We have previously used variations of this method to generate escape variants to human and murine mAbs induced by the seasonal influenza virus vaccine, H7N9 vaccination, or sequential DNA/recombinant HA protein vaccination4,5,6,7. As described above, antibodies were first characterized using the HI and microneutralization assays in order to inform us of which specific protocol to continue with next4,5. Antibodies 07-5D03, 07-5F01, 07-5G01, 07-4B03, 07-4E02 and 07-4D05 were found to have HI and neutralization activities against the avian H7N9 virus (A/Shanghai/1/2013) (Table 1), and thus protocol 1 (step 2.1) was utilized. For mAbs with neutralizing that lack HI activity, such as 41-5E04, 045-051310-2B06, 042-100809-2F04 and S6-B01 (Table 1), protocol 2 (step 2.2) was used to generate escape variants. Escape mutant mapping revealed that many of the antibodies recognize critical residues in distinct locations on the viral HA4,5 (Figure 4). While the majority of the HI-positive antibodies have escape mutant residues near previously reported antigenic sites of the H7 HA, the HI-negative antibodies generated escape mutants with point mutations in the stalk region4,5.
| Antibody | HI Activity | NEUT Activity |
| 07-5D03 | + | + |
| 07-5F01 | + | + |
| 07-5G01 | + | + |
| 07-4B03 | + | + |
| 07-4E02 | + | + |
| 07-4D05 | + | + |
| 41-5E04 | - | + |
| 045-051310-2B06 | - | + |
| 042-100809-2F04 | - | + |
| S6-B01 | - | + |
Table 1: Table of antibody HI and neutralization activity. Ten H7-specific mAbs isolated from individuals vaccinated with an experimental H7N9 vaccine exhibit different in vitro antiviral activities5.
| Forward Primer (5' to 3') | Reverse Primer (5' to 3') | Thermocylcer conditions |
| IAV | TATTCGTCTCAGGGAGCAAAAGCAGGGG | ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT | 42 ºC for 60 min, 94 ºC for 2 min/5 cycles of 94 ºC for 20 s, 50 ºC for 30 s and 68 ºC for 3 min 30 s, followed by 40 cycles of 94 ºC for 20 s, 58 ºC for 30 s, and 68 ºC for 3 min 30 s with a final extension time at 68 ºC for 10 min |
| IBV | GGGGGGAGCAGAAGCAGAGC | CCGGGTTATTAGTAGTAACAAGAGC | 45 ºC for 60 min, 55 ºC for 30 min, 94 ºC for 2 min/5 cycles of 94 ºC for 20 s, 40 ºC for 30 s and 68 ºC for 3 min 30 s, followed by 40 cycles of 94 ºC for 20 s, 58 ºC for 30 s, and 68 ºC for 3 min 30 s with a final extension time at 68 ºC for 10 min |
Table 2: Universal influenza virus primers. Primer pairs for the amplification of the HA segments of influenza A27 and B28 viruses and their respective thermocycler conditions.

Figure 1: HI assay. (A) A schematic for the setting up a HI assay to test the activity of two mouse H1-specific mAbs 7B2 (head-specific) and 6F12 (stalk-specific) using a 96-well V-bottom plate, and (B) an example of the results of an HI assay23. Please click here to view a larger version of this figure.

Figure 2: Microneutralization assay. A schematic for setting up a microneutralization assay to test the activity of two human mAbs 4D055 and CR911417. Please click here to view a larger version of this figure.

Figure 3: Generation of escape mutants. The methodology suggested will be dependent on the HI and the microneutralization activity exhibited by the antibody. The generation of escape mutants against (A) neutralizing HI-positive antibodies may require a single passage in eggs, while (B) neutralizing HI-negative antibodies may involve multiple passages with increasing antibody amounts in cell tissue culture. Please click here to view a larger version of this figure.

Figure 4: An example of an epitope map of the novel avian H7N9 HA generated with escape mutant variants. Vaccine-induced antibodies isolated from individuals vaccinated with a candidate H7N9 influenza A vaccine were used to generate escape mutant variants. Each residue indicated in red represents the location of critical amino acids required for efficient binding of a mAb. Data were adapted from Dunand-Henry et al., 20154. Please click here to view a larger version of this figure.