Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

טכניקות כדי להשרות ולכמת סלולר הזדקנות

doi: 10.3791/55533 Published: May 1, 2017

Summary

הזדקנות תאית, המדינה ההפיכה של מעצר מחזור התא, יכולה להיגרם על ידי מדגיש הסלולר שונה. כאן, אנו מתארים פרוטוקולים לגרום הזדקנות תאית שיטות להערכת סמנים של הזדקנות.

Abstract

בתגובה ללחץ או נזק לתאים, תאי מתרבים יכול לגרום תוכנית ספציפית יוזם במצב של מעצר מחזור התא לטווח ארוך, כינה הזדקנות תאית. הצטברות של תאים מזדקנים מתרחשת עם והזדקנות האורגניזם ובאמצעות culturing המתמשך במבחנה. שתאים מזדקנים להשפיע על תהליכים ביולוגיים רבים, כולל התפתחות עוברית, תיקון רקמות התחדשות, דיכוי גידולים, והזדקנות. סימני היכר של תאים מזדקנים כוללים, אך אינם מוגבלים, פעילות β-galactosidase הזדקנות הקשורה מוגברת (SA-β-gal); רמות p16 INK4A, p53, ו p21; רמות גבוהות יותר של נזק לדנ"א, כולל H2AX γ; היווצרות מוקדי heterochromatin הקשורים הזדקנות (SAHF); ורכישת פנוטיפ הפרשה הקשורים הזדקנות (SASP), תופעה המאופיינת על ידי הפרשת מספר ציטוקינים פרו-דלקתיים מולקולות איתות. כאן, אנו מתארים פרוטוקולים הוא בשכפול הדנ"א ואתDNA נזק הנגרם הזדקנות תאים בתרבית. בנוסף, אנו מדגישים טכניקות כדי לפקח על הפנוטיפ senescent באמצעות מספר סמנים הקשורים להזדקנות, כולל SA-β-gal, γ-H2AX והכתים SAHF, ו לכמת רמות חלבון ה- mRNA של הרגולטורים מחזור התא וגורמים SASP. שיטות אלה ניתן להחיל את הערכה של הזדקנות במודלים ורקמות שונים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

לפני יותר מחצי מאה, Hayflick ועמיתיו תארו כיצד untransformed תאים להתרבות בתרבות, אבל רק עבור תקופה מוגבלת של זמן 1. תרביות של פיברובלסטים אדם לטווח ארוכים גורמות לתאים להפסיק מתרבים; עם זאת, הם היו מבחינה מטבולית פעילה, וזה נקרא הזדקנות תאית. הזדקנות יכולה להיות מועילה עבור עיכוב היווצרות גידול, אבל זה גם יכול להזיק, כפי שהוא חשב לתרום אובדן יכולת התחדשות המתרחשת עם 2 הזדקנות, 3. שתאים מזדקנים הוכחו להצטבר ברקמות כבני אדם בגיל 4 ו היו מעורבים מספר תהליכים ביולוגיים, כולל ההתפתחות העוברית, לריפוי פצעים, תיקון רקמות, ודלקות הקשורות לגיל 2.

passaging המתמשכת של תאים בתרבית המשרה הזדקנות בשכפול הדנ"א, אשר נקשרהטלומרים התשה וחוסר יציבות גנומית. מדגיש תא שונים, לרבות נזק לדנ"א אונקוגנים, יכול גם לגרום להזדקנות 3. הזדקנות נגרמת על ידי גורמים אחרים מלבד תשה הטלומרים נקראת לעתים מתח מושרה או הזדקנות מוקדמת וכן תלויה בדרך כלל על p16 INK4A / Rb המסלול 5. למרות מתרבה, תאי untransformed מופיעים בדרך כלל ציר בכושר, ניתן לזהות תאים מזדקנים כבעל מאפיינים מסוימים, כולל מורפולוגיה שטוחה, גדולה הקשורים להזדקנות מוגברת פעילות β-galactosidase (SA-β-gal) (איורי 1 & 2). שתאים מזדקנים גם לצבור סמנים לנזק לדנ"א, כולל γ-H2AX (איור 3) 6, ו, באופן פוטנציאלי, מוקדים heterochromatin הקשורים להזדקנות (SAHF) (איור 4) 7. יש שתאים מזדקנים רמות גבוהות יותר של רגולטורי מחזור התא, כולל p 16 (P16 INK4A) ו / או p21 ו- p53 (איור 5) 8, 9. יתר על כן, הנתונים האחרונים הראו כי שתאים מזדקנים יכולות להיות השפעות בלתי אוטונומית על ידי הפרשת מספר פרו-דלקתיות ציטוקינים chemokines נקרא פנוטיפ הפרשה קשורה-הזדקנות (SASP) 10. למרות תופעת SASP עשויה להשתנות מן סוג תא לסוג תא, באופן כללי, זה בא לידי ביטוי בגידול Interleukin-6 (IL-6), IL-8, גורם מגרת מושבת מקרופאג-גרנולוציט (GM-CSF), צמיחה, α אונקוגן מוסדר (GRO-α), ו Gro-β, בין היתר (איור 6). לחץ מסוים או ניזק המשרה הזדקנות עשוי גם להשפיע על הפנוטיפ פרשת 11, 12, 13. SASP ניתן לאתר על ידי מדידת רמות של חלבונים המופרשים באמצעות ELISAs או ציטוקינים / מערכים חלבוןs = "Xref"> 10, 14. למרות מנגנונים שלאחר תעתיק יכולים לווסת את רמות חלבון SASP 11, 15, 16, 17, שינויים ברמות mRNA יכול גם להתגלות במקרים רבים. שינויים אלה הם בדרך כלל יותר רגישים יותר קלים לכמת מ מדידות רמת חלבון. סמני ההזדקנות אחרים ניתן להעריך גם, כולל מוקדי הגרעין עיקש נזק לדנ"א, קטעי DNA הנקרא עם שינויים הכרומטין חיזוק הזדקנות (DNA-צלקות) 18, וסמנים אחרים שונים 3, 19, 20.

כאן, אנו מתארים שיטות נפוצות גרימת הזדקנות בתאים בתרבית וגם למדידת מספר סמנים של הזדקנות, כולל SA-β-גל, γ-H2AX, SAHF, ואת חלבון ה- mRNA של להזדקןNCE הקשורים מולקולות.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הזדקנות 1. התרמה בשכפול הדנ"א

  1. הפיברובלסטים דיפלואידי אדם נמוך מעבר הפשרה (למשל, WI-38 ו- IMR-90) או שורות תאים אחרות.
    הערה: הנה, הפיברובלסטים דיפלואידי האדם שימשו, אבל פרוטוקולים אלה יכולים לשמש כדי להעריך הזדקנות בסוגי תאים אחרים, כגון אנדותל, אפיתל, או תאי גזע mesenchymal. תנאי Culturing עשויים להיות מותאמים במיוחד סוגי התאים השונים המשמשים בשל שיעורי צמיחה שונים או תנאי גידול.
    הערה: תאים צריכים להיות מתרבים ויש להם מורפולוגיה ציר (ראה איור 1 עבור סכמטי באיור 2 עבור דוגמאות). באופן אידיאלי, התאים צריכים להיות רמת הכפלת אוכלוסין (PDL) של <30 בתחילת ניסויים כדי להימנע מצורך שתאים מזדקנים בשכפול הדנ"א אפשריים.
    1. חשבתי את PDL של התאים באמצעות היומן = PDL המשוואה הבאה (N f / N 0) / log2, כאשר f N הוא מספר התא הסופי <em> N 0 הוא המספר הראשוני של תאי זרע 21.
  2. תרבות WI-38 תאים בינוניים הנשר Modified של Dulbecco (DMEM) בתוספת 10% עוברית שור סרום (FBS), 1% חומצות אמינו חיוניות, ו 1% פניצילין / סטרפטומיצין.
  3. לגדל תאים IMR-90 DMEM בתוספת 10% FBS ו 1% פניצילין / סטרפטומיצין.
  4. לגדול כל התאים ב 37 ° C ו 5% CO 2. הרף לגדול בתאים ולפצל כל 2 - ד 4 כאשר התאים מגיעים ~ 70 - 80% המפגש. מעקב אחר מפגש תא באמצעות מיקרוסקופ אור. הימנע תאים עם מפגש גבוה, כמו זה יכול להשפיע על צמיחת תאים כתוצאה ממגע עיכוב.
  5. צג התאים תחת מיקרוסקופ אור על המראה המורפולוגי של תאים מזדקנים (ראה איורים 1 & 2) ועבור כשאין שינוי PDL מ-תרבות אחד למשנהו.

הזדקנות 2. DNA-induced נזק

    (למשל, WI-38, IMR-90, או סוג אחר התא) בצפיפות דלילה (כלומר ~ 300,000 תאים / 6 ס"מ צלחת) בתוך מיכל מתאים עבור סוג של ניתוח (כלומר צלחת 6 ס"מ עבור חלבון / סמנים RNA או צלחת 6-גם עבור מכתים SA-β-gal). השתמש מוקדם מעבר תאים צעירים מתרבים (<30 PDL) צלחת אותם כך התאים הם בערך 50 - 60% ומחוברים ביום הבא.
  1. הסר את מדיום הגידול באמצעות פיפטה מזכוכית מחוברת ואקום לשטוף את התאים על ידי הוספת תמיסת מלח 1x פוספט שנאגר (PBS). חזור על שלב זה עבור סכום כולל של שני שוטף. הוספת שכבה דקה של PBS (~ 750 μL עבור צלחת 6 ס"מ) הן תנאי "מדומה" מטופלים ועבור בקרינה מייננת (IR) מטופלים.
  2. השתמש irradiator גמא לחשוף תאים מנה בודדת של 10 גריי (Gy) של IR; מדובר בחשיפה אופייני שורות תאים ביותר. במנדף, להסיר את PBS ולהחליפה מדיום הגידול. לחילופין, לטיפול בתאים עם Bleomycin ב 20 מיקרוגרם / מ"ל ​​עבור 2 h.
  3. שינוי המדיום על תאים כל 48 -7 2 ​​h ולפצל את התאים במידת הצורך.
  4. צג התאים תחת מיקרוסקופ אור עבור שינויים מורפולוגיים (ראה איור 1 עבור סכמטי באיור 2 תמונות תא נציג) ו assay עבור סמני הזדקנות 7 - 10 ד לאחר טיפול IR.
    הערה: פרוטוקול זה מתאר הזדקנות המושרית על ידי IR. הזדקנות יכולה להיגרם גם על ידי מדגיש אחר, כוללים בליאומיצין (ראה לעיל עבור תנאים), H 2 O 2 22, 23, 24 תרופות כימותרפיות, עשן סיגריות 25, גורם גדילה הפיכה (TGF) -β1 26, 27, ושיטות אחרות 21 , 28, 29.

3. Cel המכתיםls עבור הקשורים הזדקנות β-galactosidase

  1. לפני מכתים, לבחון את התאים תחת מיקרוסקופ אור לפקח על שינויים מורפולוגיים.
    הערה: שתאים מזדקנים בדרך כלל הן מתפשטות ושטוח, בניגוד לתאים להתרבות, אשר יש מורפולוגיה ציר (ראה איור 1 עבור סכמטי באיור 2 עבור תוצאות נציג). תאים מתרבים יכולים לשמש כביקורת שלילית, ותאים שטופלו IR או אחר סוכן לפגוע-DNA (ראה סעיף 2) יכולים לשמש שולטים חיובי.
  2. לכמת פעילות SA-β-gal באמצעות ריאגנטים מ ערכה מסחרית (ראה טבלת החומרים). ההפשרה כל ריאגנטים מביאים לטמפרטורת החדר על ידי מתחמם אותם 37 מעלות צלזיוס.
    1. לחשב את הסכום של פתרון מכתים מקבע פתרון הכרחי.
      הערה: בדרך כלל, נפח 1 מ"ל מספיק טוב אחד צלחת 6-היטב. ניתן להשתמש בגדלים שונים צלחת, אבל בגודל צלחת 6-גם הוא well-מתאים לבצע assay בשלושה עותקים עבור כל תנאי. צפיפות זו בדרך כלל מספקת מספר מספיק של תאים לכל שדה לספור ללא שימוש מספר עודף של תאים.
    2. לדלל את 1:10 הפתרון המכתים עם מים מזוקקים.
    3. לדלל את הפתרון מקבע 01:10 עם מים מזוקקים.
    4. איפור פתרון המניות 20x של גל X (5-bromo-4-כלורו-3-indolyl-β-D-galactopyranoside) ב N, N-dimethylformamide (DMF; למשל, 20 מ"ג של גל X ב 1 מ"ל של DMF). כדי למקסם את השימוש בערכה, למדוד את X-gal לסכום הדרוש עבור כל assay ולאחר מכן להוסיף את הסכום המחושב של DMF להתמוסס. לחלופין, לאחסן פתרון המנייה ב -20 ° C בתוך שפופרת אור-מוגן עבור חודש אחד. השתמשו פוליפרופילן בלבד (אטום) צינורות לדילול ואחסון פתרונות-גל X.
    5. הכן פתרון מכתים β-gal: 930 μL של פתרון מכתים 1x, 10 μL של מכתים תוספת, 10 μL של B תוספת מכתים, ו 50 μL של 20 מ"ג / מ"ל ​​X-gal ב DMF. הכן תערובת מאסטר תלוי כמה בארות צריך להיות מוכתם.
  3. מוציאים בזהירות את המדיום מן התאים בעזרת פיפטה העברה או שווה ערך.
  4. לשטוף בעדינות את התאים פעם עם בטמפרטורת החדר 1X PBS.
  5. להוסיף 1 מ"ל של 1x פתרון מקבע היטב כל דגירה במשך 10 - 15 דקות ב RT.
  6. הסר את הפתרון מקבע עם טפטפת העברה.
    הערה: הפתרון מקבע (1x) מכיל 2% פורמאלדהיד 0.2% glutaraldehyde ו צריך להיות מסולק כמו פסולת מסוכנת על פי המלצות משרד הבטיחות במעבדה.
  7. לשטוף בעדינות את התאים פעמים עם PBS 1x.
  8. הסר את PBS לחלוטין ולהוסיף פתרון מכתים β-gal 1x אל בארות (1 מ"ל / גם צלחת 6-היטב). מכסים את הצלחת לחלוטין עם רדיד אלומיניום דגירה במשך 24 - 48 שעות ב 37 ° C חממה (רצוי בהעדר CO 2, כמו זה יכול להוריד את ה- pH של חיץ ולהשפיע מכתים).
    1. בדקו את התאים ב 24 h מכתים, ואם הכתם בהיר מדי, דגירה של 24 אחר h.
  9. לאחר זמן הדגירה, להסיר את הפתרון β-gal ולהחליפה PBS 1x.
    הערה: צעד זה מסיר חלק צבע הרקע כאשר הדמיה וגם מונע שפיכות מסוכנות של פתרון X-gal.
    הערה: משליכה את הפתרון β-gal כראוי, בהתאם להמלצות משרד הבטיחות במעבדה.
  10. בחן את התאים על מיקרוסקופ אור עם מצלמה מחוברת באמצעות מטרת 10x ומעלה; תאי SA-β-חיוב גל יהיו כחולים. רוכש את המספר הרצוי של תמונות לצורך הניסוי. אם סופר את אחוז תאי SA-β-חיוב גל, לרכוש את המספר המתאים של תמונות (> 5) כימות לכל טוב. ודא כי התמונות אינן חופפות מתחומים שונים של נוף בתוך כל טוב.
  11. ספירת SA-β-gal-חיובי (כחולה) תאים לעומת מספר תאים הכולליםכדי לחשב את אחוז תאי SA-β-gal-חיובי. רוזן> 100 תאים לכל מצב.
    הערה: תמונות נציג יכולות לשמש גם עבור דמויות. שים לב confluency התא הוא קריטי אם תאים לספור, כמו תאים רבים מדי יקשו לבדל כל תא מדי כמה לא יכול לתת מספר מספיק של תאים עבור כימות וסטטיסטיקה. תמונות עבור דמויות לפרסום הן ברזולוציה הטובה ביותר אם נשמרים כקבצים .tiff, למרות קבצים בפורמט JPEG מתאימים גם. תמונות צבע צריכות להיות 300 dpi.

4. תאים מכתימים עבור-H2AX γ

  1. פלייט התאים ממקטעים 1 או 2 על coverslips זכוכית צלחת 24-היטב.
  2. למחרת, לשטוף את התאים עם 1x PBS. יש לשטוף היטב, כפי שתאים מזדקנים לא ידבקו היטב coverslips וניתן להסירו בקלות במהלך שוטף. לחלופין, ישירות לתקן את התאים ללא שטיפה.
  3. הסר את PBS ולתקן את התאים עם פורמלדהיד 3.7% טריים PBS עבור10 דקות ב RT.
  4. הסר את הפתרון ואת permeabilize התאים עם 0.2% Triton X-100 ב PBS עבור 10 דקות.
  5. סר הפתרון וחסימת 5% FBS ב PBS עבור 2 שעות ב RT.
  6. דגירה עם אנטי phospho γ-H2AX (Ser139) ו המצומד FITC ב FBS 5% / PBS עבור 2 שעות ב 37 מעלות צלזיוס או O / N ב 4 ° C. להגן מפני אור.
  7. לשטוף 3 - 6x עם PBS ב 37 מעלות צלזיוס למשך כולל של 30 - דקות 60.
  8. כתם עם DAPI (מדולל 1: 15,000 ב PBS) עבור 10 דקות ב RT.
  9. Wash 3x עם PBS.
  10. מהר לשטוף עם מים כדי להסיר את המלחים ואת הר coverslip בשקופית זכוכית באמצעות 3 - 5 μL של antifade מגיב. לחלופין, להשתמש בפתרון הרכבה המכיל DAPI.
  11. תן לו להתייבש O / N ולדמיין את התא הצבעוני על מיקרוסקופ פלואורסצנטי או confocal באמצעות מטרת 63X ומעלה.
  12. לכמת את מוקדי γ-H2AX באמצעות אחת משתי השיטות המתוארות להלן. ציון לאף פרוטוקול ידי העין באמצעות מיקרוסקופ פלואורסצנטי. באופן אידיאלי, לנוEA confocal מיקרוסקופ. קח Z-סעיפים ומתעבים מטוס אחד בודד כדי להמחיש את כל המוקדים לזיהוי (תמונות נציג מכתימים γ-H2AX בתאים מתרבים ו senescent מוצגים איור 3). רוזן המוקדים ידי עין באמצעות תוכנת הדמיה; באופן כללי, ~ 100 - 200 גרעינים מספיקים לספור.
    1. כדי לכמת את אחוז התאים שיש מוקדים γ-H2AX חיובי, לספור כל תא שיש לו לפחות מוקד אחד גלוי ולחלק במספר הכולל של גרעינים מוכתמים DAPI.
    2. כדי לכמת את מספר מוקדים γ-H2AX, לספור את מוקדי γ-H2AX לכל תא.
      הערה: רמות של γ-H2AX עשוי להשתנות תלוי הדחק ספציפי או נזק שגרמו להזדקנות.

5. תאים מכתימים עבור סמני SAHF

הערה: שתאים מזדקנים האנושות יאלצו קרובות אזורי גרעין של DNA / הכרומטין מרוכז. בשנת שתאים מזדקנים, אלה אזורים הטרוכרומטיןנחשבים לעכב את הביטוי של גנים לקידום התרבות, כגון בני משפחה E2F. SAHF ניתן דמיינו ידי ארגון מחדש של DAPI; על ידי נוכחות של סימני היסטון הקשורים heterochromatin, כולל מתילציה-tri דוּ ושל Lys9 על היסטון H3 (H3K9Me2 ו H3K9Me3); ועל ידי חלבונים ארגון מחדש-הכרומטין, כולל heterochromatin HP1 חלבון 1 (HP1), הירה (א מדכא היסטון), ו ASF1a (פונקציה-1a אנטי השתקה) כדי הכרומטין 30. בחרנו להשתמש במודל הזדקנות מושרה-אונקוגן (OIS), כפי SAHF בולט יותר מודלי OIS 30. תאי IDH4 להתרבות בנוכחות dexamethasone בשל נוכחותם של אנטיגן T הגדול SV40 אבל להפוך senescent לאחר הסרת dexamethasone מן 31 הבינוניים. SAHF ניתן להבחין באמצעות מכתים DAPI ועל ידי צביעה עם נוגדנים כנגד הסמנים הספציפיים המפורטים לעיל. כאן, אנו מתארים מכתים DAPI ו H3K9Me2 עבור visualizatיון של SAHF בתאים 28.

  1. לגדל תאים IDH4 DMEM בתוספת 10% FBS, 1% פניצילין / סטרפטומיצין, ו dexamethasone 1 מיקרוגרם / מ"ל. כדי לגרום להזדקנות, להסיר את dexamethasone ולשנות את המדיום כך שהוא מכיל-הפשיט פחם FBS; לאחר הגוברת ~ 10 ימים במדיום החדש הזה, תאי IDH4 להפוך מזדקנים 31.
  2. תאי IDH4 פלייט או תאים ממקטעים 1 או 2, כמתואר לעיל, על coverslips זכוכית צלחת 24-היטב.
  3. למחרת, לשטוף את התאים עם 1x PBS. יש לשטוף היטב, כפי שתאים מזדקנים לא ידבקו היטב coverslips וניתן להסירו בקלות במהלך שוטף. לחלופין, ישירות לתקן תאים ללא שטיפה.
  4. הסר את PBS ולתקן את התאים עם פורמלדהיד 3.7% טריים PBS עבור 10 דקות ב RT.
  5. שוטפים את התאים 3 פעמים עם 1X PBS.
  6. הסר את הפתרון ואת permeabilize התאים עם 0.2% Triton X-100 ב PBS עבור 5 דקות.
  7. שוטפים את התאים עם 1xPBS. הסר את PBS ולחסום את coverslips ידי הוספת חיץ חסימת המכיל 3% BSA (w / v) ב PBS עבור 5 דקות ב RT. סנן תמיד פתרונות המכילים BSA לפני השימוש כדי להסיר חומר חלקיקים.
  8. הסר חוצץ חסימת דגירת התאים עם נוגדנים עיקריים נגד סמני SAHF כגון נוגדנים אנטי H3KMe2 (איור 4; ראה לוח חומרים לפרטים נוספים). לדלל את הנוגדנים במאגר חסימת דגירה במשך 1 - 2 שעות ב RT.
  9. הסר את פתרון הנוגדן הראשוני לשטוף את coverslips 3 פעמים עם 1% (v / v) טריטון X-100 ב PBS.
  10. לדלל את הנוגדנים משני חסימת חיץ (לוח חומרים) ו דגירה של 1 ש 'ב RT. להגן מפני אור.
  11. שוטפים את התאים פעמיים עם PBS 1x. כתם עם DAPI (מדולל 1: 15,000 ב PBS, ראה טבלת החומרים) עבור 10 דקות ב RT.
  12. שטפו את coverslips 3x עם 1x PBS.
    1. לשטוף עם מים במהירות כדי להסיר את המלחיםnd הר coverslip כל בשקופית זכוכית באמצעות 3 - 5 μL של antifade מגיב. לחלופין, להשתמש בפתרון הרכבה המכיל DAPI.
    2. בואו היבש O / N ולדמיין את התא הצבעוני על מיקרוסקופ פלואורסצנטי או confocal באמצעות מטרת 63X ומעלה (ראה תוצאות הנציג באיור 4). לכמת את SAHF כמפורט בסעיף 4.
      הערה: נוגדנים ראשוניים אלוטיפ או לא נוגדן ראשוני (כלומר משנית בלבד) אמורה לשמש כביקורת שלילית עבור מכתים immunofluorescence.

6. ניתוח הקשורים חלבוני הזדקנות ידי Immunoblotting

הערה: פנוטיפ senescent מתאפיין הגברת הביטוי של הרגולטורים מחזור התא, כולל p16 INK4A, p21, ו- p53. פרוטוקול זה יתאר את כימות של רמות של חלבונים אלה lysates תא. ניתן להשתמש בטכניקות אלה כדי להעריך מושרה הזדקנות באמצעות מגוון שלשיטות 21, 28, 29.

  1. להשרות הזדקנות תאית כמתואר בסעיפים 1 ו 2 או באמצעות שיטה אחרת 21, 28, 29. כדי לנתח סמנים תאיים הזדקנות, צלחת התאים במנות 6 ס"מ ולנתח הן את החלבון ואת RNA זמנית (ראה סעיף 7 לקבלת הוראות בידוד RNA).
  2. הסר את תרבית תאים בינוניים. שים את התאים על מגש של קרח.
    1. שוטפים את התאים 2 פעמים עם PBS 1x קר. הטה את המנה כדי להבטיח שכל PBS הוא aspirated כדי להיות מדויק ככל במונחים של כמויות המשמש ההליך.
    2. לאחר aspirating לשטוף האחרון של PBS, להוסיף 200 μL של PBS 1x קר (עבור צלחת 6 ס"מ) אל צלחת. גרד את התאים באמצעות מגרד תא.
    3. פיפטה את התערובת תא / PBS לתוך צינור RNase ללא עבור בידוד RNA. קח כ 150 &# 181; L של תערובת זו פיפטה אותו לתוך צינור חדש. aliquot זה ישמש לניתוח חלבון, ולכן מקפיד פיפטה אותה הכמות מצינור כל.
  3. Lyse את התאים על ידי הוספת 75 - 100 μL של חיץ מדגם של 2x Laemmli שונה (60 mM Tris-HCl pH 6.8, 12.5% ​​גליצרול, 2% SDS, 5% β-mercaptoethanol (BME), ו bromophenol כחול; יכול להיות מורכב כמו אצווה גדול, aliquoted, ומאוחסנים ב -20 ° C עד השימוש) או חיץ מדגם מקביל.
    1. לחלופין, lyse התאים ב -75 - 100 μL של חיץ תמוגה צנטריפוגות ב 15,000 XG במשך 10 דקות ב 4 ° C כדי להסיר את פסולת התא. הסר את supernatant פיפטה לתוך צינור נקי. Assay חלבון ברדפורד או assay חלבון שווה ערך ניתן להשתמש על lysates כדי להבטיח את הטעינה שווה של חלבון.
      הערה: מבחני חלבון לא יכול להתבצע על דגימות lysed במאגר מדגם.
    2. הוצא ~ 25 μL של lysate ולהוסיף אותו 15 μL של חיץ מדגם 2x. פיפטה למעלה לעשותwn במאגר מדגם כדי lyse התאים.
      הערה: כרכים של חיץ ימס או חיץ מדגם עשויים להיות מותאמים בהתאם מפגש תא. אם המדגם הוא "דביק" בשל lysing גרעיני, להוסיף עוד חיץ מדגם או PBS לדלל. דוגמאות ניתן לאחסן ב -20 ° C עד השימוש.
  4. מרתיחים את הדגימות למשך 5 דקות ב 95 מעלות צלזיוס על גוש חום (או ציוד שווה ערך) ואת עומס ~ 40 μL של מדגם lysed במאגר מדגם על ג'ל 18% טריס-גליצין.
    הערה: ג'ל שיפוע (4-15%) או ג'ל 14% טריס-גליצין הם גם מספיק לזיהוי חלבונים בעלי משקל מולקולרי נמוך. סוגים שונים של ג'ל acrylamide יכולים לשמש גם, אך להבטיח כי ג'לים המערכת מספיקים לזיהוי חלבונים בעלי משקל מולקולריים נמוכים.
    1. הפעל באמצעות חיץ ריצה 1x בכל 100 V קבוע במשך 20 דקות (דרך ג'ל הערמה) ו ~ 60 דקות ב 180 V. נטר הג'ל כך בחזית לצבוע רק בורח או בתחתית הג'ל כך מולקולרי נמוך חלבוני משקל לא rהאו"ם הנחה של ג'ל.
  5. מעבירים את הג'ל acrylamide אל קרום PVDF (pre-ספוג עם 100% מתנול להפעלה). אם עושה העברה רטובה, רק 1 h נדרשת העברה (לעומת נורמלי ~ 1.75 ח). התאם בהתאם למערכת ההעברה המתאימה; באמצעות סמני משקל מולקולריים טרום מוכתם יכול לסייע בהערכת יעילות העברה.
  6. לשטוף את הממברנה במים. השתמש כתם Ponceau כדי לפקח על ההעמסה השווה של דגימות. שטפו את Ponceau עם מים לסירוגין.
    1. חסום את הממברנה ב 5% דל שומן יבש החלב TBST (50 mM Tris-HCl 7.5 pH, 150 מ"מ NaCl, ו 0.1% Tween-20) עבור 1 ש 'ב RT או O / N ב 4 ° C עם תסיסה.
  7. Wash למחוק פעם עם TBST ו דגירה עם נוגדן ראשוני מדולל TBST חלב 5% (ראו טבלה חומרים עבור דילולים והמלצות נוגדן) עבור 1 ש 'ב RT.
  8. בצע שתי שטיפות מהירות עם TBST ולאחר מכן לשטוף פעמים על שייקר עבור סכום כולל של ~ 30 דקות '(~ 15 דקות כל אחד היהח).
  9. דגירה עם נוגדנים משני עבור 40 דקות ב RT. חזור על שלב 6.10.
  10. דגירה עם מצע כתם המערבי טרי ולפתח את הסרט או לקרוא אותו על קורא chemiluminescence.
  11. Immunoblot Probe עם נוגדנים INK4A p16 הראשון (איור 5). להפשיט את הממברנה על ידי דוגרים במשך 15 דקות עם מים, 15 דק 'עם 0.2 N NaOH, ולאחר 15 דקות עם מים. המשך עם שלב 6.9 באמצעות נוגדנים אנטי-P21.
  12. להפשיט את הממברנה באמצעות 62.5 מ"מ טריס-HCl pH 6.8 ו 2% SDS עם 300 μL של BME טרי הוסיף לכל 50 מ"ל של הפשטה פתרון.
  13. לדגור על 50 מעלות צלזיוס למשך 30 דקות ולשטוף בהרחבה עם כפות ואז TBST. בדיקה עם נוגדנים נגד אקטין או אנטי-GAPDH לבקרות חלבון-טעינה (איור 5 מציג תוצאות נציג).
    הערה: רמות ה- p53 ניתן להעריך גם על אותו ממברנות. עם זאת, מאז p53 הוא משקל מולקולרי גבוה, היא נפתרת טובה יותר על ג'ל נמוך אחוז (למשל,

7. ניתוח רמות ה- mRNA של סמנים הזדקנות

הערה: כאשר בידוד RNA, להבטיח כי משטחי העבודה מנקים עם פתרונות להסרת RNase או שווה ערך, וכי החומרים הם כל RNase חינם.

  1. באמצעות תערובת התא / PBS משלב 4.2, להוסיף 1 מיליליטר של תמיסת מיצוי RNA מערבולת של 30 s (לא אמור להיות גושים גלויים או פסולת הסלולר).
  2. הוספת 200 μL של כלורופורם ולנער במרץ למשך 15 s.
  3. צנטריפוגה במהירות מקסימלית (> 15,000 XG) במשך 15 דקות ב 4 °.
  4. הסר ~ 400 μL של השכבה המימית RNA העליון פיפטה אותו לתוך צינור microfuge חדש.
  5. הוספת 400 μL של isopropanol (1: 1 עם הנפח הכולל של השכבה המימית pipetted בשלב הקודם) ו 4 μL של יחסי ציבורecipitant לשכבת RNA.
  6. צנטריפוגה 15-30 דקות במהירות מרבית (> 15,000 XG) ו 4 ° C עד גלולת RNA.
  7. הסר supernatant ולהוסיף 1 מ"ל של 75% אתנול קר כקרח.
  8. צנטריפוגה 1 דקות במהירות המרבית (> 15,000 XG) ו 4 מעלות צלזיוס.
  9. הסר supernatant ו צנטריפוגות עבור 1 דקות במהירות המרבית (> 15,000 XG) ו 4 מעלות צלזיוס.
  10. פיפטה את הנוזל ככל האפשר יבש ואוויר עבור 2 דקות.
  11. Re- להשעות ב 10 μL של 10x חיץ DNase, 85 μL של H 2 O, ו 5 μL של DNase 1.
  12. לדגור על 37 מעלות צלזיוס למשך 30 דקות.
  13. הוספת 200 חיץ μL NT2 (50 mM Tris-HCl pH 7.4, 150 מ"מ NaCl, 1 מ"מ MgCl 2, ו 0.05% Nonidet P-40) ולהוסיף 300 μL של השכבה התחתונה של חומצה פנול-CHCl 2.
  14. וורטקס 1 דקות ו צנטריפוגות בטמפרטורת החדר למשך 5 דקות במהירות המרבית (> 15,000 XG).
  15. אסוף 250 μL של השכבה העליונה RNA (2 x 125 μL), להוסיף 25μL של 3 M pH יצטטו נתרן 5.2, 625 μL של אתנול קר כקרח 100%, ו 5 μL של נמהר. מערבבים היטב המשקע O / N ב -20 מעלות צלזיוס.
  16. למחרת, לערבב ספין במהירות המרבית (> 15,000 XG) ו 4 מעלות צלזיוס למשך 30 דקות וזורקים supernatant.
  17. חזור על שלבים 6.8-6.11.
  18. Re- להשעות את הגלולה ב 12 μL של מי nuclease ללא ולאחסן ב -80 ° C עד שימוש.
    הערה: נהלי בידוד RNA אחרים וערכות יכולים לשמש גם.
  19. בצע שעתוק לאחור עם hexamers האקראי SSII הפוכה transcriptase פי הפרוטוקול של היצרן.
    הערה: לאור הכמות הנמוכה של RNA שבודד שתאים מזדקנים, עדיף להשתמש בכל RNA (12 μL) לסינתזת השעתוק לאחור. לחלופין, RNA ניתן לכמת באמצעות ספקטרופוטומטר, וכן כמויות שוות של RNA יכול לשמש שעתוק לאחור.
  20. לנתח את רמות ה- mRNA באמצעות כמותי בזמן אמת qPCR (RT-qPCR) amplification ואת תערובת הורים SYBR ירוק PCR עם פריימרים גן ספציפי.
    1. כמו תגובה RT-qPCR טיפוסי, לדלל את 1:30 cDNA (ב RNase / DNase ללא מים) ולהוסיף 3 μL לצלחת 96 היטב בזמן אמת עבור דיוק pipetting טוב יותר. הכן תערובת הורים התגובה של גנים ספציפיים קדימה לאחור תחל (2.5 ריכוז מיקרומטר, להוסיף 5 μL / תגובה), לערבב PCR-ירוק SYBR (6.25 μL / תגובה; להשתמש פחות המלצת היצרן), ו 5.75 μL של RNase / מים DNase-חינם עבור נפח תגובה הסופי של 20 μL (17 μL של פריימרים / SYBR ירוק / מים 3 μL של cDNA).
    2. בצע הגברת RT-qPCR באמצעות מכונת PCR בזמן אמת; בצע את הפרוטוקול של היצרן.
      הערה: רשימה של האדם תוקף קדימה לאחור תחל בזמן אמת ניתן למצוא בטבלה 1. גנים אלה כוללים חלבוני SASP וסמני הזדקנות הקשורים אחרים ו / או גנים. תוצאות נציגת ההזדקנות מושרת IR מוצגות

8. רמות חלבון כימות SASP

  1. להשרות הזדקנות באמצעות סעיפים 1 או 2 או בשיטה אחרת. פלייט התאים על 6 או 10 או צלחות ס"מ, כמתואר לעיל (~ 250,000 תאים / 6 צלחת ס"מ או ~ 650,000 / 10 צלחת ס"מ).
  2. כך או עם תאי 10 טיפול לפוסט-IR או עם שתאים מזדקנים בשכפול הדנ"א (ותאי בקרה נאותים), לשטוף את התאים שלוש פעמים עם 1X PBS ולהוסיף סרום ללא בינוני עם אנטיביוטיקה בנפח קטן (2.5 מ"ל עבור 6 ס"מ או 5 מ"ל עבור 10 ס"מ).
  3. דגירה לילה בשעה 37 ° C ו 5% CO 2 באינקובטור בתרבית רקמה. למחרת, לאסוף את המדיום ולשים אותו צינור חרוטים על קרח.
  4. שוטפים את התאים 2 פעמים עם PBS ולאחר מכן להוסיף 1 מ"ל של טריפסין (עבור צלחת 6 ס"מ). ספירת התאים באמצעות hemocytometer כדי מאוחר להתאים את הריכוזים פי מספר תא.
  5. צנטריפוגה בינוני עבור 5 דקות ב 300 גרם x.
  6. Filtאה המדיום באמצעות מסנן מזרק 0.45 מיקרומטר.
  7. Aliquot המדיום ולהקפיא ב -80 ° C עד שימוש או assay ישירות באמצעות ELISA או מבחנים מקבילים.
  8. חשב את מספר התאים / ריכוז מ"ל ידי לקיחת המספר / נפח תא הכולל של המדיום שנאספו.
  9. בצע assay immunosorbent המתאים enzyme-linked (ELISA) על פי הוראות היצרן. ראה טבלת חומרים עבור ערכות ELISA מומלצות מנסה לאמוד על IL-6, IL-8, GROα, וציטוקינים אחרים / וכמוקינים (איור 6).
  10. כדי להבטיח כי הגורמים נמדדים נמצאים בטווח הליניארי של ערכת ELISA, לעשות דילולים של המדיום הסלולרי מזדקן לעומת המדיום הסלולרי מתרבה. חשבון עבור דילולים אלה ואת הנפח בעת חישוב הסכום של IL-6. כדי לרכוש בסכום של IL-6 מופרש לכל תא ליום, לחשב את ערך IL-6 המתקבל הערכה (ב PG) לכל ריכוז תא מדולל מיליליטר (frאום צעד 7.8).
    הערה: שיטות אחרות, כגון מערכי ציטוקינים, שניתן להשתמש בהם כדי לזהות רמות החלבון SASP ועלול להיות מתאים להקרנה מספר רב של גורמים SASP. רמות החלבון של גורמי SASP עשויות להשתנות בהתאם הזמן לאחר אינדוקצית הזדקנות, סוג התא, או הסוג של הזדקנות המושרית.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

איורים 2 - 6 להראות תוצאות נציג מכתים SA-β-gal; מכתים עבור γ-H2AX ו SAHF; הערכת רמות החלבון p16 של INK4A, p21, ו- p53; ו mRNA ורמות חלבון של מולקולות senescent קשור. SA-β-gal מכתים מוגברת מתרחשת עם הזדקנות בשכפול הדנ"א ואת DNA-induced נזק. כמו כן, לבחון את השינויים המורפולוגיים המתרחשות עם הזדקנות. התאים הופכים מוגדלים שטוח לעומת מראה הציר של פיברובלסטים מתרבים. עבור פרדיגמה ניסויית זו, תאים היו מוכתמים RNA / חלבון בודד 7 ד לאחר חשיפת IR. תוצאות נוספות חזקות עלולות להתרחש על ידי מחכה כבר לאחר חשיפת IR (כלומר 10 ד). תנאים צריכים להיקבע עבור כל תנאי התקנה ניסיונית. תוצאות אלו יציגים ונוגעים סמנים אלה יכול גם להתגלות כאשר הזדקנות מושרה באמצעות שיטות אחרות.

her.within-page = "1"> לקבלת איור 6, שמות גן רשומים ו מתאים CXCL1 (GROα), CXCL2 (GROβ), ו CSF2 (GM-CSF). גברת הביטוי של רמות ה- mRNA של כמה, אבל לא כולם, של גורמי SASP נצפתה לאחר הזדקנות מושרה IR ב WI-38 תאים. תעתיקי הזדקנות הקשורים אחרים, כולל CDKN1A (מקודד p21) ו CDKN2A (מקודד INK4A p16), היו שהוגברו. תעתיקים אחרים (EDN1 ו ANKRD1) יש גם נכללו הוכחו בעבר להיות גבוהים ב שתאים מזדקנים 15. פריימרים מפורטים בטבלה 1.

איור 1
איור 1: מתרבים ו senescent פיברובלסטים. ייצוג סכמטי של מתרבים (משמאל) מזדקנים (מימין) פיברובלסטים. דוגמאות מעוררות הזדקנות מוצגות יהתיבת llow. ההזדקנות קשורה לרמות גבוהות יותר של סמנים המצוינים. SA-β-gal, פעילות β-galactosidase הקשורים להזדקנות; SASP, פנוטיפ הפרשה הקשורים להזדקנות; SAHF, מוקדי heterochromatin הקשורים להזדקנות; DDR, בתגובה DNA נזק. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו

איור 2
איור 2. מאפיינים מורפולוגיים ופעילות SA-β-gal מוגברת של תאים מזדקנים. WI-38 תאים, או מתרבים "צעיר" (PDL 27), senescent בשכפול הדנ"א (PDL 40), או מי שהיה חשוף (IR) קרינה מייננת, הוכתמו לפעילות SA-β-gal. IMR-90 תאים, או מתרבים "צעיר" (PDL 30), senescent בשכפול הדנ"א (PDL 52), או אלה החשופים לקרינה מייננת (IR), היו STAשאינו עומד לפעילות SA-β-gal. סעיפים 1 - 2 לתאר גרימת בשכפול הדנ"א והדנ"א הזדקנות המושרה נזק, וסעיף 3 מסביר מכתים עבור SA-β-gal. תאים הוכתמו 7 ד לאחר IR. קון, מלא. בר סולם = 50 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
איור 3. גברת γ-H2AX מוקדים ב שתאים מזדקנים. WI-38 תאים, או מתרבים "צעיר" (PDL 30) או senescent בשכפול הדנ"א (PDL 53), קובעו ונצבעו עם נוגדנים אנטי-γ-H2AX ו DAPI. הערה העלייה במספר מוקדים γ-H2AX ב שתאים מזדקנים. תמונות התקבלו על מיקרוסקופ confocal. Z-סעיפים נלקחו, ואת הקרנת העוצמה המרבית שימש כדי לקבל תמונה המטוס אחת, כדי להציג את כל detecמוקדי שולחן. בר סולם = 20 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 4
איור 4. מכתים פלורסנט של SAHF ב שתאים מזדקנים. (א) מתרבים WI-38 תאים (PDL 27) היו מטופלים או להיחשף לקרינה מייננת (IR). לאחר 10 ימים, התאים היו מוכתמים DAPI לדמיין SAHF (לב מכתים DAPI צפוף / punctate בתאים שטופל IR) (B) IDH4 גדל בנוכחות dexamethasone (מתרבה) או ב FBS-הפשיט פחם לגרום להזדקנות ( מזדקן). אחרי 10 ד, התאים הוכתמו נוגדנים נגד H3K9Me2 ו DAPI. תמונות התקבלו על מיקרוסקופ confocal. Z-סעיפים נלקחו, ואת הקרנת מקסימום בעצימות שמשה להשיג מטוס בודדתמונה. מתרבים התאים (א) ו- (ב) יש מכתים DAPI דיפוזי, בעוד שתאים מזדקנים יש מכתים DAPI punctate. (ב '), תאים מלאים יש דיפוזי, מכתים מאוד אור עבור H3K9Me2, ואילו מכתים H3K9Me2 הוא יותר חזק colocalizes עם מוקדי DAPI מוכתם ב שתאים מזדקנים. בר סולם = 20 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 5
כימות איור 5. של חלבונים הקשורים הזדקנות. חלבון שבודד "צעיר" או מתרבים (30 PDL) IMR-90 תאים (-) או IMR-90 תאים שנחשפו 10 Gy של קרינה מייננת (IR). המדיום שונה בכל 48 שעות ולאחר התאים היו lysed 7 ד לאחר IR. דוגמאות נותחו על ידי SDS-PAGE, immunoblotted עם antibo INK4A אנטי-P16מת, ו-חקר מחדש עם-P21 אנטי ואז נוגדנים אנטי-p53. GAPDH שמש כביקורת טעינת חלבון. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 6
כימות איור 6. של תעתיקים הקשורים מהזדקנות חלבוני SASP. (א) RNA שבודד "צעיר" או מתרבים (PDL 27 או 34) WI-38 תאים (-) או WI-38 תאים שנחשפו 10 Gy של קרינה מייננת (IR). המדיום השתנה כל 48 h ובידוד RNA בוצע 7 ד לאחר IR. RT-qPCR שמש לכמת את הרמות של תעתיקי ההזדקנות קשורה הצביעו באמצעות פריימרים ספציפי הגן מפורט בטבלת 1. רמות 18S שימשו עבור נורמליזציה. היסטוגרמות מייצגים את t המנורמל הממוצעo מטופל ± SEM מ 5 ניסויים עצמאיים. (ב) WI-38 תאים (PDL 26) נחשפו 10 Gy של IR; 10 ד לאחר מכן, המדיום הוחלף בינוני סרום ללא (ראה סעיף 7). לאחר 24 שעות, בינוני מותנה נאסף IL-6, IL-8, ו GROα רמות כומתו באמצעות מבחני ELISA. ההיסטוגרמה מייצג את ממוצע ± SEM מ 3 ניסויים. * P <0.05 ו *** P <0.001 ידי מבחן t. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

פריימרים אנושים קָדִימָה לַהֲפוֹך
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (P21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (P16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG מהפקולטה לרוקחות אוכלים CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

טבלה 1: RT-qPCR צבעי יסוד התעתיקים קשורים הזדקנות. פורוורד פריימרים ההפוך עבור RT-qPCR באמצעות טכנולוגיית SYBR הירוק מסומן.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הנה, יש לנו תיאר שיטות להזדקנות המושרה-נזק לדנ"א בשכפול הדנ"א ושימוש פיברובלסטים דיפלואידי האנושי. בנוסף, טכניקות לכימות חלבון רמות ה- mRNA של חלבונים שונים הקשורים להזדקנות כלולים, כמו גם מכתים עבור SA-β-gal ועבור סמן DNA נזק γ-H2AX. ניתן פרוטוקולים אלה בשימוש נרחב כדי להעריך פנוטיפים senescent היא במבחנת in vivo, למרות אזהרות רבות קיימות לאפיון הזדקנות in vivo 20. תאים אחרים עשויים לבטא סמני הזדקנות, גם אם הם לא שתאים מזדקנים. לדוגמה, תאים כגון osteoclasts ויש מקרופאגים רמות גבוהות יותר של פעילות β-gal 32, 33. בנוסף, תאים סרטניים רבים שהוגברו p16 INK4A 34. תאים יכולים גם לצבור נזק לדנ"א (למשל, γ-H2AX מוקדים) ולא להיות מזדקנים. גורמים SASP יכול גם להיות upregulated ידיפיסיולוגי שונה או במצבים פתולוגיים שעשויים או לא עשוי להיות כרוך שתאים מזדקנים. לכן, סמני הזדקנות מרובים צריכים להיות מנוצלים, במיוחד כאשר מעריכים הזדקנות in vivo.

למרות שתאים מזדקנים נמצאו להיות מוגברת ברקמות נורמליות הזדקנות יותר מ 20 שנים לפני 4, זה רק עכשיו כי אנחנו לגמרי הם מתפעלים את שלל התפקידים שתאים מזדקנים לשחק בשני הומאוסטזיס הרקמה נורמלי במצבים פתולוגיים. ההעסקה האחרונה של מודלי עכבר כדי לחסל p16 INK4A שתאים מזדקנים -positive אפשרה לחוקרים יותר בבירור ובאופן מדויק להעריך את התפקיד של תאים מזדקנים ברקמות ואיברים 35, 36, 37. מודלים אלה חשפו כי שתאים מזדקנים לתרום שפע של פתולוגיות הקשורות לגיל, tumorigenesis, ועכבר תוחלת חיים 35 </ sup>, 36, 37. בהתחשב הגילויים האחרונים הללו ואת אימות לחשיבות שתאים מזדקנים בפיזיולוגיה, זה הזמן עבור מחקר נוסף על תאים ספציפיים אלה. לדוגמא, מחקרי העסקת אסטרטגיות כדי להסיר תאים מזדקנים טיפולי או לעכב הזדקנות יכולה להועיל הן מחקרי healthspan ואת תוחלת חיים.

לאחרונה, במעבדה שלנו נמצאת מטפורמין כי, תרופה המשמשת בדרך כלל לטיפול בסוכרת סוג 2, פוחתת הזדקנות תאית 38. כמו מטפורמין נמצא כרגע המוצע כטיפול אנטי-אייג'ינג ויש לו תכונות אנטי-סרטני 39, 40, זה יהיה מעניין בעתיד לחקור אם התרופה הזו, או התערבויות הזדקנות אחרות, להשפיע תוצאות בריאותיות ידי ויסות הזדקנות תאית.

הפרוטוקולים אנו דנים כאן הם נפוצים היקף שותףטכניקות ccepted להעריך את הפנוטיפ מזדקן. עבור תאים שגודלו בתנאי מעבדה, חשוב לעקוב אחר שינויים בתא מתוך ציר דמוי מורפולוגיה פחוסה מנת להבטיח כי התאים הם מזדקנים (ראו איורים 1 & 2). אם התאים אינם חיוביים עבור SA-β-gal או סמנים אחרים המתוארים כאן, להעריך הזדקנות בבית PDLs התא גבוה (להזדקנות בשכפול הדנ"א), או בזמן לא גדל לאחר הזדקנות המושרה נזק לדנ"א. בנוסף, פרוטוקולים אלה ייתכן שיהיה צורך אופטימיזציה עבור סוגי תאים שונים. להערכת רמות חלבון SASP, חשוב להסיר את בסרום מן המדיום הסלולרי, כמו זה יגרום רמות רקע גבוהות מערכי ELISA או חלבון. לכן, לשמור את זה בחשבון בעת ​​תכנון ניסויים, כפי שהוא לא יכול להיות אידיאלי עבור הערכת סמנים מרובים בו זמנית.

מכתים עבור גל SA-β, כפי שמתואר כאן, היא מוגבלת על ידי העובדה שהוא דורש קיבוע של תאים.בנוסף, מפגש תא הוכח להשפיע פעילות SA-β-gal. הפרוטוקולים פותחו כדי להעריך את הפעילות SA-β-גל באמצעות מצע fluorogenic לפעילות β-gal, אשר מאפשרת כימות של סמן זה בתאים חיים באמצעות זרימת cytometry 41, 42, 43. פעילות SA-β-gal יכול להימדד גם lysates תא באמצעות שיטה chemiluminescent 44. בנוסף, γ-H2AX ניתן גם למדוד בשיטות שונות אחרות, כולל זרימת cytometry או immunoblotting של lysates תא 45.

יצוין כי היווצרות SAHF היא שורת תאים תלויה ובלתי מזוהה בעיקר עם 20 הזדקנות מושרה אונקוגן, 30, 46. לכן, SAHF לא יכול להיות נוכח בכל הדגמים הזדקנות. כלי השירות שלSAHF כסמן senescent בעכברי מודל עלול גם להיות מוגבל על ידי העובדה כי SAHF לא נצפו כלל בתאים מזדקנים עכבר 30, 46, 47. הנה, נוגדנים נגד H3K9Me2 שימשו, אבל סמנים מולקולריים אחרים של SAHF יכול לשמש, כולל macroH2A, קבוצה ניידות גבוהה A (HMGA) חלבונים, ו- H3 היסטון Tri-מתיל-ליזין 9 (H3K9Me3) וחלבונים HP1 כבול. בנוסף, מבחני immunoprecipitation הכרומטין יכולים לשמש כדי להעריך סימני היסטון או איגוד הכרומטין מחייב חלבונים לגני יעד E2F.

אחד צריך להיות מודע כי ישנן מגבלות שונות באפיון הזדקנות, כולל ההטרוגניות עבור סמנים והעובדה סמנים אלה אינם באים לידי ביטוי אך ורק בתאים מזדקנים. מרובה (בכלל, 2 - 3) סמנים צריכים להיות מועסקים על מנת להעריך הזדקנות, כוללים סמנים לא המתוארת כאן. לדוגמה, DNA צלקות, הטלומריםנזק, ו / או איתות נזק לדנ"א ניתן לכמת גם. יתר על כן, כפי מהזדקנות, בפרט, את הפנוטיפ SASP, הוכח לאחרונה להיות מושפע מלחץ ספציפי או נזק משרה הזדקנות 11, 12, 13, חשוב להעריך סמנים מרובים בכל פרדיגמה ניסויית.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים אין לחשוף.

Acknowledgments

מחקר זה נתמך על ידי התכנית העירונית המחקר של המכון הלאומי לבריאות, המכון הלאומי להזדקנות. המחברים מבקשים להודות מרים Gorospe ו קוטב Abdelmohsen לדיונים רבים מועילים על הזדקנות ובין הקוטב Abdelmohsen עבור אנוש גם לקרוא את כתב היד. אנו מודים גם אנשי המעבדה שלנו, במיוחד דאגלס Dluzen עבור האנושות לקרוא את כתב היד.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
טכניקות כדי להשרות ולכמת סלולר הזדקנות
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter