Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Cancer Research

דור של סרטן הערמונית תאים מודלים של ההתנגדות דוסטקסול סוכן אנטי mitotic

doi: 10.3791/56327 Published: September 8, 2017

Summary

עמידות לטיפולים בסרטן תורמת התקדמות המחלה והמוות. קביעת את הפסיכולוגי מכניסטית של ההתנגדות היא קריטית לשיפור תגובה טיפולית. כתב היד הזה פרטים הפרוטוקול ליצירת תאים עמידים taxane מודלים של סרטן הערמונית (PC) כדי לעזור לנתח את המסלולים מעורבים סדר דוסטקסול ההתנגדות בחולים PC.

Abstract

Microtubule מיקוד סוכנים (MTAs) הם עמוד התווך בטיפול של מגוון רחב של גידולים. עם זאת, ההתנגדות רכשה תרופות כימותרפיות הוא מנגנון משותף של התקדמות המחלה, תכונה prognostic-דטרמיננטה של גידולים ממאירים. ב סרטן הערמונית (PC), עמידות MTAs כגון taxane דוסטקסול מכתיב כישלון הטיפול, כמו גם התקדמות לקראת שלבי קטלני המחלה המוגדרות על-ידי פרוגנוזה ושיעורי תמותה גבוהה. למרות למד במשך עשרות שנים, המערך של המנגנונים תורם ההתנגדות רכשה אינה מובנת לחלוטין, ובכך להוות מגבלה משמעותית להתפתחות של אסטרטגיות טיפוליות חדשות יכול להועיל לחולים אלה מתקדמים בשלבים של המחלה. ב פרוטוקול זה, אנו מתארים את הדור של שורות תאים עמידים דוסטקסול סרטן הערמונית לחקות תכונות קטלני של סרטן הערמונית בשלב מאוחר, ולכן יכול לשמש כדי לחקור את המנגנונים מאת chemoresistance הנרכש אשר נשאלת. למרות מגבלות פוטנציאל מהותי מודל תא מבוסס, כגון האובדן של מאפייני עמידות לאורך זמן, הקווים תא דוסטקסול עמיד המיוצר על ידי שיטה זו שימשו בהצלחה במחקרים אחרונים ומציעים הזדמנות לקדם את שלנו הבנה מולקולרית של chemoresistance רכשה בסרטן ערמונית קטלני.

Introduction

שיעור מוגבר של התפשטות הנגרמת על ידי השליטה מחזור התא מהווה סימן היכר של סרטן1. מלון פונקציונלי זה מעבד תאים סרטניים תלויות באופן ייחודי הנאמנות של תהליכים מרכזיים של מחזור התא במהלך S - ו M-שלבים, אשר הובילה להתפתחות של מחזור התא השונים perturbing תרופות יגרמו נזק לדנ א או פגמים mitotic. למרות אינספור גורמים אנטי mitotic, כמו מעכבי של mitotic kinases או חלבונים מוטוריים, כעת בשלבי פיתוח של ניסויים קליניים שנבדקו ב, סוכנים מיקוד microtubule מהדור הקודם (MTAs) להמשיך להיות הגישה רפואית אישרה רק עבור פילוח מיטוזה סרטן-2,-3,-4. MTAs או יציבות (Vinblastine, Vincristine, Vinorelbine) או לייצב microtubules (נגזר taxane סוכנים פקליטקסל, דוסטקסול או Cabazitaxel), ובכך למנוע היווצרות של תפקוד פלך mitotic5,6. סוכנים אלה לעורר את ציר הרכבה מחסום7,8, אשר תוצאות מעצר mitotic ממושך ולאחר מות תאים בסופו של דבר תאים בתרבית9,10 , פגמים mitotic גידולים11 ,12 והם ולכן יעיל לטיפול במגוון גדול של סוגי סרטן, ביניהם סרטן הערמונית13.

לעתים קרובות ביותר אובחן סרטן הערמונית סרטן, הסיבה המובילה של סרטן הקשורים מקרי מוות בקרב גברים14. סוכני antimitotic כגון דוסטקסול לשפר את ההישרדות של סרטן הערמונית החולה, עמוד התווך בטיפול של16,15,זו מחלה17. למרבה הצער, למרות הצטמקות הגידול הראשוני, תאים סרטניים לעתים קרובות לפתח עמידות לתרופות במהלך הטיפול. המנגנונים התאיים מספר היו מעורבים בגרימת ההתפתחות של chemoresistance, כולל הסרת הפיקוח של מוות מסלולים דלקתית או הפעלה/ביטוי של משאבות בזרימת סמים כמו המשגר קלטת מחייב ATP P-גליקופרוטאין (P-gp/ABCB1), הצופות על תוצאות הייצוא של כימותרפיות סוכנים מחוץ תאים18,19. התנגדות taxanes כבר מקושר גם עם גורמים אחרים, כגון שינויים בביטוי של טובולין isotypes או מוטציות טובולין, למנוע את האינטראקציה בין התרופה שלה 20,מטרה21. יתר על כן, ההתנגדות קשורה להצטברות יציבות הגנום ואת הגידול הטרוגניות22,23. עם זאת, המנגנונים תורם taxane ההתנגדות הם אינה מובנת לחלוטין, אשר מתבטא בהעדרה של אסטרטגיות טיפוליות המונעות את המראה שלה. לכן, יש צורך דחוף לייצר גרסאות ניסיוניות לסייע הקרע של מנגנונים אלה, וכן לזיהוי רומן גישות טיפוליות, למנוע ההתפתחות של עמידות לתרופות אלה.

במאמר זה אנו מתארים שיטה המאפשרת הדור של דוסטקסול עמידים (ד ר) תאים סרטניים בערמונית. בהמשך נתאר כיצד לאמת את מצב ההתנגדות של תאים אלה באמצעות מבחני היווצרות המושבה ו- RT-PCR כמותי. התאים המיוצרים על ידי שיטה זו יש את היתרון של recapitulating רבות מהתכונות מולקולרית נמצאו מסדי נתונים לדוגמה גידול אנושי זמין לציבור עם מוסף של מתן צדדיות כדי לבצע מגוון רחב של מבחני ניסיוני מעל תקופות זמן ארוכות יותר מזו שמותרת על ידי דגימות הגידול. מודלים אלה סרטן ההתנגדות טיפול יכול להיות מורחבת במשך שבועות רבים בתרבות רקמה, ובין גישות אחרות, יכול להיות גנטית מניפולציות, דמיינו ידי מיקרוסקופ שיטות וניתח על ביטוי גנים. יתר על כן, הם יכולים להיות xenotrasplanted בעכברים לנתח עוד אפקטים ב הגידול היווצרות וצמיחה בתוך vivo. כיום, השיטה החלופית העיקרית ללמוד תרופתיים בהקשר של סרטן הערמונית הוא ניתוח ישירה של דגימות הגידול. בזמן דגימות אלה להציג מערכת מאוד חזק כדי לאסוף מידע על ביטוי גנים ומצב mutational של גידולים נתון, גישה אליהם יכול להיות מוגבל מאוד והם קשה לשמור על מניפולציות נוספות וניתוח ניסיוני, אשר בקלות ניתן לעשות עם הקווים התא שנוצר עם זה פרוטוקול24,25. חשוב לציין, בעתיד, חלופה ניגש כמו הדור של האדם נגזר organoids ישירות מחולים להיות כלי רב עוצמה, אלטרנטיבה בהווה השיטה26,27. מאז, מסכם את הם הדברים בהקשר תלת-ממד איזה גידול היה לסביבתו המקורי organoids יהיה הדגם המושלם בין שורות תאים אנושיים גידולים. ובכל זאת, הדגמים תא ניסיוני שמתואר פרוטוקול זה הם סבירים כדי לשמור על עוד יותר ומתאים ניתוח מהיר יותר. התוצאות המתקבלות על ידי לימוד אלה שורות תאים יכולים להיות אקסטרפולציה, לאשר דגימות האנושי ובתרבויות תלת-ממד. לכן, פרוטוקול זה יכול להיות מעניין עבור חוקרים המבקשים תא מודלים ללמוד מנגנונים chemoresistance בתור כל תא, שכן פרוטוקול שלנו ניתן להתאים המחקר של סמים, סוגי סרטן אחרים. השיטות המתוארות כאן בקרבת להחיל במעבדה כלשהי, סביר ולאפשר מחקרים ראשוניים של המנגנונים המולקולריים הסלולר של עמידות לתרופות.

Protocol

1. קביעת ריכוז דוסטקסול גורם 50% ירידה ביכולת היווצרות המושבה (IC50)

הערה: ב פרוטוקול זה, ריכוז דוסטקסול IC50 יוערכו באמצעות הקמת המושבה יכולת. שיטות אלטרנטיביות המשמשים להערכת הכדאיות תא (קרי, מבחני MTS) יכול לשמש בהתבסס על החוקרים ' העדפות.

  1. DU145 לגדול או 22Rv1 תאי בקבוקון 2 75 ס מ ולהכין מלאי מספיק של 10 מ מ דוסטקסול מעורבבת עם דימתיל סולפוקסיד כדי לשמש בניסויים בעתיד.
  2. צלחת תאים עבור קביעת IC50 של דוסטקסול, להסיר מדיה הבקבוק, לשטוף היטב תאים עם 5 מ"ל PBS של דגירה עם 2 מ"ל 0.05% טריפסין-EDTA למשך 3-5 דקות ב 37 ° C כדי לנתק תאים מפני השטח הבקבוקון.
  3. לשטוף את התאים trypsinized מן הבקבוק באמצעות 5 מ של מדיה טריים ולאסוף התליה תא בשפופרת 15 מ"ל. גלולה תאים על ידי צנטריפוגה (300 x g, 3 דקות, בטמפרטורת החדר (RT)).
  4. להסיר את תגובת שיקוע, resuspend בגדר תא ב 5 מ של מדיה טריים ולספור את התאים. לדלל התליה תא 2-2.5 x 10 5 תאים/mL עבור DU145 ו- 4-4.5 x 10 5 תאים/mL עבור 22Rv1, לערבב היטב על ידי pipetting למעלה ולמטה, זרע 2 מ"ל של התליה של כל טוב של שתי צלחות 6-ובכן.
  5. לאחר 24 h, כאשר התאים נמצאים ב- 70-80% הנהרות, להוסיף מנה הסלמה ריכוזי דוסטקסול 1 nM, 2.5 ננומטר, 5 nM, 10 nM, 25 nM, 50 nM, 100 ננומטר, 250 ננומטר, 500 ננומטר, nM 1000 מכל קידוח. מתייחסים הפקד היטב עם דימתיל סולפוקסיד בווליום הגבוה ביותר המשמש דוסטקסול ( איור 2 א).
  6. לאחר 72 h, תשאף תרופה המכילה מדיה ולהוסיף 2 מ"ל של מדיה חדשה. בתוך כ 4-5 ימים, הלוחות יהיה מוכן עבור צביעת.
  7. כתם המושבות-לשטוף אותם בעדינות עם 2-3 מ"ל PBS, דגירה אותם עם 2-3 מ ל פתרון קריסטל ויולט (0.1% w/v בפורמלין 10%) 20 דקות בתוך המנוע תרביות רקמה או ברדס fume.
  8. להסיר את הלוחות פתרון ושטוף מכתימים עם 2-3 מ"ל של H 2 O, להסיר H 2 O ו מילה נהדרת צלחות.
  9. לנתח את התוצאות דמיין את בארות כדי לקבוע איזה מהם יש את הריכוז דוסטקסול זה הקטנת הכדאיות תא ב-50% (IC50). באופן ידני לספור מושבות בעזרת עט מרקר (כדי למנוע לספור את המושבות אותו פעמיים), לייצג את אחוז תא הכדאיות בגרף ( איור 2 א). ולבסוף, לקחת תמונות דיגיטליות של הלוחות לייצוג איור (כפי שמוצג באיור 3 א).

2. הדור של תאי סרטן הערמונית עמיד דוסטקסול

הערה: לבצע טיפולים התא באמצעות דוסטקסול באותו פתרון המניה המשמש לקביעת ריכוז התרופה IC50 (להכין מספיק מלאי מראש על ניסיוני השתמש). תמיד לשמור את בקבוקון קטן של תאים מהשלב הקודם, רק במקרה משהו לא עובד טוב. תאים הורים צריך להיות גדל במקביל בקבוקון קטן לאורך כל התהליך, נחשפים הרכב (דימתיל סולפוקסיד) בכמויות המתאימות מחקה הכמויות בשימוש המבחנות דוסטקסול התייחסו.

  1. תא DU145 צלחת או 22Rv1 ב 150 ס"מ 2 מבחנות המכילות 20 מ של מדיה (3.5 x 10 6 תאים לכל הבקבוק עבור DU145 ו- 6.5 * 10 6 תאים לכל בקבוק של 22Rv1). שימוש של 10 עד 20 צלוחיות של תאים מומלץ לפנות מספיק תאים בסוף הפרוטוקול.
  2. לאחר 24 שעות, כאשר כ- 70-80% הנהרות ( איור 2B, לפני דוסטקסול), להוסיף דוסטקסול הריכוז IC50 שנקבע בשלב 1 של הפרוטוקול (5 nM עבור התאים שמתואר פרוטוקול זה).
  3. לאחר 72 h, תשאף תרופה המכילה מדיה ולהוסיף טריים, ללא דוסטקסול מדיה ( איור 2B, 72 h לאחר דוסטקסול). לשנות את המדיה כל 3-4 ימים. בתוך כ- 1-2 שבועות, שיבוטים עמיד יופיעו ניכר תחת המיקרוסקופ ( איור 2B, 7 ל 14 ימים לאחר דוסטקסול).
  4. תשאף מדיה, לשטוף היטב תאים עם 15 מ"ל PBS, דגירה עם 4 מ"ל 0.05% טריפסין-EDTA למשך 3-5 דקות ב 37 ° C כדי לנתק תאים מפני השטח הבקבוקון.
  5. Resuspend trypsinized תאים מן הבקבוק באמצעות 8 מ של מדיה חדשה. בריכת תאים כל צלוחיות שטופלו. גלולה תאים על ידי צנטריפוגה (300 x g, 3 דקות, RT).
  6. להסיר את תגובת שיקוע, resuspend בגדר תא ב- 20 מ של מדיה חדשה, צלחת התאים 150 ס"מ 2 מבחנות (3.5 x 10 6 תאים לכל הבקבוק עבור DU145 ו- 6.5 * 10 6 תאים לכל בקבוק של 22Rv1).
  7. לאחר 24 שעות, כאשר כ- 70-80% הנהרות, להוסיף 5 nM דוסטקסול (ריכוז IC50 הראשונית) שוב.
  8. חזור על שלבים 2.3 ל 2.6 על יום 3-
  9. לאחר 24 שעות, כאשר כ- 70-80% הנהרות, התייחס תאים עם ריכוז דוסטקסול IC50 X 2 (10 ננומטר עבור התאים שמתואר פרוטוקול זה).
  10. חזור על צעדים 2.3 ל- 2.8, בעקבות של המינון של דוסטקסול ריכוזים (25 ננומטר, 50 nM, 100 ננומטר, 250 ננומטר), כדי ליצור אוכלוסייה יציבה של תאים הגדלים שלך מימיות מתחת הריכוז הגבוה ביותר הסופי. עבור ריכוז גבוה, ניתן ליישם את הפרוטוקול המינון עד 6 חודשים עד ריכוז nM 1,000 ( איור 1 א').

3. פונקציונלי ואפיון של רכשה דוסטקסול ההתנגדות מאת המושבה היווצרות Assay

הערה: ב פרוטוקול זה, chemoresistance יוערכו באמצעות מבחני היווצרות המושבה. שיטות אלטרנטיביות המשמשים להערכת הכדאיות תא (קרי, מבחני MTS) יכול לשמש בהתבסס על החוקרים ' העדפות.

  1. צלחת 2,000 תאים (DU145 או 22Rv1, גם ההורים וגם עמידים דוסטקסול) לכל טוב ב- 6-ובכן צלחות, באמצעות 2 מ"ל של מדיה לכל טוב.
  2. לאחר 24 h, להוסיף הגדלת ריכוזים של דוסטקסול (תאים הורים: 0.25, 0.5, 1, 2.5 ו- 5 ננומטר; ד ר תאים: 50, 125, 250, 500 ו-1000 ננומטר). עבור שורות תאים הן DU145 והן 22Rv1. להוסיף דימתיל סולפוקסיד רק טוב כפקד באותה רמת עוצמה המשמש את המינון הגבוה ביותר של דוסטקסול.
  3. לאחר 72 h, תשאף תרופה המכילה מדיה ולהוסיף מדיה טריים ללא דוסטקסול.
  4. תקופת דגירה צלחות של 1-2 שבועות עד מושבות גלויים תחת המיקרוסקופ.
  5. כתם המושבות-לשטוף אותם בעדינות עם 2-3 מ"ל PBS, דגירה אותם עם 2-3 מ ל פתרון קריסטל ויולט (0.1% w/v בפורמלין 10%) 20 דקות בתוך המנוע תרביות רקמה או ברדס fume.
  6. להסיר את הלוחות פתרון ושטוף מכתימים עם 2-3 מ"ל של H 2 O, להסיר H 2 O ו מילה נהדרת צלחות.
  7. לנתח תוצאה ידי להמחיש הבארות וספירת ידנית מושבות בעזרת עט מרקר (כדי למנוע לספור את המושבות אותו פעמיים), לייצג את אחוז תא הכדאיות בגרף. תמונות דיגיטליות של הלוחות לייצוג איור ( איור 3 א).

4. פנוטיפי אפיון של דוסטקסול ההתנגדות רכשה פנוטיפ באמצעות ניתוח לרביעיית-PCR

הערה: תאים דוסטקסול עמידים (ד ר) התערוכה פרופיל ביטוי שונה לעומת שורות תאים הורים שלהם 28 , 29. לפיכך, ההצלחה של הבחירה ניתנת לאימות כמקורית לרביעיית-PCR באמצעות תחל לסמני ספציפי (עבור רצפים פריימר, עיין בסעיף החומרים; לקבלת פרטים, עיין בסעיף ' תוצאות '). זה צריך להיעשות לאחר כל סיבוב של הבחירה מתחיל אחרי הסיבוב השלישי. לחלופין, הערכה של פנוטיפ עמידים דוסטקסול על ידי סופג המערבי אפשרי גם.

  1. לחלץ RNA מתאי הורים וגם עמידים דוסטקסול באמצעות ערכת חילוץ של RNA ובעקבות היצרן ' s הוראות (ראה את הטבלה של חומרים, ריאגנטים לפרטים). שימוש מינימלי של 1-2 x 10 6 תאים מומלץ.
  2. Quantify RNA-260 ננומטר ספיגת, שימוש ספקטרופוטומטרים. טוהר הטוב ביותר, 260 ננומטר/280 ננומטר ספיגת יחס צריך להיות קרוב 2.0.
  3. Perform הפוך שעתוק להשיג DNA משלימים (cDNA) באמצעות ערכת שעתוק במהופך ובעקבות היצרן ' s הוראות (ראה את הטבלה של חומרים, ריאגנטים לפרטים), באמצעות µg 1 של רנ א ב µL 20 תערובת התגובה (אם כמות גבוהה יותר של cDNA נדרש, קנה המידה של המיקס התגובה בהתאם).
  4. להכין את התגובה qPCR דולר עבור ג'ין כל עניין כדלקמן:
    - 2 µL של 10 מיקרומטר פריימר לפנים
    - 2 µL של 10 מיקרומטר פריימר הפוכה
    - 10 מיקס מאסטר SYBR Green PCR µL
    - 5 µL H 2 O
    -µL 1 של cDNA החדש מוכן מהשלב 4.3.
    הערה: ראה טבלה של חומרים עבור רצפי תחל בשימוש בפרוטוקול זה.
  5. להגדיר את תוכנית ה-PCR כדלקמן:
    - 95 מעלות צלזיוס למשך 15 דקות
    - 94 ° C ל 30 s |
    -56 ° C 40 s | 40 פעמים
    - 72 מעלות צלזיוס ל 30 s |
  6. לניתוח תוצאות qPCR ולקביעת שינויים בביטוי הגנים בין הורים, ד ר, ערכי הסף (Ct) מחזור עבור כל הגן עניין נקבעים שהפקידים ודוגמאות הממוצע מנורמל לפקד טעינה (אקטין triplicate ממוצע ) עבור ד ר (Ct ד ר) ותאים הורים (Ct הורים). הערכים עבור התאים הורים הם מנורמל ל- 1. ΔCt (Ct ד ר - Ct הורים) הוא נחוש בדעתו להשיג mRNA הסופי הקיפול שינויים, מיוצגים בגרף. גידול של > 2 או ירידה של < 0.5 נחשב משמעותי, אימות טוב של הקמת דוסטקסול רכשה עמיד פנוטיפ ( איור 3B).

Representative Results

פרוטוקול זה יוביל הדור של תאי סרטן הערמונית עמיד דוסטקסול (ד ר). ציר הזמן עבור השלמת ייתכן בטווח של 4 עד 7 חודשים כפי שמסוכם בצורה הסמלית של המדרגות פרוטוקול איור 1A , איור 1B. הזמן וההשקעה יכול להשתנות בהתאם את שורת התאים של הבחירה ואת טווח ריכוז סמים בשימוש כמפורט בפרוטוקול. חשוב, הקביעה של ריכוז דוסטקסול IC50 עבור כל קו התא מאפשר את העיצוב של הסם הסלמה טווח הריכוז לשימוש בפרוטוקול התאים של בחירה (איור 2 א). ברגע מופעל הפרוטוקול, הראשונית דוסטקסול השפעות על תאים DU145 ו- 22Rv1 יכול להיות שנצפו בנקודות זמן שונות מתחת למיקרוסקופ כדי לפקח אם הפרוטוקול פועל כראוי. הציע בנקודות זמן לעקוב אחר תהליך הטיפול דוסטקסול: לפני חשיפה דוסטקסול (בסיסית), לאחר חשיפה דוסטקסול במשך 72 שעות, 7 ימים ו- 14 ימים. שימו לב כי רק מיעוט של תאים סרטניים לשרוד את החשיפה דוסטקסול, ליצור שיבוטים, אשר יכול להיות שנצפו תחת המיקרוסקופ (איור 2B).

מבחני היווצרות נציג המושבה, כימות גרפים של הורים והתאים דוסטקסול עמידים (ד ר) החדש שנוצר מוצגים באיור 3 א. שימו לב כי התאים עמידים דוסטקסול שנוצר יכול לשרוד ריכוז התרופה עד 1,000-fold גבוה יותר מאשר התאים הורים.

לבסוף, הניתנים לאימות של פנוטיפ עמידים דוסטקסול על ידי לרביעיית-PCR (איור 3B). שימו לב כי תאים עמידים דוסטקסול, לעומת תאי הורים, להציג למעלה-רגולציה אופייני של ABCB1 ו- GATA2 ולמטה-רגולציה של CK19 ו- CDH1. גנים אלה נבחרו עבור אימות כי אנחנו כבר בניסוי הראו שפורסמו בעבר עבודה קולטנים upregulation GATA2, downregulation של CK19 יחד עם CDH1 שני ד ר תא מודלים28,29. הגן ABCB1 נבחר גם גן מצרך כי הוכח על-ידי אחרים להיות עקבי upregulated תאים עמידים בפני התרופה18,19. עם זאת, חשוב לציין גנים אחרים עשוי להיבחר בספרות ובהתאם הדגמים תא והסמים שנבחר ליצירת תאים עמידים על-ידי החוקר.

Figure 1
איור 1: ציר הזמן לדור של מודלים התא סרטן הערמונית עמיד דוסטקסול. (א) דיאגרמה נציג של ציר הזמן פרוטוקול לדור של דגמי תאים עמידים דוסטקסול. האיור מתאר את דוסטקסול וטיפול, אימות צעדים, הזמן הדרוש לכל חלק. (B) ייצוג סכמטי של השלבים אימות של פרוטוקול כולל המושבה פונקציונלי מבחני היווצרות של תאים הורים ו דוסטקסול עמידים מטופלים עם ריכוז דוסטקסול המצוין עבור 72 h (באדום), נציג גרף לרביעיית-PCR עבור אימות פנוטיפי ו'אחוז המושבה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: דור מערכות מודל התא סרטן הערמונית עמיד דוסטקסול. (א) דיאגרמה המתארת את הקביעה של IC50 דוסטקסול שורות תאים סרטן הערמונית הורים DU145 ו- 22Rv1 (שלב 1 לפרוטוקול). אחוזי הצפוי של הכדאיות תא, דוסטקסול מנה הסלמה הריכוזים הדרוש הינם כלולים. נציג DU145, 22Rv1 תא גרפים הכדאיות המציין 5 nM כמו IC50 לאחר 72 שעות של חשיפה דוסטקסול הינם כלולים. הניסויים triplicates ואת הנתונים מייצגים הדימויים מיקרוסקופיית שדה בהיר נציג של SD. (B) זאת אומרת ± של DU145, תאים 22Rv1 על המצוין פעמים במהלך הדור ההתנגדות דוסטקסול (שלב 2 לפרוטוקול). חצים אדומים מציינים שיבוט עמידים דוסטקסול לאחר השלמת את הפרוטוקול. גודל ברים = 50 ננומטר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: אפיון פנוטיפי פונקציונלי של הדגמים תאים עמידים דוסטקסול. (א) נציג המושבה מבחני היווצרות של תאים עמידים דוסטקסול הורים התייחסו עם ריכוז דוסטקסול המצוין עבור ה 72 אחוז של מושבות של ריכוז כל טיפול מיוצגים בגרף כלולים. הניסויים triplicates, הנתונים מייצגים את זאת אומרת ± SD. סולם ברים = 5 מ מ. (B) ד ר/הורים היחסי mRNA קיפול עלייה לכמת על ידי לרביעיית-PCR של ABCB1, GATA2, CK19, CDH1 מוצגים. כל הנתונים הגולמיים qPCR הוא מנורמל ל אקטין (ראה פרוטוקול לקבלת פרטים). הניסויים triplicates, נתונים מייצגים את זאת אומרת ± SD. * p < 0.05. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Discussion

כתב יד זה, אנו מתארים שיטה להפקת דוסטקסול עמידים סרטן הערמונית תאים דגם מערכות המאפשר חקר המנגנונים תורם רכישת פנוטיפ chemoresistance. אמנם גישה זו לשחזור ואמין מאוד, יש לקחת בחשבון כמה מגבלות אפשריות. מאז רק חלק קטן מהאוכלוסייה בכמות גדולה של תאים תערוכת chemoresistance28, מומלץ להתחיל עם אוכלוסיה גדולה של תאים (אנחנו בדרך כלל צלחת 20 צלוחיות של 150 ס מ2, המהוות כ 1.2 x 108 תאים). השלבים החשובים של הפרוטוקול להתייחס כדי להבטיח הצלחה של ההליך. ראשית, חשוב מאוד להשתמש את דוסטקסול אותה טריה מניות עבור שימוש לטווח ארוך (המניות 10 מ מ aliquots יכול לשמש עבור השנים בהן מאוחסנים כראוי ב- 80 ° C). שינויים קלים ב- דוסטקסול aliquot יכולים להשפיע את התוצאות של IC50, דור של התזמון קו תא ואת התוצאות היווצרות המושבה. שנית, זה הכרחי להפעיל את פרוטוקול הקובע את IC50 בכל שורה תא בודד, מאז וריאציות יכולות להתרחש בעת שימוש אוסף חדש של תאים. שלישית, זה חיוני כדי לפקח כי הטיפול בסמים הוא יעיל על-ידי בדיקת תאים במיקרוסקופ לעתים קרובות כך שגיאות במהירות ועוזרת מתוקן. לבסוף, אנו ממליצים לשמור תמיד על מלאי של שלבי הביניים במקרה של זיהום או בעיות בלתי צפויות, העלולה להשפיע על הכדאיות של התאים באמצע הפרוטוקול. חשוב, פרוטוקול שלנו שואפת ליצור מודלים של עמידות לתרופות על ידי חשיפת סרטן הערמונית תאים מינונים גבוהים של דוסטקסול עבור 72 h ואחריו תקופות החלמה ארוכה, במקום קבוע ריכוז נמוך יותר של הסם בניסיון לחקות את הטוב ביותר קליני תרחיש דיווח לטיפול בסרטן הערמונית עם זה taxane15,של הסוכן16.

בנוסף, יצוין כי תאים עמידים לתרופות התערוכה של פלסטיות גבוהה, דבר שעלול להוביל אובדן הדרגתי של מאפייני ההתנגדות רכשה לאורך זמן. לכן, הרחבת השימוש של תאים אלה עבור יותר מ 2-3 חודשים בתרבות אינו מומלץ. אם אספקת נחוצה, מומלץ ליצור באופן רציף חדש קבוצות של תאים עמידים. עם זאת, אם יש כבר תרבותי אצוות של תאים למשך זמן ממושך, מבחני היווצרות המושבה, qPCR יכול לשמש כדי להעריך מחדש את ההתנגדות שלהם. אלטרנטיבה אחרת היא להגביר את ההתנגדות המתמעט על ידי טיפול תאי עם מינון גבוה של דוסטקסול עבור 72 h (500-1, 000 ננומטר). לאחר תקופה של התאוששות של שבוע עד שבועיים, פנוטיפ יכול מחדש להיבדק על ידי היווצרות qPCR והמושבה מבחני. זה גם אפשרי, אם כי לא מומלץ, כדי לאחסן את aliquots של תאים שטופלו בחנקן נוזלי (ב FBS, דימתיל סולפוקסיד 10%). אנא שימו לב כי לאחר מחזור הפשרת ההקפאה, פנוטיפ chemoresistance צריך תמיד להיות הערכה מחדש עם השיטות דלעיל.

למרות אזהרות אלו, אנו28,29 ועוד30,31,32,33 הצליחו בהצלחה להעסיק המערכות מודל לזהות הסלולר מפתח רומן, מנגנונים מולקולריים המוביל גבוהות הגידול. מתחילה יכולת הישרדות cell, תוקפנות תאים עמידים דוסטקסול. באמצעות מערכות דגם אלה סרטן התא, גילינו שתאים מפגין פנוטיפ מובחן, המאופיינת על ידי היעדר בידול אפיתל, הקשורות הערמונית סמני והפיתוחים ביטוי של targetable (דרגה, קיפוד) איתות המסלולים, לשרוד חשיפה כימותרפיות28. במחקר השני, באמצעות מודלים אלה יחד עם הגן החולה זמין לציבור ערכות נתונים24,25, גילינו כי הגורם שעתוק פיוניר GATA2 הוא מאוד overexpressed ב גרורתי סירוס עמידים כימותרפיה-עמיד סרטן הערמונית תאים. GATA2 מגבירה את הישרדותם של תאים על ידי הפעלת ישירות קינאז במורד הזרם תלוי-IGF2 איתות ברשת29. ראוי לציין, מחקרים אלה עזר לזיהוי בתפקידי מפתח רומן של GATA2 סרטן הערמונית גרורתי מתקדם תוקפנות34.

ההתפתחות של עמידות לתרופות היא בעיה שאינה מוגבלת דוסטקסול סרטן הערמונית, כפי שהוא נפוץ בין סוגים רבים אחרים של סרטן שטופלו עם מגוון רחב של תרופות כימותרפיות. אכן, להחיל מגבלות דומות על הזמינות של גרסאות ניסיוניות, זה מתקבל על הדעת כי הפרוטוקול שלנו ניתן להתאים ללמוד סוגי סרטן אחרים ומנגנונים chemoresistance המתאימים שלהם.

הדור של תאים עמידים דוסטקסול כפי שמתואר פרוטוקול זה יכול לשמש ככלי פונקציונלי לזהות את הרומן הרלוונטיים מולקולרית, תאית מנגנונים של chemoresistance. פעולה זו פותחת את הדלת למציאת מטרות חדשות, שעליו לפיתוח טיפולים חדשים עבור סרטן הערמונית ממאיר מאוד עשוי לבטא, עוד פעם למתוח את הגבולות של מה אנחנו יודעים על המחלה הזו, איך אנחנו מתייחסים מטופליו.

Disclosures

המחברים מצהירים כי יש להם אינטרסים כלכליים אין מתחרים.

Acknowledgments

V.R.-בי מקבל מימון ממשרד הבריאות בארה ב & אדם שירותי, NIH, מכון הסרטן הלאומי מעניק מספר 1 K22 CA207458-01, ג'יי-די מקבל מימון בארה ב & אדם שירותי, NIH, מכון הסרטן הלאומי מעניק מספר 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).
דור של סרטן הערמונית תאים מודלים של ההתנגדות דוסטקסול סוכן אנטי mitotic
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).More

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter