Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Teknikler İndüklemek ve Ölçmek Hücresel Yaşlılık etmek

doi: 10.3791/55533 Published: May 1, 2017

Summary

Hücresel yaşlanma, hücre döngüsü tutuklama tersinmez durum, çeşitli hücresel stresler tarafından indüklenebilir. Burada, yaşlanmanın işaretlerini değerlendirmek için hücre yaşlanmasının ve yöntemleri ikna etmek protokolleri açıklar.

Abstract

Hücresel stres veya hasara yanıt olarak, çoğalan hücrelerin hücresel yaşlanma olarak adlandırılan uzun süreli hücre siklüsü hapsi için bir durum başlatır belirli bir programı, neden olabilir. Yaşlanmış hücrelerin birikimi organizma yaşlanma ile ve in vitro olarak sürekli kültürleme yoluyla ortaya çıkar. Yaşlanan hücreler embriyonik gelişim, doku onarımı ve rejenerasyon, tümör bastırma ve yaşlanma gibi birçok biyolojik süreçleri, etkiler. yaşlanmış hücrelerin ayırt edici arasında, ancak, artan senesans ile ilişkili β-galaktosidaz aktivitesi (SA-β-gal) ile sınırlı değildir; p16 INK4a, p53 ve p21 seviyeleri; γ-H2AX dahil olmak üzere DNA hasarının daha yüksek seviyelerinin; Senesans ile ilişkili Heterokromatin odakları (SAHF) oluşması; ve bir senesans ile ilişkili Salgı fenotip (SASP), pro-enflamatuvar sitokinler ve sinyal molekülleri bir dizi salgılanması ile karakterize edilen bir fenomen kazanılması. Burada, hem replikatif için protokolleri tanımlamak veDNA, kültürlü hücrelerde yaşlanmayı hasar kaynaklı. Buna ek olarak, SA-β-gal, γ-H2AX ve SAHF boyama dahil olmak üzere birçok senesans ile ilişkili belirteçleri kullanarak yaşlanmış bir fenotipi izlemek, ve hücre döngüsü düzenleyicileri ve SASP faktörleri, protein ve mRNA seviyeleri ölçmek için teknikler vurgulamaktadır. Bu yöntemler, çeşitli model ve dokularında yaşlanmayı değerlendirilmesi için uygulanabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Yarım Üzeri asır önce, Hayflick ve arkadaşları kültürde çoğalmaya nasıl uğramamış hücreleri anlatılan ama zamanla 1'in yalnızca sınırlı bir süre için. İnsan fibroblast uzun süreli kültürleme çoğalan durdurmak için hücrelerin neden olduğu; ancak, metabolik olarak aktif olduğunu ve bu hücresel yaşlanma olarak adlandırıldı. Yaşlılık tümör oluşumunu inhibe etmek için yararlı olabilir, ama yaşlanma 2, 3 oluşur rejeneratif kapasitesinin kaybına katkıda bulunduğu düşünülmektedir olarak aynı zamanda, zararlı olabilir. Yaşlanmış hücreler Gı'de durdukları yaş 4 insanların ve embriyonik gelişme, yara iyileşmesi, doku tamiri, ve yaşla ilgili enflamasyon 2 de dahil olmak üzere biyolojik süreçler, bir dizi implike edilmiştir gibi dokularda birikebilir gösterilmiştir.

kültürdeki hücrelerin sürekli pasajı bağlanmıştır replikatif senesansın, indükleryıpratma ve genomik istikrarsızlık telomer. DNA hasarı ve onkogenler de dahil olmak üzere çeşitli hücre gerilimleri, aynı zamanda yaşlanmayı 3 neden olabilir. Telomer yıpratma dışındaki faktörlerden kaynaklanan Yaşlılık genellikle stres kaynaklı veya vaktinden evvel yaşlanmaya denilen ve genel olarak p16 INK4a / Rb yolu 5 bağlıdır. Çoğalan birlikte, transforme olmamış hücreler tipik olarak şekil mili görünür yaşlanmış hücreleri, bazı özelliklere sahip bir düz, büyük bir morfoloji ve artan senesans ile ilişkili β-galaktosidaz aktivitesi (SA-β-gal) (Şekil 1 ve 2) dahil olmak üzere tespit edilebilir. Yaşlanmış hücreler de γ-H2AX (Şekil 3), 6, ve muhtemelen, senesans ile ilişkili heterokromatin odakları (SAHF) (Şekil 4) 7 de dahil olmak üzere, DNA hasarı belirteçler birikir. Yaşlanmış hücreler p dahil olmak üzere hücre döngü düzenleyicileri ile ilgili daha yüksek seviyelerde sahip 16 (p16 INK4a) ve / veya p21 ve p53 (Şekil 5) 8, 9. Ayrıca, son veriler yaşlanmış hücrelerin, pro-inflamatuar sitokin ve kemokin, bir dizi salgılayarak otonom olmayan etkileri olduğu senesans ile ilişkili salgı fenotipi (SASP) 10 olarak adlandırılan göstermiştir. Bu SASP olgu, hücre türünden hücre türüne göre değişebilir, ancak genel olarak, bu İnterlökin-6 (IL-6) aksine, IL-8, granülosit-makrofaj koloni uyarıcı faktör (GM-CSF), büyümeyi bir artış ile ortaya konmuştur düzenlenmiş onkogen α (GRO-α) ve GRO-β, diğerleri arasında (Şekil 6). Yaşlanmayı indükleyen, özellikle stres veya hasar da salgı fenotipi 11, 12, 13 etkileyebilir. SASP ELISA'lar veya sitokin / protein dizileri kullanılarak salgılanan proteinlerin seviyelerini ölçerek tespit edilebilirs = "xref"> 10, 14. Transkripsiyon sonrası mekanizmalar SASP protein seviyeleri 11, düzenler, ancak 15, 16, 17, mRNA seviyelerinde değişiklikler de birçok durumda tespit edilebilir. Bu değişiklikler genellikle daha duyarlı ve protein seviyesi ölçümlerine göre ölçmek daha kolaydır. Diğer yaşlanmış belirteçler kalıcı DNA hasarı nükleer odaklar, yaşlanmayı (DNA izler) 18 takviye edici kromatin değişiklikler ile adlandırılan DNA bölümlerinin, ve çeşitli diğer belirteçler 3, 19, 20 dahil olmak üzere, saptanabilir.

Burada, SA-β-Gal, γ-H2AX, SAHF da dahil olmak üzere yaşlanma ait birçok belirteç, ölçülmesi için kültürdeki hücreler yaşlanmayı uyarılması ve ortak teknikleri tarif eder ve yaşlanmaya protein ve mRNAmoleküller nce ilişkili.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Endükleyici Replikatif Senesens

  1. Çözülme düşük geçiş insan diploid fibroblastlar (örneğin, WI-38 ve IMR-90) ya da diğer hücre çizgileri dahildir.
    Not: Burada, insan diploid fibroblastlar kullanıldı, ancak bu protokoller, örneğin endotelyal, epitelyal veya mesenşimal kök hücreleri gibi diğer hücre tiplerinde, yaşlanmayı değerlendirmek için de kullanılabilir. Kültürleme koşulları nedeniyle farklı büyüme oranları veya büyüme koşullarına kullanılan farklı hücre türleri için optimize edilebilir.
    Not: hücre proliferatif olması ve bir mil morfoloji (şematik ve örnek için Şekil 2 Şekil 1 'e bakınız) olması gerekir. İdeal olarak, hücreler olası replikatif yaşlanan hücreleri zorunda kalmamak için deneylerin başlangıcında 30 <Bir Nüfus iki katına Seviye (PDL) olması gerekir.
    1. Aşağıdaki denklem, PDL = log Nf nihai hücre sayısı ve (N f / N 0) / log 2 kullanılarak hücrelerin PDL hesaplayın <em> N 0 tohumlanmış hücrelerin 21 ilk sayısıdır.
  2. Dulbecco Modifiye Kartal Ortamı (DMEM) içinde kültür WI-38 hücreleri,% 10 Cenin Sığır Serumu (FBS),% 1 esansiyel olmayan amino asitler ve% 1 penisilin / streptomisin ile takviye edilmiştir.
  3. % 10 FBS ve% 1 penisilin / streptomisin ile takviye edilmiş DMEM içinde IMR-90 hücreleri büyütün.
  4. 37 ° C 'de, tüm hücrelerin büyümesine ve% 5 CO 2. sürekli hücrelerin büyümesine ve her 2 bölünmüş -% 80 kaynaşmaya - hücreler, 70 ulaştıklarında 4 d. Bir ışık mikroskobu kullanarak hücre izdiham izleyin. Bu inhibisyon temas nedeniyle hücre büyümesini etkileyebileceği için, yüksek izdiham hücreleri kaçının.
  5. Sonraki bir alt-kültür ile ilgili PDL bir değişiklik olduğunda yaşlanmış hücrelerin morfolojik görünüşü için bir ışık mikroskobu altında hücrelerin izlenmesi ve için (Şekil 1 ve 2).

2. DNA hasar kaynaklı Senesens

    (örneğin, WI-38, IMR-90, ya da başka bir hücre tipi) seyrek bir yoğunlukta (yani ~ 300.000 hücre / 6 cm tabak) analiz türüne (protein için örneğin 6 cm tabak için uygun bir çanak / RNA kalem veya SA-β-gal ile boyama için bir 6-yuvalı tabak). ertesi gün% 60 bitişik - Genç ve (<30 PDL) çoğalan ve hücreler kabaca 50 olacak şekilde bunları plaka kullan erken geçiş hücreleri.
  1. bir vakuma bağlı bir cam pipet ile büyüme ortamı çıkarın ve 1 x fosfat tamponlu tuzlu suda (PBS) eklenerek hücreler yıkayın. İki yıkar toplam için bu adımı yineleyin. her ikisi de bir "sahte" muamele edilmiş ve bir iyonize radyasyon (IR), tedavi edilen duruma için (6 cm tabak için ~ 750 uL) ile PBS ince bir tabaka ekleyin.
  2. IR 10 Gray (Gy) tek bir doz hücreleri ortaya çıkarmak için bir gamma ışınlama kullanarak; bu en hücre hatları için tipik maruz kalmasıdır. Bir çeker ocakta, PBS kaldırmak ve büyüme ortamı ile değiştirin. Alternatif olarak, B hücreleri tedavi2 saat boyunca 20 ug / mL'de leomycin.
  3. hücreler üzerindeki her 48 -7 2 ​​saat ortam değiştirme ve gerekirse hücreleri bölme.
  4. 10 D kızılötesi tedavi sonrası - 7 yaşlanmış marker için morfolojik değişiklikler (temsilci hücre görüntüler için şematik ve Şekil 2 için bakınız Şekil 1) ve analiz için bir ışık mikroskobu altında hücrelerin izlenmesi.
    NOT: Bu protokol İR sonrası oluşan yaşlanmayı tarif eder. Yaşlanma, bleomisin (koşulları için yukarı bakınız) dahil olmak üzere diğer gerilmeler ile H2O 2 22, 23, kemoterapötik ilaçlar 24, sigara dumanı 25, transforme edici büyüme faktörü (TGF) -β1 26, 27, ve diğer yöntemler, 21 indüklenebilir , 28, 29.

3. Boyama CelSenesans ile ilişkili β-galaktosidaz için mi

  1. Boyamadan önce, morfolojik değişiklikleri izlemek için, bir ışık mikroskobu altında hücreleri incelemek.
    Not: Yaşlanmış hücreler tipik olarak bir mil morfoloji (şematik ve temsili sonuçlar için, Şekil 2 Şekil 1) sahip çoğalan hücrelere farklı olarak, büyütülmüş ve düz edilir. Proliferatif hücreler bir negatif kontrol olarak da kullanılabilir, ve IR ya da başka bir DNA'ya hasar veren madde (bakınız bölüm 2) ile tedavi edilen hücreler pozitif kontrol olarak da kullanılabilir.
  2. Ticari bir kit (Malzeme Tablo) 'den belirteçler kullanılarak SA-β-gal etkinliğini ölçmek. tüm reaktifler çözülme ve 37 ° C'ye kadar onları ısıtarak oda sıcaklığına getirin.
    1. boyama çözeltisi ve gerekli fiksatif çözeltisinin miktarını hesaplayın.
      Not: Genellikle, 1 ml hacimde, 6 gözlü plaka içinde bir kuyu için yeterlidir. Farklı plaka boyutları kullanılabilir, ancak bir 6-yuvalı plaka boyutu wel isHer bir durum için üç kopya halinde bir tahlilin gerçekleştirilmesi için L uygundur. Bu yoğunluk, genellikle hücrelerin aşırı sayıda kullanmadan saymak alan başına yeterli hücre sayısını içerir.
    2. damıtılmış su ile boyama çözeltisi 1:10 oranında seyreltin.
    3. damıtılmış su ile sabitleyici çözeltisinin 1:10 oranında seyreltin.
    4. 1 mL örneğin, X-gal, 20 mg N, N-dimetilformamid (DMF içinde X-gal (5-bromo-4-kloro-3-indolil-β-D-galaktopiranosid) içindeki bir 20x stok çözelti hazırlayın DMF). kitin kullanımını maksimize etmek için, her bir tayin için gerekli olan miktara X-gal ölçülmesi ve daha sonra erimesi için DMF hesaplanan miktarını ekleyin. Seçenek olarak ise, bir ay için bir ışık korunan bir tüp içinde 20 ° C 'de stok solüsyonu saklayın. seyreltilmesi ve X-gal solüsyonların depolanması için sadece polipropilen (opak) tüpler kullanın.
    5. 1x boyama çözeltisinin 930 uL, boyama ek A 10 uL, boyama ek B için 10 uL, 20 mg, 50 uL / ​​ml X: β-gal lekeleme solüsyonu hazırlayınDMF içinde p-gal. lekeli gereken kaç kuyu bağlı bir master miks yapın.
  3. Dikkatli bir şekilde transfer pipeti veya eşdeğeri kullanılarak hücrelerden orta çıkarın.
  4. Yavaşça PBS 1x oda sıcaklığı ile bir kez yıkama hücreleri.
  5. her bir göze, 1 mL 1x sabitleştirici çözeltisi ilave edin ve 10 boyunca inkübe - oda sıcaklığında 15 dakika.
  6. Bir transfer pipet ile sabitleştirici çözüm çıkarın.
    Not: fiksatif solüsyonu (1x),% 2 formaldehit ve% 0.2 glutar aldehit içeren ve laboratuvar güvenlik ofis tavsiyelerine göre, tehlikeli atık olarak bertaraf edilmelidir.
  7. Yavaşça 1 x PBS ile iki kez yıkama hücreleri.
  8. Tamamen PBS çıkarın ve kuyu (1 ml / oyuk, 6 oyuklu plaka) 1 x β-gal lekeleme çözeltisi ilave edilir. (Bu tamponun pH değerini düşürmek ve boyama etkileyebilir, tercihen CO2 yokluğunda) 37 ° C kuluçka makinesi içinde 48 saat - Alüminyum folyo ile tamamen plaka Kapak 24 inkübe edin.
    1. boyama için 24 saatte Hücrelerden ve leke çok açık ise, 24 saat daha inkübe edilir.
  9. İnkübasyon süresinden sonra, β-gal çözüm kaldırmak ve 1 x PBS ile değiştirin.
    NOT: Bu adım arka plan renginin bazı kaldırır görüntüleme ve ayrıca X-gal çözümün tehlikeli dökülmesini önler.
    NOT: laboratuvar güvenlik ofisinin önerilerine göre düzgün β-gal çözümü atın.
  10. 10x veya daha objektif kullanarak bir bağlı kamera ile bir ışık mikroskobu ile hücrelerin incelenmesi; SA-β-gal pozitif hücreler mavi olacaktır. Deney için fotoğrafın istenilen sayıda elde edin. SA-β-gal-pozitif hücrelerin yüzdesi sayma ise görüntülerin uygun sayıda edinmeniz (> 5) ölçümü için kuyu başına. görüntüler de her birimizin içinde çeşitli görüş alanlarından örtüşmeyen olduğundan emin olun.
  11. toplam hücre sayısına karşı hücreleri SA-β-gal pozitif (mavi) sayısınıSA-β-gal pozitif hücrelerin yüzde hesaplamak için. koşul başına> 100 hücreleri sayın.
    NOT: Temsili resimler de rakamlar kullanılabilir. Çok fazla sayıda hücre zor her hücreyi ayırt etmek ve çok az sayıda ölçümü ve istatistikleri için hücrelerin yeterli sayıda vermeyebilir yaptıkça, o hücre confluency sayma hücreleri ise kritiktir unutmayın. .jpeg dosyaları da uygun olmasına rağmen, .tiff dosyaları olarak kaydedilir eğer yayın için rakamlar için Resimler iyi çözünürlükte altındadır. Renkli görüntüler 300 dpi olmalıdır.

γ-H2AX 4. Boyama hücreler

  1. 24 oyuklu bir plaka içerisinde cam lameller üzerinde Bölümler 1 ya da 2 hücreleri Plate.
  2. Ertesi gün, 1 x hücrelerin PBS ile yıkayın. Yaşlanmış hücreler lamelleri iyi yapışmaz ve kolay bir şekilde yıkama sırasında çıkartılabilir olarak, dikkatli bir şekilde yıkayın. Seçenek olarak ise, doğrudan doğruya yıkanmadan hücrelerin tespit.
  3. PBS çıkarın ve PBS içinde taze hazırlanmış% 3.7 formaldehit ile hücreleri düzeltmekOda sıcaklığında 10 dakika.
  4. çözüm çıkarın ve 10 dakika boyunca PBS içinde% 0.2 Triton X-100 hücreleri geçirgenliği.
  5. Oda sıcaklığında 2 saat süre ile, PBS içinde% 5 FBS içinde çözelti ve blok çıkarın.
  6. 4 ° C'de 37 ° C ya da O / N, 2 saat süre ile /% 5 FBS içinde γ-H2AX (Ser139), anti-fosfo ve FITC konjugat ile PBS inkübe edin. Işıktan koruyunuz.
  7. 60 dakika - 30 arasında toplam 37 ° C 'de PBS ile 6x - 3 yıkayın.
  8. DAPI ile Leke (1 seyreltilmiş: 15.000, PBS içinde), oda sıcaklığında 10 dakika karıştırıldı.
  9. PBS ile yıkayın 3x.
  10. antifade reaktif 5 uL - Çabuk tuzları uzaklaştırmak ve 3 kullanılarak bir cam slayt üzerinde lamel monte etmek için su ile yıkanır. Seçenek olarak ise, DAPI içeren bir montaj solüsyonu kullanın.
  11. Kuru O / N olsun ve 63X ya da daha yüksek bir objektif kullanılarak bir flüoresan veya konfokal mikroskop boyanan hücrelerin görselleştirmek.
  12. Aşağıda tarif edilen yöntemlerden herhangi birini kullanarak, γ-H2AX odakları ölçmek. floresan mikroskop kullanılarak gözle ya protokol için Skoru. İdeal olarak, bizeea konfokal mikroskop. Z bölümleri al ve (Şekil 3'te gösterilmektedir çoğalan ve yaşlanmış hücrelerde γ-H2AX boyaması için temsili görüntülerinin) tespit edilebilen bütün odaklar görselleştirmek için tek bir düzlem içine aktarmak. görüntüleme yazılımı kullanılarak gözle odakları sayın; Genel olarak, ~ 100-200 çekirdek sayımı için yeterlidir.
    1. γ-H2AX pozitif odaklar hücrelerin yüzdesi ölçmek için DAPI ile boyanmış çekirdeklerin sayısı ile en az bir odak görünür ve bölme yer alır, her hücre sayısı.
    2. γ-H2AX odaklarının sayısını ölçmek için, hücre başına γ-H2AX odakları sayısı.
      Not: γ-H2AX seviyeleri yaşlanmanın neden olduğu özel bir stres veya hasara bağlı olarak değişebilir.

SAHF markerleri 5. Boyama hücreler

NOT: İnsan Yaşlanmış hücreler genellikle yoğunlaştırılmış DNA / kromatin nükleer bölgelere sahip olacaktır. Yaşlanmış hücrelerde, bu heterokromatik bölgeler iseBöyle E2F aile üyeleri olarak çoğalması teşvik genlerin ekspresyonunu inhibe etmek için düşünülmektedir. SAHF DAPI yeniden örgütlenmesi ile görselleştirilebilir; Histon H3 (H3K9Me2 ve H3K9Me3) üzerinde Lys9 di- ve tri-metilasyon içeren heterokromatin ilişkili histon işaretleri, varlığıyla; ve HP1 heterokromatin protein 1 (HP1) de dahil olmak üzere kromatin tekrar organize proteinler ile, HIRA (histon represör A) ve ASF1a (anti-susması işlevi-1a) 30 kromatin için. SAHF OIS modellerinde 30 daha belirgin olduğu gibi biz bir onkogen kaynaklı yaşlanmasının modeli (OIS) kullanmayı tercih etti. IDH4 hücreleri nedeniyle SV40 büyük T antijeninin varlığı deksametazon varlığında prolifere ancak orta 31 deksametazon çıkarılmasından sonra yaşlanmış hale gelir. SAHF DAPI lekelemesi ve yukarıda listelenmiş olan spesifik belirteçleri karşı antikorlarla boyama ile saptanabilir. Burada, visualizat DAPI ve H3K9Me2 lekelenmeye açıklamakhücreler 28 SAHF iyon.

  1. % 10 FBS,% 1 penisilin / streptomisin ve 1 ug / ml deksametazon ile takviye edilmiş DMEM içinde IDH4 hücreleri büyütün. yaşlanmayı uyarmak için, deksametazon çıkarın ve kömür-boşaltılmış FBS içeren, böylece orta değiştirmek; Bu yeni ortamda 10 gün ~ artan sonra, IDH4 hücreler 31 yaşlandı.
  2. Levha IDH4 hücreleri veya Bölüm 1 ya da 2 hücreleri, 24 oyuklu bir plaka içerisinde cam lameller üzerinde, yukarıda tarif edildiği.
  3. Ertesi gün, 1 x hücrelerin PBS ile yıkayın. Yaşlanmış hücreler lamelleri iyi yapışmaz ve kolay bir şekilde yıkama sırasında çıkartılabilir olarak, dikkatli bir şekilde yıkayın. Seçenek olarak ise, doğrudan doğruya yıkanmadan hücrelerin tespit.
  4. PBS çıkarın ve oda sıcaklığında 10 dakika boyunca PBS içinde taze hazırlanmış% 3.7 formaldehit ile hücrelerin tespit.
  5. 1x PBS ile hücreler 3 kez yıkayın.
  6. çözelti çıkarın ve 5 dakika boyunca PBS içinde% 0.2 Triton X-100 hücreleri geçirgenliği.
  7. 1x hücreleri yıkayınPBS. PBS çıkarın ve% 3 BSA içeren bloke edici tampon ilave lamelleri blok (ağırlık / hacim) oda sıcaklığında 5 dakika boyunca PBS içinde. Her zaman parçacıklı maddeleri çıkarmak için kullanmak BSA önce içeren çözeltiler filtre.
  8. Bloklama tamponunu çıkarın ve anti-H3KMe2 antikorları gibi SAHF belirteçleri karşı primer antikorlar ile hücrelerin inkübe (Şekil 4; ayrıntılar için Materyaller Tablo). bloke edici tampon içinde antikorlar seyreltilir ve 1 boyunca inkübe - oda sıcaklığında 2 saat.
  9. Primer antikor solüsyonu çıkarın ve% 1 PBS içinde (hac / hac) Triton X-100 ile lamelleri 3 kez yıkayın.
  10. Tampon (Malzeme Tablo) bloke ikincil antikorlar seyreltilir ve oda sıcaklığında 1 saat inkübe edin. Işıktan koruyunuz.
  11. 1x PBS ile iki kez hücreleri yıkayın. Oda sıcaklığında 10 dakika inkübe edildi: DAPI ile boyama (PBS içinde 15.000 Malzeme bakınız Tablo 1 seyreltilmiş).
  12. Lameller 1x PBS ile 3 kez yıkanır.
    1. Çabuk tuzları uzaklaştırmak için su ile yıkanır, birantifade reaktif 5 uL - nd 3'ü kullanarak bir bardak slayt Her lamel monte edin. Seçenek olarak ise, DAPI içeren bir montaj solüsyonu kullanın.
    2. Kuru O / N olsun ve 63X ya da daha yüksek bir objektif (Şekil 4 'de Örnek Sonuçlar bakınız) kullanılarak, bir flüoresan veya konfokal mikroskop boyanan hücrelerin görselleştirmek. Bölüm 4'te tarif edildiği gibi SAHF ölçmek.
      Not: (diğer bir deyişle, tek başına ikincil) İzotip kontrol birincil antikorlar veya birincil antikor immünofloresan boyama için bir negatif kontrol olarak kullanılır.

6. immünoblotlama ile senesans ile ilişkili proteinlerin analiz

NOT: Yaşlanmış fenotip, p16 INK4a, p21 ve p53 dahil olmak üzere hücre döngüsü düzenleyicileri, yukarı regülasyonu ile karakterize edilir. Bu protokol hücre lizatlarında bu proteinlerin seviyelerinin ölçümü anlatacağız. Bu teknikler çeşitli kullanılarak indüklenen yaşlanmayı değerlendirmek için kullanılabiliryöntemler 21, 28, 29.

  1. Bölümler 1 ve 2 'de ya da başka bir yöntemi 21, 28, 29 kullanılarak tarif edildiği gibi hücre yaşlanmasının neden. (RNA izolasyon talimatları için Bölüm 7) 6 cm tabaklarda hücreleri plaka ve aynı zamanda, protein ve RNA hem de analiz, hücresel yaşlanma işaretlerini analiz etmek.
  2. hücre kültürü ortamı çıkarın. buz bir tepsi hücreleri koyun.
    1. Soğuk 1x PBS ile hücreler 2 kez yıkayın. prosedür için kullanılan miktarlar açısından olarak hassas olacak şekilde, tüm PBS aspire sağlamak için çanak yatırın.
    2. PBS, son yıkama aspire edildikten sonra, çanak (6 cm tabak) soğuk 1 x PBS, 200 uL ekleyin. bir hücre kazıyıcı kullanarak hücreleri Pençe.
    3. RNA izolasyonu için bir RNaz içermeyen bir tüp içine hücre / PBS karışımı pipetle. Al yaklaşık 150 &# 181; yeni bir tüpe bu karışıma ve pipetle bu L. Bu tümböleni protein analizi için kullanılan, dolayısıyla her bir tüpten aynı miktarda pipetle mutlaka olacaktır.
  3. 75 ekleyerek Hücreleri, - modifiye 2x Laemmli numune tamponu (60 mM Tris-HCI pH 6.8,% 12.5 gliserol,% 2 SDS,% 5 β-merkaptoetanol (BME) ve mavi bromofenol 100 uL; olarak yapılmış olabilir büyük bir toplu, şişelere doldurulur ve -20 kullanıma kadar ° C) ya da eşdeğer bir numune tampon C'de saklandı.
    1. hücre artıklarının ayrılması için 4 ° C'de 10 dakika boyunca 15,000 x g'de liziz tamponu ve santrifüj 100 uL - Alternatif olarak, 75 hücreleri lize. Temiz bir tüp içine süpernatant ve pipet çıkarın. Bir Bradford protein deneyi ya da denk bir protein deneyi proteinin eşit yükleme sağlamak için lizatları üzerinde kullanılabilir.
      Not: Protein deneyleri numune tamponu içerisinde lizlendi numuneler üzerinde gerçekleştirilemez.
    2. lizat ~ 25 mcL çıkarın ve 2x numune tamponu 15 uL ekleyin. yukarı Pipet ve donumune tamponu içinde wn hücreleri lize etmek için.
      Not: liziz tamponu ya da örnek tamponu Birimleri hücre izdiham bağlı olarak ayarlanabilir. Örnek, nükleer lizlenmesine "yapışkan" ise, sulandırmak için daha fazla örnek tampon veya PBS ilave edin. Numuneler, kullanılıncaya kadar -20 ° C'de muhafaza edilebilir.
  4. bir% 18 Tris-Glisin jeli üzerinde 5, bir sıcaklıkta bir blok üzerinde, 95 ° C'de min (veya eşdeğer ekipman) ve yük numune tamponu içerisinde lizlendi numunenin ~ 40 uL için numune kaynatın.
    NOT: gradyan jel (% 4-15) ya da bir% 14 Tris-Glisin jel aynı zamanda düşük moleküler ağırlıklı proteinlerin tespit edilmesi için yeterlidir. akrilamid jeller farklı türleri de kullanılabilir, fakat jel ve sistem, düşük molekül ağırlıklı proteinlerin tespit edilmesi için yeterli olduğundan emin olmak edilebilir.
    1. (Istifleme jeli içinden), 20 dakika boyunca sabit bir 100 V 1x çalışan tamponu kullanılarak çalıştırın ve boya cephesinin, sadece kapalı çalışır veya jel altındaki yani ~ 180 V'de 60 dakika jel Monitör düşük molekül, böylece ağırlıklı proteinler r yokjel kapalı un.
  5. bir PVDF membrana akrilamid jel aktarın (aktif hale getirmek için% 100 metanol ile önceden ıslatılmış). ıslak transferi yaparken, yalnızca 1 saat (1.75 saat proteine ​​normal karşı) aktarımı için gereklidir. Uygun transfer sistemi için buna göre ayarlama; Önceden boyanmış molekül ağırlık belirteçler kullanılarak transfer verimi belirlenmesine yardımcı olabilir.
  6. Suda membran yıkayın. örneklerin eşit yükleme izlemek için bir Ponceau lekesi kullanın. Su ile kapalı Ponceau yıkayın.
    1. çalkalama ile 4 ° C'de, oda sıcaklığında ya da O / N C'de 1 saat süreyle TBST içinde% 5 yağsız kuru süt içine bir zar (50 mM Tris-HCI pH 7.5, 150 mM NaCI ve% 0.1 Tween-20) bloke eder.
  7. Yıkama TBST ile bir kez leke ve oda sıcaklığında 1 saat boyunca% 5 süt TBST (seyreltici ve antikor önerileri malzemeleri Tabloya bakınız) içinde seyreltilmiş birincil antikor ile inkübe edin.
  8. TBST ile iki hızlı yıkama yapın ve daha sonra ~ toplam ~ 30 dakika (ile bir çalkalama düzenine iki kez, her 15 dk yıkamah).
  9. Oda sıcaklığında 40 dakika için bir ikincil antikor ile inkübe edin. Adımı tekrarlayın 6.10.
  10. taze Western blot substratın ile inkübe ve film geliştirmek ya da bir kemiluminesan okuyucusunda okuyun.
  11. İlk p16 INK4a antikorları ile Prob immünoblot (Şekil 5). su ile 15 dakika, 0.2 N NaOH ile 15 dakika, ve su ile 15 dakika boyunca inkübe edilerek, membran şerit. Anti-p21 antikorları kullanılarak Aşama 6.9 ile devam ediniz.
  12. sökme çözeltisi, 50 mL başına taze eklenmiş BME 300 uL 62.5 mM Tris-HCl pH 6.8 ve% 2 SDS kullanılarak membran şerit.
  13. 30 dakika için 50 ° C'de inkübe edilir ve daha sonra TBS ile TBST ile iyice yıkayın. Protein yükleme kontrolleri anti-aktin ya da anti-GAPDH antikorları ile Prob (Şekil 5, tipik sonuçlarını göstermektedir).
    NOT: p53 seviyeleri de aynı zarlar üzerinde değerlendirilebilir. P53 daha yüksek bir molekül ağırlığı olduğu, ancak, daha iyi (daha düşük yüzdeli jeli üzerinde giderilip ör

7. Yaşlılık İşaretlerinin mRNA seviyelerini analiz

Not: RNA izole ederken, çalışma yüzeyleri RNaz kaldırma çözeltiler veya bir eşdeğeri ile temizlenir sağlamak ve malzeme tüm RNaz içermeyen olduğu.

  1. Aşama 4.2 hücre / PBS karışımı kullanılarak, 30 s için RNA ekstraksiyonu çözeltisi ve girdap solüsyonu 1 mL (hiçbir görünür kümeleri veya hücresel döküntü olmalıdır).
  2. 200 ul kloroform eklenir ve 15 saniye boyunca kuvvetli bir şekilde çalkalanır.
  3. 4 ° C'de 15 dakika boyunca maksimum hızı (> 15,000 xg) santrifüjleyin.
  4. En RNA, sulu tabakanın ~ 400 uL çıkarmak ve yeni bir mikrofüj tüpüne içine pipetle.
  5. ve PR 4 uL (toplam önceki aşamada pipetle sulu tabaka hacmi ile 1: 1) izopropanol 400 mcLRNA, tabakasına ecipitant.
  6. maksimum hız (> 15,000 xg), 15-30 dakika ve 4 ° C'de santrifüj pelet RNA için.
  7. Süpernatantı ve% 75 buz soğukluğundaki etanol 1 ml.
  8. maksimum hız (> 15.000 x g'de) ve 4 ° C 'de 1 dakika süre ile santrifüje.
  9. maksimum hız (> 15.000 x g'de) ve 4 ° C 'de, 1 dakika için supernatant ve santrifüj çıkarın.
  10. 2 dakika için olası ve kuru hava kadar sıvıyı Pipet.
  11. 10x DNaz tamponu 10 uL, H2O 85 uL yeniden askıya ve DNase 1 5 uL.
  12. 30 dakika boyunca 37 ° C'de inkübe edilir.
  13. 200 uL NT2 tamponu (50 mM Tris-HCI pH 7.4, 150 mM NaCl, 1 mM MgCl2, ve% 0.05 Nonidet P-40) ilave edilir ve asit fenol-CHCl 2 alt tabakanın 300 uL ekleyin.
  14. maksimum hızda 5 dakika boyunca oda sıcaklığında 1 dakika ve santrifüj vorteksleyin (> 15,000 xg).
  15. Üst RNA tabakası (2 x 125 uL) 250 uL toplama, 25 eklemek3 M sodyum asetat pH 5.2,% 100, buzla soğutulmuş etanol 625 uL ve çökeltici 5 uL uL. İyice karıştırın ve -20 ° C 'de O / N hızlandırabilir.
  16. Sonraki gün, karıştırmak ve maksimum hızı (> 15,000 xg) ve 30 dakika boyunca 4 ° C'de santrifüj ve süpernatant atılır.
  17. Tekrarlayın 6.8-6.11 adımları tekrarlayın.
  18. kullanılana kadar -80 ° C'de nükleazsız su ve mağaza 12 uL pelet yeniden askıya.
    NOT: Diğer RNA izolasyonu prosedürleri ve kitler de kullanılabilir.
  19. rastgele heksamerlerie ters transkripsiyonu gerçekleştirin ve SSII üreticinin protokolüne ters transkriptaz.
    Not: yaşlanmış hücrelerden izole edilmiş RNA grupları en düşük miktar göz önüne alındığında, ters transkripsiyon sentezi için RNA (12 uL) her kullanmak en iyisidir. Seçenek olarak ise, RNA, bir spektrofotometre kullanılarak kantifiye edilebilir ve RNA'nın eşit miktarlarda ters transkripsiyon için kullanılabilir.
  20. kantitatif qPCR (RT-qPCR) amplific gerçek zamanlı kullanılarak mRNA düzeylerini analizasyon ve gen spesifik primerler ile SYBR yeşili PCR ana karışımı.
    1. Tipik bir RT-qPCR reaksiyonunda olduğu gibi, (Rnaz / DNase içermeyen su içinde) cDNA, 1:30 seyreltin ve daha iyi pipetleme doğruluğu için gerçek zamanlı 96 oyuklu plakaya 3 uL ekleyin. gen spesifik ileri bir reaksiyon ana karışımı hazırlamak ve geri primerler (2.5 uM konsantrasyon, 5 uL / ​​reaksiyon ekleme), SYBR yeşili PCR karışımı (6.25 uL / ​​reaksiyon, üreticinin tavsiyesine göre daha az kullanın) ve RNase 5.75 uL / 20 uL (primerler / SYBR yeşili / su 17 uL ve cDNA 3 uL) içindeki bir son reaksiyon hacmi için DNase içermeyen su.
    2. Gerçek zamanlı PCR makinesi kullanılarak RT-qPCR büyütmesi gerçekleştirmek; üreticinin protokolünü takip edin.
      Not: bir ileri doğrulanmış insan listesi ve gerçek zamanlı geri primerler Tablo 1 'de bulunabilir. Bu genler SASP proteinleri ve diğer senesans ile ilişkili işaretleri ve / veya genleri içerir. İR kaynaklı yaşlanma elde edilen temsilci sonuçlar gösterilmektedir

8. ükler SASP Protein Düzeyleri

  1. Bölüm 1 ya da 2 ya da başka bir yöntemi kullanarak kullanılarak yaşlanmayı uyarma. (~ 250,000 hücre / 6 cm plaka veya ~ 650.000 / 10 cm plaka) yukarıda tarif edildiği gibi, 6 veya 10 cm tabaklarda, hücreler plaka.
  2. Ya 6 cm ya da 5 ml için (2.5 mL hücreleri, 10 d sonrası İR tedavisi veya replikatif yaşlanmış hücrelerde (ve uygun kontrol hücreleri) ile, 1 x PBS ile hücreler üç kez yıkayın ve küçük bir hacme antibiyotiklerle serumsuz ortam ilave 10 cm).
  3. Bir doku kültürü kuluçka makinesi içinde CO2 37 ° C'de gece boyunca inkübe edilir ve% 5. Ertesi gün, orta toplamak ve buz üzerinde konik tüp içine koyun.
  4. PBS ile hücreler 2 defa yıkanır ve daha sonra (6 cm tabak) tripsin 1 ml. Daha sonra hücre sayısı uygun konsantrasyonlarda ayarlamak için bir hemasitometre kullanarak hücreleri sayın.
  5. Santrifüj 300 x g, 5 dakika boyunca ortam.
  6. filter, ortam, bir 0.45 mikron şırınga filtresi kullanılarak.
  7. şirketinden ELISA veya eşdeğer tahliller kullanılarak kullanım veya deneye kadar -80 ° C 'de orta ve dondurarak kısım.
  8. Toplanan ortamın toplam hücre sayısı / hacminin alınması ile / mL konsantrasyonda hücre sayısını hesaplayın.
  9. Üreticinin talimatlarına uygun olarak, uygun bir enzim-bağlantılı ümmünozorbent deneme (ELISA) ile gerçekleştirin. IL-6, IL-8, GROa, ve diğer sitokinler / kemokinler (Şekil 6B) için tahlil edilmesi için tavsiye edilen ELISA kitleri için malzemeler Tablo bakınız.
  10. ölçülür faktörler ELISA kiti lineer aralığında olmasını sağlamak için, proliferasyon hücre ortamına kıyasla yaşlanmış hücre ortamının dilüsyonları yapmak. Bu seyreltiler ve IL-6 miktarının hesaplanması hacmi için hesap. günde hücre başına salgılanan IL-6 miktarı elde etmek için, ml başına seyreltilmiş hücre konsantrasyonu başına (pg) kitinden elde edilen IL-6 değerini hesaplamak (from adım 7.8).
    NOT: sitokin dizileri gibi diğer yöntemler, SASP protein seviyelerini tespit etmek için kullanılabilir ve SASP faktörlerin büyük sayıda taranması için de uygun olabilir. SASP faktörlerin protein seviyeleri senesans indüksiyonu, hücre tipi veya neden olduğu yaşlanma türü sonra zamana göre değişiklik gösterebilir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

, 6 SA-β-gal ile boyama temsil edici sonuçlar göstermektedir - 2 Şekil γ-H2AX ve SAHF için boyama; p16 INK4a, p21 ve p53 protein seviyelerinin değerlendirilmesi; ve mRNA ve yaşlanmış ilişkili moleküllerin protein seviyeleri. Artan SA-β-gal boyaması replikatif ve DNA hasarı ile indüklenen yaşlanma ile ortaya çıkar. Ayrıca, yaşlanma ile ortaya morfolojik değişikliklerini izleyin. Hücreler, çoğalan fibroblastların mil görünüşüne göre büyütülmüş ve düz hale gelir. Bu deneysel örnekte, hücreler boyandı ve RNA / protein İR maruz kaldıktan sonra 7 d izole edilmiştir. Daha sağlam sonuçlar İR ilgili işlemler (10 d) sonra uzun bekleme ile oluşabilir. Koşullar her koşul ve deneysel kurulum için tespit edilmesi gerekmektedir. Bu sonuçlar, temsilidir ve yaşlanmayla diğer yöntemler kullanılarak uyarıldığında, bu belirteçler de tespit edilebilir.

Şekil 6 için her.within sayfa = "1">, gen isimleri belirtilen ve CXCL1 (GROa), CXCL2 (GROp) ve CSF2 (GM-CSF) karşılık gelir. SASP bazı faktörlerin mRNA seviyelerinin yükselişini, ama hepsi değil, WI-38 hücrelerinde İR kaynaklı yaşlanmadan sonra gözlenmiştir. CDKN1A (p21 kodlayan) ve CDKN2A (p16 INK4a kodlayan) da dahil olmak üzere diğer senesans ile ilişkili mRNA'lar, yukarı-regüle edildi. Diğer mRNA'lar (EDN1 ve ANKRD1) da dahil edilmiştir ve daha önce yaşlanmış hücrelerde 15 daha yüksek olduğu gösterilmiştir. Primerler, Tablo 1 'de listelenmiştir.

Şekil 1
Şekil 1: Proliferatif ve Yaşlanmış fıbroblastların. çoğalan (sol) ve yaşlanmış (sağ) fibroblastlarının bir şematik temsili. senesans indükleyicilerin örnekleri ye gösterilmiştirllow kutu. Yaşlılık belirtilen işaretlerin daha yüksek seviyeleri ile de ilişkilidir. SA-β-gal, senesans ile ilişkili β-galaktosidaz aktivitesi; SASP, senesans ile ilişkili salgı fenotipi; SAHF, senesans ile ilişkili heterokromatin odakları; DDR, DNA hasarına yanıt. Bu rakamın büyük halini görmek için buraya tıklayın

şekil 2
Şekil 2. Morfolojik Özellikler ve Yaşlı hücrelerde artan SA-β-gal etkinliğini. WI-38 hücreleri, "Küçük" (PDL 27), replikatif yaşlanma (PDL 40) veya iyonize radyasyon (IR) maruz kalan, SA-β-gal aktivitesi için boyandı çoğalan ya. IMR-90 hücre ya çoğalan "Küçük" (PDL 30), replikatif yaşlanma (PDL 52) ya da radyasyon (IR) maruz kalması bu sta edildiSA-β-gal aktivitesi için daimi olarak tutturulabilir. Bölümler 1-2 replikatif ve DNA hasar kaynaklı senesens indükleyici tarif eder ve Bölüm 3 SA-β-gal boyaması açıklar. Hücreler, IR sonra 7 d boyandı. Con, kontrol. Ölçek çubuğu 50 um =. Bu rakamın büyük halini görmek için buraya tıklayın.

Şekil 3,
Şekil 3. yaşlanmış hücrelerde γ-H2AX Foci arttırıldı. WI-38 hücreleri ya çoğalan "Küçük" (PDL 30) veya replikatif yaşlanma (PDL 53), sabit ve anti-γ-H2AX antikorları ve DAPI ile boyanmıştır. yaşlanmış hücrelerde γ-H2AX odaklarının sayısında bir artış not edin. Görüntüler konfokal mikroskop ile elde edildi. Z bölümler alındı ​​ve maksimum yoğunluk tüm DETEC görselleştirmek için tek bir düzlem görüntü elde etmek için kullanılmıştırTablo odaklar. Ölçek çubuğu 20 um =. Bu rakamın büyük halini görmek için buraya tıklayın.

Şekil 4,
Şekil yaşlanmış hücrelerde SAHF 4. Floresan boyanması. (A) 'Üreyen WI-38 hücreleri (PDL 27) işlenmemiş ya da iyonize edici radyasyon (IR) maruz bırakıldı. 10 gün sonra, hücreler, SAHF (İR ile muamele edilmiş hücrelerde yoğun / noktasal DAPI lekelemesi dikkat edin) (B) 'IDH4 deksametazon varlığında büyütüldü (çoğalan) ya da yaşlanmayı uyarmak için kömür-boşaltılmış FBS içinde (görselleştirmek için DAPI ile boyanmıştır yaşlanmış). 10 gün sonra, hücreler, H3K9Me2 ve DAPI karşı antikorlarla boyandı. Görüntüler konfokal mikroskop ile elde edildi. Z bölümler alındı ​​ve maksimum yoğunluk projeksiyonu tek düzlem elde edilmesi için kullanılmıştırgörüntüsü. Yaşlanmış hücreler noktalı DAPI lekelemesi sahip iken, (A) ve (B) olarak çoğalan hücrelerin, yaygın DAPI lekelemesi sahiptir. H3K9Me2 boyama daha sağlamdır ve yaşlanmış hücreler DAPI ile boyanmış odağı olan lokalize ise (B), kontrol hücreleri, H3K9Me2 için yaygın, çok hafif lekelenme sahiptir. Ölçek çubuğu 20 um =. Bu rakamın büyük halini görmek için buraya tıklayın.

Şekil 5,
Senesans ile ilişkili proteinlerin Şekil 5. miktarının belirlenmesi. iyonlaştırıcı radyasyon 10 Gy (İR) maruz bırakıldı ve IMR-90 hücreleri (-) protein çoğalan "Küçük" (PDL 30), IMR-90 hücrelerden izole edilmiştir. Ortam maddesi her 48 saat değiştirildi ve hücreler, IR sonra 7 d parçalanmıştır. Örnekler, anti-p16 INK4a Antibo ile immüno, SDS-PAGE ile analiz edildikalıplar, ve anti-p21 ve daha sonra anti-p53 antikorları ile yeniden problanmıştır. GAPDH bir protein yükleme kontrolü olarak kullanılmıştır. Bu rakamın büyük halini görmek için buraya tıklayın.

Şekil 6,
Senesans ile ilişkili mRNA ve SASP Proteinlerin Şekil 6. miktarının belirlenmesi. (-) iyonize edici radyasyon (IR) 10 Gy maruz bırakıldı veya WI-38 hücreleri (A) RNA ya da çoğalan "Küçük" (PDL 27 veya 34), WI-38 hücreleri izole edilmiştir. Ortam maddesi her 48 saat değiştirildi ve RNA izolasyonu IR sonra 7 d gerçekleştirilmiştir. RT-QPCR Tablo 1'de listelenen gene özgü primerler kullanılarak belirtilen senesans ile ilişkili mRNA seviyelerini ölçmek için kullanıldı. 18S seviyeleri normalleştirilmesi için kullanılmıştır. histogramlar ortalama normalize t temsil5 bağımsız deneyden o muamele edilmemiş ± SEM. (B), WI-38 hücreleri (PDL 26) IR 10 Gy maruz bırakıldı; 10 d sonra, ortam serum içermeyen ortama değiştirilmiştir (bakınız Bölüm 7 ye bakınız). 24 saat sonra, koşullandırılmış ortam toplandı ve IL-6, IL-8 ve GROa düzeyleri ELISA tahlilleri kullanılarak ölçüldü. Histogram 3 deneyden elde edilen ortalama ± SEM temsil eder. * Student t-testi ile P <0.05 ve *** p <0.001. Bu rakamın büyük halini görmek için buraya tıklayın.

İnsan Astarlar ileri Ters
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GTT AGA AGT GTCTTC AGA T
CDKN1A (p21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL-6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL-8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tablo 1: senesans ile ilişkili mRNA için RT-qPCR astarlar. RT-qPCR SYBR yeşili teknoloji kullanımı için, ileri ve geri primerler, gösterilir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Burada, insan diploid fibroblastlarının kullanılarak replikatif ve DNA hasarına neden olduğu yaşlanma için yöntemler tarif etmişlerdir. Buna ek olarak, protein ve çeşitli senesans ile ilişkili proteinlerin mRNA seviyelerini ölçmek için teknikler, aynı zamanda boyama SA-β-gal ve DNA hasarına işaret γ-H2AX için edilmektedir. Birçok nokta vivo 20 yaşlanmayı karakterize etmek için mevcut olmakla beraber bu protokoller yaygın in vitro ve in vivo olarak yaşlanan fenotipleri değerlendirmek için de kullanılabilir. Diğer hücreler de yaşlanmış hücreler olmasa bile, yaşlanmış işaretlerini ifade edilebilir. Örneğin, bu tür osteoklastlar ve makrofajlar gibi hücreler, β-gal aktivitesi 32, 33 arasında daha yüksek seviyelerine sahiptirler. Buna ek olarak, pek çok kanser hücreleri p16 Ink4a 34 upregüle var. Hücreler, aynı zamanda, DNA hasarını (örneğin, γ-H2AX odak) ve yaşlanmış vermeye birikebilir. SASP faktörler de tarafından arttırılabilmektedirçeşitli normal fizyolojik da yaşlanmış hücreleri ile ilişkili olabilir veya olmayabilir patolojik durumlar. In vivo olarak yaşlanmayı değerlendirmek yüzden, özellikle, birden fazla yaşlanmayla belirteçleri, kullanılmalıdır.

Yaşlanmış hücreler 20 yıldan fazla önce 4 Normal yaşlanma dokularda artmış bulunmuştur rağmen, ancak şimdi tam olarak yaşlanmış hücreler hem normal doku homeostazında ve patolojik koşullarda oynadığı rollerin bolluk takdir olmasıdır. P16 Ink4a pozitif yaşlanan hücreleri ortadan kaldırmak için fare modellerinin son istihdam araştırmacılar daha net izin ve kesin doku ve organlarda 35, 36, 37 yaşlanmış hücrelerin rolünü takdir etmiştir. Bu modeller, yaşlanmış hücreler yaşla ilgili patolojilerin, tümör oluşumunun çok sayıda katkıda bulunduğu ortaya ve fare ömrü 35 adres </ sup>, 36, 37. Bu son keşifler ve fizyolojisi yaşlanmış hücrelerin önemi doğrulama göz önüne alındığında, zaman bu özel hücreler üzerinde daha fazla araştırma için olgunlaşmıştır. Örneğin, çalışmalar, terapötik yaşlanmış hücreleri çıkarmak için veya yaşlanması hem Healthspan'in ve ömrü çalışmaları için yararlı olabilir geciktirmek için stratejiler kullanılarak.

Son zamanlarda, bizim laboratuvar o metformin, yaygın tip 2 diabetes mellitus tedavisinde kullanılan bir ilaç, hücre yaşlanmasının 38 azalır bulundu. Metformin şu anda bir anti-aging tedavi olarak önerilen ve anti-kanser özelliklere 39, 40 sahiptir ediliyor gibi, bu ilaç veya diğer yaşlanma müdahaleler, hücresel yaşlanmayı modüle tarafından sağlık sonuçlarını etkileyebilecek olmadığını keşfetmek için gelecekte ilginç olacaktır.

Burada tartışmak protokoller yaygın yaygın ve vardırccepted teknikleri yaşlanma fenotipini değerlendirmek. In vitro olarak yetiştirilen hücreler için, hücreler (bakınız Şekil 1 ve 2'ye bakınız) yaşlanmış olmasını sağlamak amacıyla, düzleştirilmiş bir morfolojiye bir aks-benzeri hücre değişiklikleri izlemek için çok önemlidir. Hücreler SA-β-gal veya burada tarif edilen diğer belirteçler için pozitif değilse, (replikatif yaşlanma için) veya DNA hasarı ile indüklenen yaşlanmadan sonra artan bir zamanda daha yüksek hücre PDL'ler de yaşlanmayı değerlendirmek. Buna ek olarak, bu protokoller farklı hücre tipleri için optimize edilmesi gerekebilir. SASP protein seviyelerini değerlendirmek için, ELISA veya protein dizileri yüksek geri plan seviyelerinde neden olarak, hücre ortamından serumun ayrılması için çok önemlidir. Deney tasarlarken aynı anda birden belirteçleri değerlendirmek için ideal olmayabilir Bu nedenle, bunu göz önünde bulundurun.

Burada tarif edildiği gibi SA-β-gal lekeleme, bu hücrelerin tespit gerektirmesidir ile sınırlıdır.Buna ek olarak, hücre izdiham SA-β-gal etkinliğini etkilediği gösterilmiştir. Protokoller 41, 42, 43, akış sitometrisi kullanılarak canlı hücreler bu belirtecin ölçülmesini sağlar β-gal aktivitesi için bir florojenik substrat kullanılarak SA-β-Gal aktivitesini değerlendirmek için geliştirilmiştir. SA-β-gal etkinliğini de kemilüminesan yöntem 44 ile hücre lizatlarında ölçülebilir. Buna ek olarak, γ-H2AX da akış sitometrisi veya hücre lizatları 45 immunoblotting dahil olmak üzere çeşitli metotlar kullanılarak ölçülebilir.

SAHF oluşumu hücre hattı bağlı olduğu unutulmamalıdır ve çok ilişkili olduğu onkogen kaynaklı senesens 20, 30, 46. Bu nedenle, SAHF tüm yaşlanmasının modellerde mevcut olmayabilir. faydasıFare modellerinde yaşlanmış marker olarak SAHF da SAHF genellikle fare yaşlanmış hücrelerde 30, 46, 47 gözlenmemiştir gerçeği ile sınırlı olabilir. Burada, H3K9Me2 karşı antikorlar kullanılmıştır, ancak SAHF diğer moleküler markörler macroH2A, yüksek mobilite grubu bir (HMGA) proteinleri ve tri-metillenmiş lizin 9 histon H3 (H3K9Me3) ve bağlı HP1 proteinler de dahil olmak üzere, kullanılabilir. Buna ek olarak, kromatin immüno-çökeltme deneyleri, histon işaretleri ya da E2F hedef genlere bağlayıcı proteinlerin kromatin ilişkiyi değerlendirmek için de kullanılabilir.

Bir belirteçler için heterojenlik ve bu belirteçler yaşlanan hücrelerde münhasıran ifade edilmez gerçeği de dahil olmak üzere, yaşlanmayı karakterize etmek için çeşitli sınırlamalar olduğunu bilmelidir. Çoklu (genel olarak, 2-3) markörleri burada açıklanmayan işaretleri içeren, yaşlanmayı değerlendirmek için kullanılması gerekmektedir. Örneğin DNA-yara izi, telomerhasar ve / veya DNA hasarı sinyali de ölçülebilir. Ayrıca, yaşlanma ve, özellikle de, SASP fenotip olarak, son zamanlarda senesens 11, 12, 13 neden olmaktadır, belirli bir stres veya hasar etkilendiği gösterilmiştir, her deneysel örnekte, birden fazla belirteci değerlendirmek için önemlidir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgments

Bu çalışma Ulusal Sağlık Enstitüleri İntramural Araştırma Programı, Ulusal Yaşlanma Enstitüsü tarafından desteklenmiştir. Yazarlar ayrıca eleştirel el yazması okumak için yaşlanma ve kotb Abdelmohsen ilgili birçok yararlı tartışmalar için Myriam Gorospe ve kotb Abdelmohsen teşekkür etmek istiyorum. Biz de eleştirel el yazması okumak için, özellikle Douglas Dluzen bizim laboratuvar üyelerine teşekkür.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Teknikler İndüklemek ve Ölçmek Hücresel Yaşlılık etmek
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter