, Seneszenz-assoziierte β-Galactosidase-Aktivität; SASP, Seneszenz-assoziierte sekretorischen Phänotyp; SAHF, Seneszenz-assoziierte Heterochromatin Foci; DDR, DNA-Schadensantwort. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen

Figur 2
Abbildung 2. Morphologische Merkmale und erhöhte SA-β-gal Aktivität von alternden Zellen. WI-38-Zellen, entweder "jung" (PDL 27), replikative seneszenten (PDL 40), oder solche, ionisierender Strahlung ausgesetzt (IR) proliferierende, wurden gefärbt für SA-β-gal-Aktivität. IMR-90-Zellen, entweder "jung" (PDL 30), replikative seneszenten (PDL 52) proliferierende, oder solche, ionisierender Strahlung ausgesetzt (IR) wurden die stained für SA-β-gal Aktivität. Abschnitte 1 bis 2 beschreibt induzierende replikativen und DNA-Schädigung induzierte Seneszenz, und Abschnitt 3 erläutert Färbung für SA-β-gal. Die Zellen wurden gefärbt 7 d nach der IR. Con, Kontrolle. Maßstabsbalken = 50 um. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 3
Abbildung 3. Erhöhte γ-H2AX Foci in seneszenten Zellen. WI-38-Zellen, entweder "jung" (PDL 30) oder replikative seneszenten (PDL 53), wurden fixiert und mit anti-γ-H2AX Antikörper und DAPI proliferierenden. Beachten Sie die Erhöhung der Anzahl von γ-H2AX Foci in seneszenten Zellen. Bilder wurden auf einem konfokalen Mikroskop erhalten. Z-Schnitte wurden genommen, und die maximale Intensitätsprojektion wurde verwendet, um eine einzelne Ebene Bild zu erhalten, alle DETEC zur VisualisierungTabelle Brennpunkte. Maßstabsbalken = 20 um. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4. Fluoreszierende Anfärbung von SAHF in seneszenten Zellen. (A) Proliferierende WI-38 - Zellen (PDL 27) waren unbehandelt oder ionisierender Strahlung ausgesetzt (IR). Nach 10 Tagen wurden die Zellen mit DAPI gefärbt SAHF ( man beachte , dichte / punctata DAPI - Färbung in IR-behandelten Zellen) (B) IDH4 in Gegenwart von Dexamethason (proliferierende) oder in charcoal-stripped FBS gezüchtet Seneszenz zu induzieren , wurden sichtbar zu machen ( seneszenten). Nach 10 d wurden die Zellen mit Antikörpern gegen H3K9Me2 und DAPI gefärbt. Bilder wurden auf einem konfokalen Mikroskop erhalten. Z-Schnitte wurden genommen, und die Maximalintensitätsprojektion verwendet, wurde eine einzelne Ebene zu erhalten,Bild. Proliferierenden Zellen in (A) und (B) haben diffuse DAPI-Färbung, während seneszenten Zellen punctata DAPI-Färbung aufweisen. In (B) haben Kontrollzellen diffuse, sehr leichte Färbung für H3K9Me2, während H3K9Me2 Anfärbung robuster ist und kolokalisiert mit DAPI-gefärbten Foci in seneszenten Zellen. Maßstabsbalken = 20 um. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5 : Quantifizierung der Seneszenz-assoziierte Proteine. Das Protein wurde isoliert aus entweder wuchernden "jung" (PDL 30) IMR-90-Zellen (-) oder IMR-90-Zellen, die mit 10 Gy ausgesetzt wurden ionisierender Strahlung (IR). Das Medium wurde alle 48 Stunden gewechselt und die Zellen 7 d nach dem IR lysiert. Die Proben wurden durch SDS-PAGE analysiert, einem Immunoblotting mit anti-p16 INK4A Antibostirbt und wieder sondiert mit anti-p21 und dann anti-p53-Antikörper. GAPDH wurde als Proteinbeladung Kontrolle verwendet. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 6
Abbildung 6. Quantifizierung der Seneszenz-assoziierte mRNAs und Proteine SASP. (-) oder WI-38 - Zellen, die mit 10 Gy ionisierender Strahlung (IR) ausgesetzt wurden (A) RNA wurde entweder aus proliferierenden "jung" (PDL 27 oder 34) , WI-38 - Zellen isoliert. Das Medium wurde alle 48 h und RNA-Isolierung geändert wurde 7 d nach der IR durchgeführt. RT-qPCR wurde verwendet , um die Pegel des angegebenen Seneszenz-assoziierte mRNAs unter Verwendung der genspezifischen in Tabelle 1 aufgelisteten Primer zu quantifizieren. 18S - Spiegel wurden für die Normalisierung eingesetzt. Die Histogramme stellen den Mittelwert normalisiert to unbehandelter ± SEM von 5 unabhängigen Experimenten. (B) WI-38 - Zellen (PDL 26) wurden zu 10 Gy von IR ausgesetzt; 10 d später wurde das Medium auf serumfreies Medium gewechselt (siehe Abschnitt 7). Nach 24 h wurde konditionierte Medium gesammelt und IL-6, IL-8, GRO & agr und Spiegel wurde unter Verwendung eines ELISA-Assays quantifiziert. Das Histogramm stellt den Mittelwert ± SEM von 3 Experimenten. * P <0,05 und *** P <0,001 durch t-Test nach Student. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

menschliche Grundierungen Vorwärts Umkehren
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (P21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL - 6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabelle 1: RT-qPCR Primer für Seneszenz-assoziierten mRNAs. Vorwärts- und Rückwärtsprimer für die RT-qPCR SYBR-Grün-Technologie angezeigt.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

unter Verwendung von humanen diploiden Fibroblasten Hier haben wir Methoden zur replikativen und DNA-Schädigung induzierte Seneszenz beschrieben. Zusätzlich sind Techniken zum Protein- und mRNA-Mengen verschiedenen Seneszenz-assoziierte Proteine ​​Quantifizieren enthalten sind, sowie Färbung für SA-β-gal und für den DNA-Schädigung Marker γ-H2AX. Diese Protokolle können weit seneszenten Phänotypen verwendet werden , sowohl in vitro zu bewerten und in vivo, obwohl viele Einschränkungen bestehen für die Charakterisierung von Seneszenz in vivo 20. Andere Zellen können seneszenten Marker exprimieren, auch wenn sie nicht seneszenten Zellen sind. Beispielsweise können Zellen, wie Osteoklasten und Makrophagen haben höhere β-gal - Aktivität 32, 33. Darüber hinaus haben viele Krebszellen p16 INK4A 34 nach oben reguliert. Die Zellen können akkumulieren auch DNA - Schäden (zB γ-H2AX Foci) und nicht seneszenten sein. SASP Faktoren können auch von oben reguliert werdenverschiedene normale physiologische oder pathologische Zustände, die oder nicht seneszenten Zellen beinhalten kann. Daher sollten mehrere Seneszenz Marker verwendet werden, vor allem , wenn Seneszenz in vivo zu bewerten.

Obwohl seneszenten Zellen gefunden wurden vor 4 in normalen Alterungs Geweben mehr als 20 Jahren erhöht werden sollen, ist es erst jetzt , dass wir voll und ganz die Fülle von Rollen zu schätzen , dass alternde Zellen sowohl in normalen Gewebe Homöostase und bei pathologischen Zuständen spielen. Die kürzliche Beschäftigung von Mausmodellen p16 INK4A -positiver seneszenten Zellen zu eliminieren , hat Forscher deutlicher erlaubt und schätzt genau die Rolle der seneszenten Zellen in Geweben und Organen 35, 36, 37. Diese Modelle haben aufgedeckt , dass alternde Zellen zu einer Vielzahl von altersbedingten Krankheiten, Tumorentstehung beitragen und Maus Lebensdauer 35 </ sup>, 36, 37. In Anbetracht dieser jüngsten Entdeckungen und die Validierung der Bedeutung von seneszenten Zellen in der Physiologie, ist die Zeit für mehr Forschung über diese speziellen Zellen reifen. Zum Beispiel unter Verwendung von Studien Strategien zum therapeutischen seneszenten Zellen zu entfernen oder Seneszenz zu verzögern sowohl für Gesundheitsspanne und Lebensdauer Studien von Nutzen sein könnte.

Kürzlich fand unser Labor , dass Metformin, ein Medikament häufig verwendet , um Typ - 2 - Diabetes mellitus zu behandeln, nimmt zelluläre Seneszenz 38. Da Metformin derzeit als Anti-Aging - Therapie vorgeschlagen und hat Anti-Krebs - Eigenschaften 39, 40, wird es in Zukunft interessant sein , zu untersuchen , ob dieses Medikament oder andere Alterungs Interventionen, Gesundheitsergebnisse beeinflussen durch zelluläre Seneszenz zu modulieren.

Die Protokolle wir hier diskutieren, sind häufig und weit verbreitet einccepted Techniken, um die seneszenten Phänotyp zu bewerten. Für Zellen in vitro gezüchtet, ist es entscheidend Zelle wechselt von einer spindelartigen auf eine abgeflachte Morphologie, um sicherzustellen , dass die Zellen , seneszenten sind (siehe Abbildungen 1 und 2) zu überwachen. Wenn Zellen nicht positiv sind für SA-β-gal oder anderen hier beschriebenen Marker, bewerten Seneszenz bei höheren Zell PDLs (für replikative Seneszenz) oder bei einem erhöhten Zeit nach DNA-Schädigung induzierte Seneszenz. Darüber hinaus müssen diese Protokolle können für verschiedene Zelltypen optimiert werden. SASP Proteinspiegel für die Bewertung ist es kritisch, das Serum aus dem Zellmedium zu entfernen, da diese hohe Hintergrundwerte in den ELISA oder Protein-Arrays verursacht. Deshalb denken Sie daran, wenn Experimente entwerfen, da es nicht für die gleichzeitige Beurteilung mehrerer Marker ideal sein kann.

Die Färbung für SA-β-gal, wie hier beschrieben ist, wird durch die Tatsache, dass es die Fixierung der Zellen erfordert.Darüber hinaus wurde Zellkonfluenz gezeigt SA-β-gal-Aktivität zu beeinflussen. Protokolle wurden entwickelt , SA-β-Gal - Aktivität unter Verwendung eines fluorogenen Substrat für β-gal - Aktivität zu bewerten, die unter Verwendung von Flow Cytometry 41 für die Quantifizierung dieses Markers in lebenden Zellen ermöglicht, 42, 43. SA-β-Gal - Aktivität kann auch in Zell - Lysaten gemessen werden , 44 ein chemilumineszentes Verfahren. Darüber hinaus kann auch γ-H2AX verschiedene andere Methoden gemessen werden, einschließlich der Durchflusszytometrie oder Immunoblotting von Zelllysaten 45.

Es soll beachtet werden , dass die Bildung SAHF Zelllinie abhängig ist , und wird meist in Verbindung mit Onkogen-induzierter Seneszenz 20, 30, 46. Daher kann nicht SAHF in allen Seneszenz Modellen vorhanden sein. Die NützlichkeitSAHF als seneszenten Marker in Mausmodellen auch dadurch begrenzt werden, dass SAHF wird im Allgemeinen nicht in Maus - seneszenten Zellen 30, 46, 47 beobachtet. Dabei werden Antikörper gegen H3K9Me2 wurden verwendet, aber auch andere molekulare Marker von SAHF können verwendet werden, einschließlich macroH2A, High Mobility Group A (HMGA) Proteine ​​und tri-methylierten Lysin 9 Histon H3 (H3K9me3) und gebundene HP1-Proteine. Bindungsproteine ​​zu E2F Zielgen Zusätzlich kann Chromatinimmunpräzipitation Assays verwendet werden, um Histon-Markierungen oder die Assoziation von Chromatin zu beurteilen.

Man sollte sich darüber im Klaren sein, dass es verschiedene Einschränkungen Seneszenz Charakterisierung einschließlich Heterogenität für Marker und die Tatsache, dass diese Marker nicht ausschließlich in seneszenten Zellen exprimiert wird. Mehrere (in der Regel 2 - 3) Marker sollte Seneszenz zu beurteilen, verwendet werden, einschließlich Markierungen hier nicht beschrieben. Zum Beispiel, DNA-SCARS, telomereSchäden und / oder Signalisierungs DNA-Schäden können auch quantifiziert werden. Ferner ist , wie Seneszenz und insbesondere, der Phänotyp SASP, wurde vor kurzem gezeigt worden , durch den spezifischen Stressor oder Beschädigung beeinträchtigt werden , die 11 Seneszenz induziert, 12, 13, ist es wichtig , mehrere Marker in jedem experimentellen Paradigma zu bewerten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Diese Studie wurde von der Intramural Research Program der National Institutes of Health, National Institute on Aging. Die Autoren möchten Myriam Gorospe und Kotb Abdelmohsen für viele hilfreiche Diskussionen über die Seneszenz und Kotb Abdelmohsen für auch kritisch Lesen des Manuskripts. Wir danken auch unser Labor Mitglieder, vor allem Douglas Dluzen für kritisch, das Manuskript zu lesen.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Techniken zur Induktion und Quantify Zelluläre Seneszenz
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter