Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Методы индуцируют и Quantify Cellular Старение

doi: 10.3791/55533 Published: May 1, 2017

Summary

Клеточное старение, необратимое состояние остановки клеточного цикла, может быть вызвано различными клеточными напряжениями. Здесь мы описываем протоколы для индукции клеточного старения и методов оценки маркеров старения.

Abstract

В ответ на клеточный стресс или повреждения, пролиферирующие клетки могут вызвать определенную программу, которая инициирует состояние долгосрочной остановки клеточного цикла, называемую клеточным старение. Накопление стареющих клеток происходит с организменном старения и за счет непрерывного культивирования в пробирке. Стареющие клетки влияют на многие биологические процессы, в том числе эмбрионального развития, ремонта и регенерации тканей, подавление опухоли, и старение. Клейма стареющие клетки включают в себя, но не ограничиваются ими, увеличилась Старение-ассоциированные β-галактозидазы (SA-бета-гал); р16 Ink4a, p53, p21 и уровней; более высокие уровни повреждений ДНК, в том числе гамма-H2AX; формирование Старение-ассоциированного гетерохроматина очагах (SAHF); и приобретение старении-ассоциированной секреторного фенотипа (SASP), явление, характеризующееся секреции ряда провоспалительных цитокинов и сигнальных молекул. Здесь мы описываем протоколы для обоих репликативной иПовреждения ДНК-индуцированное старение в культивируемых клетках. Кроме того, мы выделим методу для мониторинга стареющего фенотипа с использованием несколько старения-ассоциированными маркеров, включая SA-бету-гала, гамма-H2AX и SAHF окрашивание и количественную оценку уровней белка и мРНК регуляторов клеточного цикла и SASP факторов. Эти методы могут быть применены к оценке старения в различных моделях и тканях.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Более полувека назад, Хейфлик и его коллеги описали , как нетрансформированный клетки пролиферируют в культуре, но только в течение ограниченного периода времени 1. Долгосрочное культивирование человеческих фибробластов вызвало клетку, чтобы остановить пролиферирующие; однако, они были метаболически активными, и это называлось клеточное старение. Старение может быть полезным для ингибирования онкогенеза, но она также может быть вредно, так как это , как полагают, способствуют потере регенерационной способности , что происходит со старением 2, 3. Стареющие клетки , как были показаны, накапливается в тканях , как люди возраст 4 и участвуют в ряде биологических процессов, в том числе эмбрионального развития, заживления ран, восстановления тканей, а также связанные с возрастом воспаления 2.

Постоянные пассажи клеток в культуре индуцирует репликативное старение, который был связанна теломер истощение и нестабильность генома. Различные напряжения клеток, в том числе повреждения ДНК и онкогенов, могут также вызвать старение 3. Старение вызвано другими , чем теломер истощение факторов часто называют стрессом-индуцированным или преждевременным старением и , как правило , зависит от р16 Ink4a / Rb пути 5. Несмотря на то, пролиферирующих, нетрансформированные клетки обычно появляются шпиндель в форме, стареющие клетки могут быть идентифицированы как имеющие определенные характеристики, в том числе плоскую, большую морфологию и повышенную старении-ассоциированной β-галактозидазы (SA-β-гал) (фиг.1 и 2). Стареющие клетки также накапливаются маркеры повреждения ДНК, в том числе гамма-H2AX (рисунок 3) 6, и, потенциально, Старение-ассоциированные гетерохроматина очаги (SAHF) (Рисунок 4) 7. Стареющие клетки имеют более высокие уровни регуляторов клеточного цикла, в том числе р 16 (р16 INK4A) и / или р21 и р53 (рисунок 5) 8, 9. Кроме того, недавние данные показали , что стареющие клетки могут иметь неавтономных эффекты, секретирующие ряд про-воспалительных цитокинов и хемокинов называется Старение-ассоциированный секреторной фенотип (SASP) 10. Хотя это явление SASP может варьироваться в зависимости от типа клеток типа клеток, в общем, это свидетельствует увеличение интерлейкина-6 (ИЛ-6), ИЛ-8, гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF), growth- регулируемый онкогена α (GRO-α), а также GRO-β, среди других (рисунок 6). Частности , стресс или повреждение , которое вызывает старение может также влиять на секреторную фенотип 11, 12, 13. SASP может быть обнаружен путем измерения уровней секретируемых белков с помощью ELISA, или цитокина / белковых массивовs = "Xref"> 10, 14. Хотя пост-транскрипционные механизмы могут регулировать уровни белка SASP 11, 15, 16, 17, изменения в уровне мРНК также могут быть обнаружены во многих случаях. Эти изменения, как правило, более чувствительны и проще, чем для количественного измерения уровня белка. Другие стареющие маркеры также могут быть оценены, включая стойкие повреждения ДНК ядерных очаги, называемые сегменты ДНК с хроматином изменениями армирующих старения (ДНК-Рубцы) 18, а также различных другими маркерами 3, 19, 20.

Здесь мы опишем общие методы для индукции старении в клетках в культуре, а также для измерения нескольких маркеров старения, включая SA-бета-Gal, гамма-H2AX, SAHF, и белок и мРНК стареютсть-ассоциированных молекул.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. побуждающих Репликативного Старение

  1. Оттаивания низкого прохода фибробласты диплоидного человека (например, WI-38 и IMR-90) или другие клеточные линии.
    Примечание: В данном случае были использованы диплоидные фибробласты человека, но эти протоколы могут быть использованы для оценки старении в других типах клеток, таких как эндотелиальные, эпителиальные или мезенхимальные стволовые клетки. Культивирование условие может быть оптимизировано для различных типов клеток, используемых в связи с различными скоростями роста или условиями роста.
    Примечание: Клетки должны быть пролиферирующими и имеет морфологию шпинделя (рисунок 1 для схематического и фиг.2 для примера). В идеале, клетки должны иметь Удвоение Population уровень (PDL) из <30 в начале экспериментов, чтобы избежать возможных репликативные стареющие клетки.
    1. Вычислить PDL клеток с использованием следующего уравнения PDL = Log (N F / N 0) / log2, где N F является окончательным числом клеток и <EM> N 0 представляет собой начальное количество посеянных клеток 21.
  2. Культура WI-38 клеток в среде Игла в модификации Дульбекко (DMEM) с добавлением 10% фетальной бычьей сыворотки (FBS), 1% заменимых аминокислот, и 1% пенициллина / стрептомицина.
  3. Рост клеток IMR-90 в среде DMEM с добавлением 10% FBS и 1% пенициллина / стрептомицина.
  4. Grow все клетки при 37 ° С и 5% СО 2. Непрерывно растут клетки и разделить каждую 2 - 4 D , когда клетки достигают ~ 70 - 80% слияния. Монитор клеток слияния с помощью светового микроскопа. Избегайте клетки с более высоким слиянием, так как это может повлиять на рост клеток из-за контактное ингибирование.
  5. Монитор клетки под световым микроскопом для морфологического появления стареющих клеток (см На рисунках 1 и 2) , и для того, когда нет никаких изменений в PDL от одной субкультуры к следующему.

2. Повреждение ДНК-индуцированное Старение

    (например, WI-38, КМС-90, или другой тип клетка) при низкой плотности (т.е. ~ 300000 клеток / 6 см блюда) в подходящем блюде для типа анализа (т.е. в 6 см чашки для белка / маркеры РНК или блюдо 6-луночное для SA-β-гал окрашивания). Использование клетки раннего пассаж, которые являются молодыми и пролиферирующим (<30 PDL) и пластинчатыми их так, чтобы клетки примерно 50 - 60% сливающиеся на следующий день.
  1. Удалите ростовую среду с помощью стеклянной пипетки, соединенной с вакуумом и промыть клетки путем добавления 1x фосфатно-солевого буфер (PBS). Повторите этот шаг в общей сложности двух стирок. Добавьте тонкий слой PBS (~ 750 мкл на чашку диаметром 6 см) как для «ложной» обработанной и ионизирующим излучением (ИК) обработанного состояния.
  2. С помощью гамма-облучатель подвергать клетки к одной дозе 10 Грей (Гр) ИК; это типичная экспозиция для большинства клеточных линий. В капюшоне, удалите PBS и заменить его ростовую среду. В качестве альтернативы, лечить клетки с бleomycin при 20 мкг / мл в течение 2 ч.
  3. Изменение среды на клетки каждые 48 -7 2 ​​ч и разделить клетки, если это необходимо.
  4. Монитор клетки под световым микроскопом для морфологических изменений (рис 1 для схемы и фиг.2 для изображений представительных клеток) и анализа на стареющие маркер 7 - 10 д после обработки ИК.
    Примечание: Этот протокол описывает старение, индуцированное ИК. Старение может также быть вызвано другими стрессами, в том числе блеомицина (см выше условия), H 2 O 2 , 22, 23, 24 химиотерапевтических препаратов, сигаретный дым 25, трансформирующий фактор роста (TGF) -β1 26, 27, и другие методы 21 , 28, 29.

3. Окрашивание КвждLs для Старение-ассоциированного -галактозидазы

  1. Перед окрашиванием, исследовать клетки под световым микроскопом, чтобы контролировать морфологические изменения.
    Примечание: стареющие клетки , как правило , увеличены и плоские, в отличие от пролиферирующих клеток, которые имеют морфологию шпинделя (смотрите рисунок 1 для схемы и фиг.2 для репрезентативных результатов). Пролиферирующие клетки могут быть использованы в качестве отрицательного контроля, и клетки, обработанные ИК или другой ДНК-повреждающего агента (смотри раздел 2) может быть использован в качестве положительного контроля.
  2. Количественно SA-β-гал активности с использованием реагентов из коммерческого набора (см Материалы таблицу). Оттепель все реагенты и довести их до комнатной температуры путем нагревания их до 37 ° C.
    1. Рассчитать количество окрашивающего раствора и раствор закрепителя необходимого.
      Примечание: Как правило, 1 мл объема достаточно для одной скважины в 6-луночный планшет. Различные размеры плиты могут быть использованы, но в 6-луночном размере пластины вэйл подходит для выполнения анализа в трех повторах для каждого условия. Эта плотность, как правило, обеспечивает достаточное количество клеток на поле для подсчета без использования избыточного количества клеток.
    2. Разбавляют раствор 1:10 окрашивания дистиллированной водой.
    3. Развести Фиксирующий раствор в соотношении 1:10 дистиллированной водой.
    4. Составьте 20x исходный раствор X-гал (5-бром-4-хлор-3-индолил-β-D-галактопиранозида) в N, N-диметилформамиде (ДМФ, например, 20 мг X-гал в 1 мл ДМФ). Чтобы максимизировать использование комплекта, отмерить X-гал в количестве, необходимом для каждого анализа, а затем добавить расчетное количество ДМФ до растворения. В качестве альтернативы, хранить исходный раствор при -20 ° С в защищенном от света трубки в течение одного месяца. Используйте только полипропилен (непрозрачные) трубы для разбавления и хранения X-Gal решений.
    5. Подготовьте β-гал окрашивание раствора: 930 мкл 1х окрашивающего раствора, 10 мкл окрашивающего добавки А, 10 мкл окрашивающего добавки B, и 50 мкл 20 мг / мл Х-Gal в ДМФ. Сделать мастер смеси в зависимости от того, сколько скважин должны быть окрашены.
  3. Осторожно удалите среду из клеток с использованием передачи пипетки или эквивалент.
  4. Осторожно промыть клетки сразу с комнатной температурой 1x PBS.
  5. Добавить 1 мл 1x Фиксирующий раствор в каждую лунку и инкубировали в течение 10 - 15 мин при комнатной температуре.
  6. Удалите закрепляющий раствор с пипеткой передачи.
    Примечание: Фиксирующий раствор (1x) содержит 2% формальдегида и 0,2% глутарового альдегида и следует утилизировать как опасные отходы в соответствии с рекомендациями Управления лабораторной безопасности.
  7. Осторожно промыть клетки дважды 1х PBS.
  8. Удалить PBS полностью и добавить 1x окрашивание раствора β-гал в лунки (1 мл / лунку 6-луночного планшета). Закройте планшет полностью с алюминиевой фольгой и инкубируют в течение 24 - 48 ч при 37 ° С инкубатор (предпочтительно в отсутствие СО 2, так как это может привести к снижению рН буфера и влияют на окрашивание).
    1. Проверьте клетки через 24 ч для окрашивания, а если пятно слишком светлый, инкубируют в течение еще 24 ч.
  9. После периода инкубации, удалить раствор β-гал и заменить его на 1x PBS.
    Примечание: Этот шаг удаляет некоторые цвета фона при визуализации, а также предотвращает опасные просыпание решения X-гал.
    ПРИМЕЧАНИЕ: Утилизировать β-гал раствора должным образом, в соответствии с рекомендациями в офисе лаборатории безопасности.
  10. Исследуют клетки на световой микроскоп с подключенной камеры с помощью 10x или выше цели; SA-β-гал-позитивные клетки будут синим. Acquire нужного количества изображений для эксперимента. Если подсчета процентного содержания СА-β-гал-позитивных клеток, приобретают соответствующее число изображений (> 5) для количественного определения на лунку. Убедитесь, что изображения не перекрываются с различных полей зрения в каждую лунку.
  11. Подсчитайте число SA-β-гал-положительной (синий) клеток по сравнению с количеством общего числа клетокдля расчета процента SA-β-гал-позитивных клеток. Count> 100 клеток в состоянии.
    Примечание: Представитель фотография также может быть использована для фигур. Обратите внимание, что ячейка конфлуэнтность имеет решающее значение, если подсчет клеток, так как слишком много клеток, делают его трудно дифференцировать каждую клетку и слишком мало не может дать достаточное количества клеток для количественной оценки и статистики. Картинки для рисунков для публикации в лучшем разрешении, если сохранены как .tiff файлов, хотя .jpeg файлы также подходят. Цветные изображения должны быть 300 точек на дюйм.

4. Окрашивание Клетки для гамма-H2AX

  1. Пластина клеток из разделов 1 или 2 на покровные стекла в 24-луночный планшет.
  2. На следующий день, мыть клетки с 1x PBS. Промыть тщательно, как и стареющие клетки не хорошо придерживаться покровных и могут быть легко удалены во время мытья. В качестве альтернативы, непосредственно зафиксировать клетки без промывки.
  3. Удалить PBS и зафиксировать клетки с свежеприготовленного 3,7% формальдегида в PBS для10 мин при комнатной температуре.
  4. Удалить раствор и клетки проницаемыми с 0,2% Triton X-100 в PBS в течение 10 мин.
  5. Удалить раствор и блок в 5% FBS в PBS в течение 2 ч при комнатной температуре.
  6. Инкубируйте с анти-фосфо гамма-H2AX (Ser139) и FITC конъюгата в 5% FBS / PBS в течение 2 ч при температуре 37 ° C или O / N при 4 ° С. Защита от света.
  7. Промыть 3 - 6х с PBS при 37 ° С в течение в общей сложности 30 - 60 мин.
  8. Пятно с DAPI (разведенный 1: 15000 в PBS) в течение 10 мин при комнатной температуре.
  9. Вымойте 3x с PBS.
  10. Быстро промыть водой для удаления солей и смонтировать покровное на предметное стекло, используя 3 - 5 мкл antifade реагента. В качестве альтернативы, использовать монтажный раствор, содержащий DAPI.
  11. Дайте ему высохнуть O / N и визуализации окрашенных клеток на флуоресцентном или конфокальной микроскопии с использованием 63X или выше цели.
  12. Количественная γ-H2AX фокусы с помощью одного из двух методов, описанных ниже. Оценка для любого протокола на глаз с использованием флуоресцентного микроскопа. В идеале, намеа конфокальный микроскоп. Возьмем Z-секции и конденсируются в одну плоскость, чтобы визуализировать все обнаруживаемого очаги (представительные изображения для γ-H2AX окрашивания в пролиферирующих и стареющие клетки показаны на рисунке 3). Количество очагов на глаз, используя программное обеспечение обработки изображений; в общем, ~ 100 - 200 ядер являются достаточными для подсчета.
    1. Для того, чтобы количественно оценить процент клеток, которые имеют γ-H2AX-положительных фокусы, подсчитывать каждую ячейку, которая имеет, по меньшей мере, один фокус видимым и разделить на общее число DAPI-окрашенных ядер.
    2. Для того, чтобы количественно определить количество γ-H2AX очагов, подсчитывают γ-H2AX фокусы на клетку.
      Примечание: Уровни гамма-H2AX может варьироваться в зависимости от конкретного стрессора или повреждения, индуцированного старения.

5. Окрашивание Клетки для SAHF маркеров

Примечание: Человеческие стареющие клетки часто имеют ядерные области конденсированной ДНК / хроматина. В стареющих клетках, эти гетерохроматинекак полагает, ингибирует экспрессию пролиферации промотирующего генов, такие как члены семьи E2F. SAHF могут быть визуализированы реорганизации DAPI; наличием гетерохроматиновых-ассоциированных гистонов знаков, включая ди- и три-метилирование Lys9 гистона H3 (H3K9me2 и H3K9me3); и хроматин-реорганизовать белков, в том числе HP1 гетерохроматина белок 1 (HP1), HIRA (гистона репрессор А) и ASF1a (анти-глушителей функция-1a) для хроматина 30. Мы выбрали использовать модель старения онкогена-индуцированный (OIS), а SAHF является более заметным в моделях OIS 30. IDH4 клетки пролиферируют в присутствии дексаметазона из - за наличия SV40 большого Т - антигена , но становятся стареющей после удаления дексаметазона из среды 31. SAHF может быть обнаружен с помощью DAPI окрашивания и окрашивания с антителами против специфических маркеров, перечисленных выше. Здесь мы опишем DAPI и H3K9me2 окрашивания для visualizatион SAHF в клетках 28.

  1. Grow IDH4 клеток в DMEM с добавлением 10% FBS, 1% пенициллина / стрептомицина и 1 мкг / мл дексаметазона. Для того, чтобы вызвать старение, удалить дексаметазон и изменить среду таким образом, что она содержит уголь-раздели FBS; после роста в течение ~ 10 дней в этой новой среде, IDH4 клетка становится стареющей 31.
  2. IDH4 клетки пластины или клетки из разделов 1 или 2, описанные выше, на покровные стекла в 24-луночный планшет.
  3. На следующий день, мыть клетки с 1x PBS. Промыть тщательно, как и стареющие клетки не хорошо придерживаться покровных и могут быть легко удалены во время мытья. В качестве альтернативы, непосредственно исправить клетки без промывки.
  4. Удалить PBS и зафиксировать клетки с свежеприготовленного 3,7% формальдегида в PBS в течение 10 мин при комнатной температуре.
  5. Вымойте клетки 3 раза 1x PBS.
  6. Удалить раствор и клетки проницаемыми с 0,2% Triton X-100 в PBS в течение 5 мин.
  7. Вымойте клетки с 1хPBS. Удалить PBS и блокируют покровные добавлением блокирующего буфера, содержащего 3% BSA (вес / объем) в PBS в течение 5 мин при комнатной температуре. Всегда фильтровать растворы, содержащие БСА перед использованием, чтобы удалить твердые частицы.
  8. Удалить блокирующий буфер и инкубировать клетки с первичными антителами против SAHF маркеров , таких как анти-H3KMe2 антител (рис 4, см таблицы Материалов для деталей). Развести антитела в блокирующем буфере и инкубируют в течение 1 - 2 ч при комнатной температуре.
  9. Удалить раствор первичного антитела и мыть покровные 3 раза с 1% (об / об) Тритона X-100 в PBS.
  10. Развести вторичные антитела в блокирующем буфере (Материалы таблицы) и инкубируют в течение 1 ч при комнатной температуре. Защита от света.
  11. Вымойте клетки дважды с 1x PBS. Пятно с DAPI (разведенного 1: 15000 в PBS; см Материалы таблицу) в течение 10 мин при комнатной температуре.
  12. Вымойте покровные 3 раза 1х PBS.
    1. Быстро промыть водой для удаления солейй монтировать каждый покровный на предметное стекло, используя 3 - 5 мкл antifade реагента. В качестве альтернативы, использовать монтажный раствор, содержащий DAPI.
    2. Дайте высохнуть O / N и визуализации окрашенных клеток на флуоресцентном или конфокальной микроскопии с использованием 63X или выше цели (см Представитель Результаты показаны на рисунке 4). Количественная SAHF, как описано в разделе 4.
      Примечание: первичные антитела изотипа контроля или отсутствие первичного антитела (т.е. вторичные одна) следует использовать в качестве отрицательного контроля для иммунофлуоресцентного окрашивания.

6. Анализ Старение белков, ассоциированных с помощью иммуноблоттинга

Примечание: дряхлеющая фенотип характеризуется усилением активности регуляторов клеточного цикла, в том числе р16, р21 Ink4a и р53. Этот протокол будет описывать количественное определение уровней этих белков в клеточных лизатов. Эти методы могут быть использованы для оценки старения индуцированных с использованием различногоМетоды 21, 28, 29.

  1. Индуцирует клеточное старение , как описано в разделах 1 и 2 , или с использованием другого способа 21, 28, 29. Для анализа маркеров клеточного старения, пластины клеток в 6-см чашки и анализируют как белок и РНК одновременно (см раздел 7 Инструкции по изоляции РНК).
  2. Удалите клеточную культуральную среду. Поместите клетки на подносе льда.
    1. Промыть клетки 2 раза холодной PBS 1x. Наклоните блюдо, чтобы гарантировать, что все PBS отсасывают таким образом, чтобы быть точным с точки зрения объемов, используемых для этой процедуры.
    2. После аспирационных последнего мыть PBS, добавляют 200 мкл холодного PBS (1x для 6 см чашку) к тарелке. Скрип клеток с использованием клеточного скребка.
    3. Пипетировать клеточную / PBS смесь в РНКазы свободной трубки для выделения РНК. Возьмите примерно 150 &# 181; л этой смеси и пипеткой его в новую пробирку. Эта аликвоты будет использоваться для анализа белков, поэтому обязательно пипетки одинакового количества от каждой трубки.
  3. Лизиса клеток путем добавления 75 - 100 мкл модифицированного буфера для образцов 2x Лэммли (60 мМ Трис-HCl, рН 6,8, 12,5% глицерина, 2% SDS, 5% β-меркаптоэтанола (BME), и бромфеноловый синий, могут быть составлены в виде большой партии, аликвоты и хранили при -20 ° С до использования) или эквивалентного буфера для образца.
    1. В качестве альтернативы, лизиса клеток в 75 - 100 мкл буфера для лизиса и центрифуге при 15000 х г в течение 10 мин при 4 ° С для удаления остатков клеток. Удалить супернатант и пипеткой в ​​чистую пробирку. Анализ на белка Брэдфорда или эквивалентный анализ протеина может быть использован на лизаты для обеспечения одинаковой нагрузки белка.
      Примечание: Белковые анализы не могут быть выполнены на образцах лизируют в буфере для образцов.
    2. Вынуть ~ 25 мкл лизата и добавить его в 15 мкл 2х буфера для образцов. Пипетировать и сделатьшп в буфере для образца, чтобы лизировать клетки.
      Примечание: Объемы буфера для лизиса или буфера для образцов можно регулировать в зависимости от клеточного слияния. Если образец «липкий» из-за ядерного лизису, добавить больше образца буфера или PBS разбавить. Образцы могут храниться при температуре от -20 ° С до использования.
  4. Кипение образцы в течение 5 мин при 95 ° С на нагревательном блоке (или эквивалентного оборудования) и нагрузки ~ 40 мкл лизированных образца в буфере для образцов на 18% Трис-Глицин геля.
    Примечание: градиент гель (4-15%) или 14% Трисы-Глицин гель также достаточно для обнаружения низкомолекулярных белков. Различные типы гелей акриламида также могут быть использованы, но гарантировать, что гели и системы являются достаточными для обнаружения низкомолекулярных белков.
    1. Запуск с помощью 1x рабочего буфера при постоянной 100 В в течение 20 мин (через гель укладки) и ~ 60 мин при 180 В. Монитор гель, так что передняя краситель просто убегает или в нижней части геля, так что низкомолекулярный вес белки не гип от геля.
  5. Передача гель акриламида на PVDF мембрану (предварительно пропитанные 100% -ным метанолом для активации). Если делать влажную передачу, только 1 ч необходима для передачи (по сравнению с нормальным ~ 1,75 ч). Отрегулировать соответствующим образом для соответствующей системы передачи; с использованием маркеров предварительно окрашенными молекулярного веса, может помочь в оценке эффективности переноса.
  6. Промойте мембрану в воде. Используйте пятно пунцового для контроля за равную загрузку образцов. Промыть пунцовый водой.
    1. Блок мембраны в 5% обезжиренном сухом молоке в TBST (50 мМ Трис-HCl, рН 7,5, 150 мМ NaCl и 0,1% Твин-20) в течение 1 ч при комнатной температуре или O / N при 4 ° С при перемешивании.
  7. Промывочный блот один раз TBST и инкубировать с первичным антителом , разведенным в 5% молока TBST (смотри таблицу Материалы для разведений и рекомендации антител) в течение 1 ч при комнатной температуре.
  8. Выполните два быстрых промывок TBST и затем промыть дважды на шейкере в течение в общей сложности ~ 30 мин (~ 15 мин каждый былчас).
  9. Инкубируйте с вторичными антителами в течение 40 мин при комнатной температуре. Повторите шаг 6,10.
  10. Инкубируйте с свежеприготовленный Вестерн-блот-субстрат и развитие фильм или прочитать его на читателя хемилюминесценции.
  11. Зонд иммуноблот с р16 Ink4a антител первых (рисунок 5). Газа мембраны путем инкубации в течение 15 мин с водой, 15 мин с 0,2 N NaOH и 15 мин с водой. Продолжить с шагом 6.9 с использованием анти-p21 антитела.
  12. Газа мембрану с использованием 62,5 мМ Трис-HCl, рН 6,8 и 2% SDS с 300 мкл свежей добавленной BME в 50 мл десорбирующий раствор.
  13. Инкубируют при 50 ° С в течение 30 мин и мыть экстенсивно с TBS и затем TBST. Зонд с анти-актина или GAPDH анти-антител для контроля белок-погрузочных (5 показаны репрезентативные результаты).
    Примечание: Уровни p53 также могут быть оценены на один и те же мембраны. Однако, так как р53 является более высокой молекулярной массой, он лучше решен на нижнем процентный геле (например,

7. Анализ уровней мРНК старении маркеров

Примечание: При выделении РНК, гарантировать, что рабочие поверхности очищают с растворами удаления РНКазы или эквивалент, и что эти материалы все РНКазы.

  1. Использование клеток / PBS смесь со стадии 4.2, добавляют 1 мл экстракционного раствора РНК и вихря в течение 30 с (не должно быть никаких видимых комков или остатков клеток).
  2. Добавляют 200 мкл хлороформа и энергично встряхивают в течение 15 с.
  3. Центрифуга на максимальной скорости (> 15000 Xg) в течение 15 мин при 4 ° С.
  4. Удалить ~ 400 мкл верхней РНК водного слоя и пипеткой его в новую микроцентрифужную пробирку.
  5. Добавьте 400 мкл изопропанола (1: 1 с общим объемом водного слоя пипеткой на предыдущей стадии) и 4 мкл прecipitant к РНК слоя.
  6. Центрифуга в течение 15-30 мин при максимальной скорости (> 15000 Xg) и 4 ° С для осаждения РНК.
  7. Удалить супернатант и добавить 1 мл 75% охлажденного на льду этанола.
  8. Центрифуга в течение 1 мин при максимальной скорости (> 15000 Xg) и 4 ° С.
  9. Удалить супернатант и центрифуги в течение 1 мин при максимальной скорости (> 15000 Xg) и 4 ° С.
  10. Пипетировать, как много жидкости, как это возможно, и сушат на воздухе в течение 2 мин.
  11. Повторное приостановить в 10 мкл 10 - кратного буфера ДНКазы, 85 мкл H 2 O, и 5 мкл ДНКазы 1.
  12. Инкубируют при 37 ° С в течение 30 мин.
  13. Добавляют 200 мкл буфера NT2 (50 мМ Трис-HCl , рН 7,4, 150 мМ NaCl, 1 мМ MgCl 2, и 0,05% Нонидет P-40) и добавьте 300 мкл нижнего слоя кислоты фенол-CHCl 2.
  14. Вихревой течение 1 мин и центрифугируют при комнатной температуре в течение 5 мин при максимальной скорости (> 15000 мкг).
  15. Собрать 250 мкл верхнего слоя РНК (2 х 125 мкл), добавляют 25мкл 3 М ацетата натрия рН 5,2, 625 мкл 100% ледяной этанола и 5 мкл осадителя. Хорошо перемешать и осадить O / N при -20 ° С.
  16. На следующий день, перемешать и спина при максимальной скорости (> 15000 Xg) и 4 ° С в течение 30 мин и отбросить супернатант.
  17. Повторите шаги 6.8-6.11.
  18. Повторное приостановить осадок в 12 мкл нуклеазы без воды и хранят при -80 ° С до использования.
    Примечание: Другие процедуры выделения РНК и наборы могут быть использованы.
  19. Выполнение обратной транскрипции со случайными гексамерами и SSII обратной транскриптазы в соответствии с протоколом производителя.
    Примечание: Учитывая низкое количество РНК, выделенной из стареющих клеток, то лучше использовать все РНК (12 мкл) для обратной транскрипции синтеза. Альтернативно, РНК может быть определена количественно с помощью спектрофотометра, и равные количества РНК могут быть использованы для обратной транскрипции.
  20. Анализ уровней мРНК с использованием в режиме реального времени количественного КПЦР (RT-КПЦР) amplificция и SYBR-зеленый Master Mix ПЦР с использованием праймеров, специфических генов.
    1. Как и в обычной реакции РТ-КПЦР, разбавить кДНК 1:30 (в РНКазы / ДНКазы без воды) и добавляют 3 мкл в режиме реального времени 96-луночный планшет для повышения точности пипетирования. Подготовьте мастер реакционную смесь гена-специфического пр мого и обратного праймеров (концентрации 2,5 мкМ, добавляют 5 мкл / реакция), SYBR-зеленый ПЦР смесь (6,25 мкл / реакцию, использование менее чем рекомендации производителя), и 5,75 мкл РНКазы / ДНКазы, свободной воды для конечного объема реакции 20 мкл (17 мкл праймеров / SYBR-зеленый / воды и 3 мкл кДНК).
    2. Выполните RT-КПЦР амплификации с использованием в режиме реального времени PCR машину; следовать протоколу производителя.
      Примечание: Список проверенных человека в прямом и обратном режиме реального времени праймеров можно найти в таблице 1. Эти гены включают SASP белки и другие старение-ассоциированные маркера и / или гены. Типичные результаты ИК-индуцированное старение показаны в

8. Количественная SASP Белковые уровни

  1. Индуцирует с помощью старения Разделов 1 или 2 или с помощью другого метода. Пластина клеток на 6 или 10 см пластинах, как было описано выше (~ 250000 клеток / см пластины 6 или ~ 650,000 / 10 см пластины).
  2. Либо с ячейками 10 г после ИК лечения или с репликативными стареющими клетками (и соответствующими контрольными клетками), промыть клетки три раза 1x PBS и добавить бессывороточную среду с антибиотиками в небольшом объеме (2,5 мл на 6 см или 5 мл на 10 см).
  3. Инкубируют в течение ночи при 37 ° С и 5% CO 2 в инкубаторе тканевых культур. На следующий день, собрать среду и положить его в коническую пробирку на льду.
  4. Промыть клетки 2 раза PBS и затем добавляют 1 мл трипсина (для 6 см чашки). Граф клеток с использованием гемоцитометра позже регулировки концентрации в зависимости от количества клеток.
  5. Центрифуга среда в течение 5 мин при 300 х г.
  6. Filtэр среда с помощью шприца фильтр 0,45 мкм.
  7. не Алигота среды и заморозить при -80 ° С до использования или анализа ELISA с использованием непосредственно или эквивалентные анализов.
  8. Подсчитайте число клеток / мл концентрации, принимая общее число клеток / объем среды, собранный.
  9. Выполните соответствующий иммуноферментный анализ (ELISA) в соответствии с инструкциями изготовителя. Смотрите таблицу рекомендуемых материалов для наборов ELISA для анализа на IL-6, IL-8, GROα и других цитокинов / хемокинов (фиг.6В).
  10. Для того, чтобы гарантировать, что факторы, которые измеряются в пределах линейного диапазона набора ELISA, чтобы разведения клеточной среды стареющей по сравнению с пролиферирующими клетками среды. Счет для этих разведений и объема при расчете количества IL-6. Для того, чтобы получить количество IL-6, секретируемых на клетку в день, вычислить значение IL-6, полученный из комплекта (в пг) в разбавленной концентрации клеток на мл (фршаг 7,8 Ом).
    Примечание: Другие методы, такие, как цитокин массивы, могут быть использованы для обнаружения уровня белка SASP и могут быть пригодны для скрининга большого количества SASP факторов. Уровни протеина SASP факторов могут меняться в зависимости от времени после увядания индукции, типа клеток или типа старения индуцированных.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

На рисунках 2 - 6 показывают репрезентативные результаты от SA-β-гал окрашивания; окрашивания для гамма-H2AX и SAHF; оценка уровней белка р16, р21 Ink4a и р53; и мРНК и уровни белка стареющих-ассоциированных молекул. Увеличение SA-β-гал окрашивание происходит с репликативным и повреждением ДНК-индуцированным старением. Кроме того, необходимо соблюдать морфологические изменения, которые происходят с старением. Клетки увеличиваются и плоские по сравнению с внешним видом шпинделя пролиферирующих фибробластов. Для этой экспериментальной парадигмы, клетки окрашивали и РНК / белок выделял 7 суток после того, как ИК-облучения. Более надежные результаты могут возникать при ожидании дольше после воздействия ИК (т.е. 10 г). Условия должны быть определены для каждого состояния и экспериментальной установки. Эти результаты являются репрезентативными и эти маркеры могут быть также обнаружены при Старение индуцируется с помощью других методов.

фиг.6, названия генов перечислены и соответствуют CXCL1 (GROα), CXCL2 (GROβ) и CSF2 (GM-CSF). Регуляция уровней мРНК некоторых, но не все, из факторов SASP наблюдались после того, как ИК-индуцированной старении в клетках WI-38. Другой стареющий связан мРНК, в том числе CDKN1A (кодирует p21) и CDKN2A (кодирует p16 Ink4a), были повышался. Другие мРНК (EDN1 и ANKRD1) также были включены и ранее было показано выше в стареющих клетках 15. Праймеры представлены в таблице 1.

Рисунок 1
Рисунок 1: пролиферирующий и Стареющие Фибробласты. Схематическое представление пролиферирующих (слева) и стареющих (справа) фибробластов. Примеры стареющих индукторов показаны в YeLlow коробка. Старение связано с более высокими уровнями указанных маркеров. SA-β-гал, Старение-ассоциированные β-галактозидазы; SASP, Старение-ассоциированные секреторного фенотипа; SAHF, Старение-ассоциированные гетерохроматина очаги; DDR, ответ на повреждения ДНК. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры

фигура 2
Рисунок 2. Морфологические характеристики и Повышена SA-β-гал активности стареющих клеток. WI-38 клетки, либо пролиферирующий "молодой" (PDL 27), репликативные стареющей (PDL 40), или тех, кто подвергается воздействию ионизирующего излучения (ИК), окрашивал для SA-β-гал активности. IMR-90 клеток, либо пролиферирующий "молодой" (PDL 30), репликативные стареющая (PDL 52), или тех, кто подвергается воздействию ионизирующего излучения (ИК), была STAINed для SA-β-гал активности. В разделах 1 - 2 описывает индуцирование репликативного и ДНК-индуцированное повреждение старения, а в разделе 3 объясняет, для окрашивания SA-бета-гал. Клетки окрашивали 7 суток после того, как ИК. Con, контроль. Шкала бар = 50 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3. Увеличение γ-H2AX фокусов в стареющих клетках. WI-38 клетки, либо пролиферирующих «молодых» (PDL 30) или репликативной стареющей (PDL 53), фиксировали и окрашивали анти-гамма-Н2АХ антител и DAPI. Обратите внимание на увеличение числа γ-H2AX очагов в стареющих клетках. Изображения были получены на конфокальной микроскопии. Z-секции были приняты, а максимальная интенсивность проекция была использована для получения плоскости одного изображения, чтобы визуализировать все DETECтаблица фокусы. Шкала бар = 20 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4. Флуоресцентные Окрашивание SAHF в стареющих клетках. (А) пролиферирующие WI-38 клетки (PDL 27) были неочищенными или подвергаются воздействию ионизирующего излучения (IR). Через 10 дней клетки окрашивала DAPI для визуализации SAHF (обратите внимание плотное / точечный DAPI окрашивание в ИК-обработанные клетки) (В) IDH4 выращивали в присутствии дексаметазона (пролиферирующий) или в угольном-раздели FBS , чтобы вызвать старение ( стареющий). После того, как 10 г, клетки окрашивали антителами против H3K9me2 и DAPI. Изображения были получены на конфокальной микроскопии. Z-секции были приняты, и проекция максимальной интенсивности была использована для получения одной плоскостиобраз. Пролиферирующие клетки в (А) и (В) имеют диффузное окрашивание DAPI, тогда как стареющие клетки имеют точечный DAPI окрашивание. В (В), контрольные клетки имеют диффузную, очень легкое окрашивание на H3K9me2, тогда как H3K9me2 окрашивание является более надежным и колокализуется с DAPI-окрашенных очагов в стареющих клетках. Шкала бар = 20 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 5
Рисунок 5. Количественное Старение-ассоциированных белков. Белок был выделен либо из пролиферирующих IMR-90 клеток «молодых» (30 PDL) (-) или клеток IMR-90, которых подвергали воздействию 10 Гр ионизирующего излучения (ИК). Среду меняли каждые 48 ч и клетки лизируют 7 суток после того, как ИК. Образцы анализировали с помощью SDS-PAGE, иммуноблоттинг с анти-р16 Ink4a antiboумирает, и повторно зондировали с использованием анти-p21 и затем анти-р53 антителами. GAPDH, был использован в качестве контрольного белка нагрузки. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 6
Рисунок 6. Количественное Старение-связанных мРНК и белков SASP. (А) РНК выделяли из пролиферирующих либо «молодой» (PDL 27 или 34) WI-38 клеток (-) или WI-38 клеток , которые подвергали воздействию 10 Гр ионизирующего излучения (ИК). Среду меняли каждые 48 ч и выделения РНК проводили 7 суток после того, как ИК. RT-КПЦР был использован для количественного определения уровней указанных стареющих-ассоциированной мРНК с использованием праймеров , специфических генов , перечисленных в таблице 1. Уровни 18S были использованы для нормализации. Гистограммы представляют собой средний нормализованный то необработанной ± SEM из 5 независимых экспериментов. (B) клетки WI-38 (PDL 26) подвергали воздействию 10 Гр ИК; 10 г позже, среда была изменена на бессывороточной среде (см раздел 7). Через 24 ч, кондиционированную среду собирали и уровни IL-6, IL-8, и GROα были количественно определены с использованием анализов ELISA. Гистограмма представляет собой среднее ± SEM из 3 экспериментов. * P <0,05 и *** Р <0,001 по Т-критерию Стьюдента. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Человеческие Грунтовки Вперед Задний ход
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGA АГТ GTCTTC Т
CDKN1A (р21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (р16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL - 7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Таблица 1: RT-КПЦР Праймеры для Старение-связанных мРНК. Прямые и обратные праймеры для RT-КПЦР использования SYBR-зеленый технологии обозначены.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Здесь мы описали способы репликативной и ДНК-повреждений, вызванных старением с использованием диплоидных фибробластов человека. Кроме того, методы для количественного определения белка и уровни мРНК различных стареющих-ассоциированных белков включены, а также для окрашивания SA-бета-гал и для повреждения ДНК маркера гамма-H2AX. Эти протоколы могут быть широко использованы для оценки стареющих фенотипов как в пробирке и в естественных условиях, хотя многие предостережения существуют для характеристики старения в естественных условиях 20. Другие клетки могут экспрессировать стареющие маркера, даже если они не стареющие клетки. Так , например, клетка , такие как остеокласты и макрофаги , имеет более высокие уровни β-гал активности 32, 33. Кроме того, многие раковые клетки повышалась p16 Ink4a 34. Клетки могут также накапливать повреждения ДНК (например, γ-H2AX фокусов) , а не быть стареющими. SASP факторы также могут быть активируемыхразличные нормальные физиологические или патологические состояния, которые могут или не могут быть связаны с стареющими клетками. Таким образом, множественные маркеры должны быть старения использоваться, особенно при оценке старения в естественных условиях.

Хотя были обнаружено стареющие клетки увеличиваются в нормальных старении тканей более чем 20 лет назад 4, только теперь, когда мы в полной мере оценив множество ролей , которые стареющие клетки играют и в нормальном гомеостазе ткани и при патологических состояниях. Недавняя работа мышиных моделей для устранения p16 Ink4a -положительных стареющих клеток позволила исследователям более четко и точно оценить роль стареющих клеток в тканях и органах 35, 36, 37. Эти модели обнаружили , что стареющие клетки способствуют множеству возрастных патологий, онкогенеза и мыши продолжительность жизни 35 </ SUP>, 36, 37. Учитывая эти недавние открытия и проверку важности стареющих клеток в физиологии, настало время для дальнейших исследований по этим конкретным клеткам. Например, исследования с использованием стратегии, чтобы удалить терапевтически стареющие клетки или задерживать старение может быть полезным для обоих, и продолжительность жизни здорового периода исследований.

В последнее время в нашей лаборатории было установлено , что метформин, препарат , который обычно используется для лечения сахарного диабета типа 2, уменьшает клеточное старение 38. Поскольку метформин в настоящее время предлагается в качестве анти-старения терапии и имеет противораковые свойства 39, 40, это будет интересно в будущем , чтобы выяснить , является ли этот препарат или другие стареющие вмешательства, влияют на результаты в отношении здоровья путем модуляции клеточного старения.

Протоколы мы здесь обсуждаем, являются общими и широкоccepted методы для оценки стареющего фенотипа. Для клеток , выращенных в лабораторных условиях , крайне важно , чтобы отслеживать изменения клеток из-шпинделя , как к уплощенной морфологии с тем , чтобы гарантировать , что клетки стареющие (См Рисунки 1 & 2). Если клетки не являются положительными для SA-бета-гал или других маркеров, описанных здесь, оценить старение при более высоком ФДЛ клеток (для репликативной старении) или при повышенное время после повреждения ДНК-индуцированного старения. Кроме того, эти протоколы, возможно, должны быть оптимизированы для различных типов клеток. Для оценки уровня белка SASP, крайне важно, чтобы удалить сыворотку из клеточной среды, так как это вызовет высокие фоновые уровни в ELISA или белковых массивах. Поэтому, имейте это в виду при разработке экспериментов, так как она не может быть идеальным для одновременной оценки нескольких маркеров.

Окрашивание для SA-бета-гал, как описано здесь, ограничена тем, что она требует фиксации клеток.Кроме того, клетки слияние было показано влиянием SA-β-гал активности. Протоколы были разработаны для оценки активности SA-β-Gal , используя флуорогенный субстрат для β-гал активности, который позволяет для количественной оценки этого маркера в живых клетках с помощью проточной цитометрии 41, 42, 43. SA-β-гал активность может быть также измерена в клеточных лизатов с использованием хемилюминесцентного метода 44. Кроме того, γ-Н2АХ также могут быть измерены с использованием различных других методов, в том числе проточной цитометрии или иммуноблоттинга клеточных лизатов 45.

Следует отметить , что формирование SAHF является клеточная линия зависит и главным образом связан с онкоген-индуцированной Старение 20, 30, 46. Поэтому SAHF не может присутствовать во всех моделях стареющих. ПолезностьSAHF как стареющие маркера в мышиных моделях также может быть ограничен тем , что SAHF обычно не наблюдается у мышей стареющих клеток 30, 46, 47. Здесь были использованы антитела против H3K9me2, но могут быть использованы и другие молекулярные маркеры SAHF, в том числе macroH2A, высокой подвижностью группы А (HMGA) белков, и три-метилированных лизина 9 гистона H3 (H3K9me3) и связанных HP1 белков. Кроме того, хроматин иммунопреципитация может быть использована для оценки гистонов знаков или ассоциации хроматина связывания белков генов-мишеней E2F.

Следует иметь в виду, что существуют различные ограничения, характеризующие старении, в том числе гетерогенности маркеров и тот факт, что эти маркеры не выражается исключительно в стареющих клетках. Несколько (в общем, 2 - 3) маркеры должны быть использованы для оценки старения, включая маркеры, не описанный здесь. Так, например, ДНК-РУБЦЫ, теломерысигнализации повреждения, и / или повреждение ДНК также могут быть определены количественно. Кроме того, как старении и, в частности, фенотип SASP, недавно было показано, что зависит от конкретного стрессора или повреждения , которое вызывает Старение 11, 12, 13, важно , чтобы оценить несколько маркеров в каждой экспериментальной парадигмы.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Это исследование было поддержано исследовательской программой Intramural Национальных институтов здравоохранения, Национальный институт по проблемам старения. Авторы хотели бы поблагодарить Мириам Горосп и Котб Абдельмохсен за полезные дискуссии о старении и Котб Абдельмохсна для также критически чтения рукописи. Мы также благодарим наших лабораторных членов, особенно Дуглас Длузен для критически чтении рукописи.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Методы индуцируют и Quantify Cellular Старение
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter