Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Cancer Research

Geração de modelos de célula de câncer de próstata de resistência para o agente antimitótica Docetaxel

doi: 10.3791/56327 Published: September 8, 2017

Summary

Resistência às terapias de câncer contribui para a morte e a progressão da doença. Determinar as bases mecanicistas da resistência é crucial para melhorar a resposta terapêutica. Este detalhes de manuscrito o protocolo para gerar modelos metastizado resistente de células de câncer de próstata (PC) para ajudar a dissecar as vias envolvido na progressão para resistência de Docetaxel em pacientes de PC.

Abstract

Microtubule direcionamento MTAs (agentes) são dos pilares no tratamento de uma ampla variedade de tumores. No entanto, a resistência adquirida de quimioterápicos é um mecanismo comum de progressão da doença e uma característica determinante do prognóstico de tumores malignos. No cancro da próstata (PC), resistência à MTAs como o Docetaxel taxano dita insucesso do tratamento, bem como a progressão para estágios letais da doença que são definidos por um prognóstico pobre e altas taxas de mortalidade. Apesar de estudado durante décadas, a matriz de mecanismos que contribuem para a resistência adquirida não são completamente compreendidas e, portanto, representar uma limitação significativa para o desenvolvimento de novas estratégias terapêuticas que poderia beneficiar pacientes nestas fases de avançadas doença. Neste protocolo, descrevemos a geração de Docetaxel resistentes linhas de células de câncer de próstata que imitam características letais de câncer de próstata avançado e, portanto, pode ser usado para estudar os mecanismos pelos qual chemoresistance adquirida surge. Apesar de potenciais limitações intrínsecas a um modelo de célula com base, tais como a perda das propriedades de resistência ao longo do tempo, resistente ao Docetaxel linhas celulares produzidas por esse método tem sido utilizadas com sucesso em estudos recentes e oferecer a oportunidade de avançar nosso compreensão molecular da chemoresistance adquirida no câncer de próstata letal.

Introduction

Um aumento da taxa de proliferação, causada pela perda de controlo do ciclo celular é uma marca registrada de câncer1. Esta propriedade funcional processa células cancerosas exclusivamente dependente a fidelidade dos processos-chave do ciclo celular durante a S - e M-fases, que levou ao desenvolvimento de vários ciclo celular distorçer drogas que induzem o DNA danos ou defeitos mitóticos. Apesar de numerosos agentes antimitóticos, como inibidores de quinases mitóticas ou proteínas do motor, estão actualmente a ser desenvolvido e testado em ensaios clínicos, legado do microtubule direcionamento MTAs (agentes) continuam a ser a única abordagem clinicamente aprovada para direcionamento de mitose em câncer2,3,4. MTAs ou desestabilizam (vimblastina, vincristina, Vinorelbina) ou estabilizar microtúbulos (derivado de taxano agentes Paclitaxel, Docetaxel ou Cabazitaxel) e, assim, evitar a formação de um funcionamento fuso mitótico5,6. Esses agentes acionar o eixo conjunto posto7,8, que resulta em uma prolongada detenção mitótica e a morte eventual de célula em células cultivadas9,10 e defeitos mitóticos em tumores11 ,12 e são, portanto, útil para tratar uma grande variedade de cânceres, entre eles o câncer de próstata13.

Câncer de próstata é o mais frequentemente diagnosticado câncer e das principais causas de câncer relacionados a mortes em homens14. Agentes antimitóticos como Docetaxel melhorar a sobrevida do paciente com câncer de próstata e são dos pilares no tratamento desta doença15,16,17. Infelizmente, apesar do encolhimento do tumor inicial, as células do tumor frequentemente desenvolvem resistência aos medicamentos durante o tratamento. Vários mecanismos celulares têm sido implicados em causar o desenvolvimento de chemoresistance, incluindo desregulamentação de apoptotic e vias inflamatórias ou ativação/superexpressão de bombas de efluxo de drogas como o ATP-binding cassette transportador P-glicoproteína (P-gp/ABCB1), o último dos quais resulta na exportação de agentes quimioterápicos, fora as células18,19. Resistência à taxanos também tem sido associada com outras causas, tais como mudanças na expressão de tubulina isotipos ou mutações de tubulina, que impedem a interação entre a droga e seu alvo 20,21. Além disso, resistência tem sido relacionada com acúmulo de instabilidade do genoma e tumor heterogeneidade22,23. No entanto, os mecanismos que contribuem para a resistência de taxano não são completamente compreendidos, que manifesta-se pela ausência de estratégias terapêuticas que impedem a sua aparência. Portanto, há uma necessidade urgente para gerar modelos experimentais que auxiliam na dissecação desses mecanismos e identificar novas abordagens terapêuticas que impedem o desenvolvimento de resistência a estas drogas.

Neste artigo nós descrevemos um método que permite a geração de Docetaxel-resistente (DR) células cancerosas da próstata. Além disso, descreveremos como validar o status de resistência dessas células utilizando ensaios de formação de colônia e RT-PCR quantitativo. As células produzidas por esse método tem a vantagem de muitas das características moleculares encontradas em bancos de dados de amostra de tumor humano disponível publicamente com o benefício adicional de fornecer a versatilidade para executar uma grande variedade de ensaios experimentais sobre recapitulando longos períodos de tempo do que o permitido por amostras do tumor. Estes modelos de câncer de resistência de terapia podem ser expandidos por muitas semanas em cultura de tecidos e entre outras abordagens, pode ser geneticamente manipulados, visualizados por métodos de microscopia e analisados para expressão gênica. Além disso, eles podem ser xenotrasplanted em ratos para analisar mais efeitos no tumor de formação e crescimento em vivo. Atualmente, o principal método alternativo para estudar a resistência a medicamentos no contexto do câncer de próstata é a análise direta de amostras do tumor. Enquanto estas amostras apresentam um sistema muito potente para reunir informações sobre expressão gênica e status mutacional dos tumores determinados, acesso a eles pode ser muito limitado, e são difíceis de manter por mais manipulações e análise experimental, que pode ser feito facilmente com as linhas de célula geradas com este protocolo24,25. Importante, no futuro, alternativa abordagens tais como a geração de humanos organoids derivada diretamente de pacientes seria uma ferramenta muito poderosa e alternativa para o presente método26,27. Uma vez que eles serão recapitulate em um contexto 3D, um tumor que estava em seu ambiente original, organoids será o modelo perfeito entre linhagens celulares e tumores humanos. Ainda, os modelos de celular experimental descritos neste protocolo são ainda mais acessíveis para manter e apropriado para uma análise mais rápida. Os resultados obtidos através do estudo dessas linhas de células podem ser extrapolados para e corroborados em amostras humanas e culturas 3D. Portanto, este protocolo pode ser de interesse para os investigadores procuram modelos de celular estudar os mecanismos de chemoresistance em qualquer linha de celular, desde que nosso protocolo pode ser adaptado para o estudo de outros tipos de câncer e drogas. Os métodos descritos aqui são fáceis de aplicar em qualquer laboratório, acessível e permitir estudos preliminares dos mecanismos moleculares e celulares da resistência às drogas.

Protocol

1. determinação da concentração de Docetaxel, causando 50% diminuição na capacidade de formação de Colônia (IC50)

Nota: neste protocolo, concentração de Docetaxel IC50 foi avaliada usando a formação da colônia capacidade. Métodos alternativos usados para avaliar a viabilidade celular (i.e., ensaios MTS) podem ser usados com base na investigadores ' preferências.

  1. DU145 crescer ou 22Rv1 células em balão 2 75cm e preparar o estoque suficiente de 10mm Docetaxel diluído em DMSO para ser utilizado em experiências futuras.
  2. Para placa células para determinação de IC50 de Docetaxel, remova a mídia do recipiente, lavar cuidadosamente as células com 5 mL de PBS e incubar com 2ml 0.05% Trypsin-EDTA para 3-5 min a 37 ° C para separar as células da superfície do balão.
  3. Enxaguar as células trypsinized do frasco com 5 mL de mídia fresca e coletar a suspensão de células em um tubo de 15 mL. Células de pelotas por centrifugação (300 x g, 3 min, temperatura ambiente (RT)).
  4. Remover o sobrenadante e ressuspender as células em 5 mL de mídia fresca... contar as células. Diluir a suspensão de células para 2 a 2,5 x 10 5 células/mL para DU145 e 4-4,5 x 10 5 células/mL para 22Rv1, misture bem pipetando para cima e para baixo e 2 mL da suspensão em cada poço de duas placas de 6-poços de sementes.
  5. Após 24 h, quando as células encontram-se na confluência de 70-80%, adiciona concentrações de Docetaxel aumentando a dose de 1 nM, 2,5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM e 1000 nM para cada poço. Tratar o controle bem com DMSO em maior volume usado para Docetaxel ( Figura 2A).
  6. Depois de 72 h, aspirar a droga contendo mídia e adicionar 2 mL de mídia fresca. Dentro de aproximadamente 4-5 dias, as placas estarão prontas para a coloração.
  7. Para manchar as colônias, lave-os delicadamente com 2-3 mL de PBS e incube-os com 2-3 mL de solução de cristal violeta (0,1% p/v em formol a 10%) por dentro do capô de cultura de tecidos ou uma coifa de 20 min.
  8. Remover placas coloração de solução e lavagem com 2-3 mL de H 2 O, retire H 2 O e placas de secar ao ar.
  9. Analisar os resultados através da visualização dos poços para determinar qual deles tem a concentração de Docetaxel que diminui a viabilidade celular em 50% (IC50). Manualmente a contagem das colónias com a ajuda de uma caneta (para evitar a contagem das colônias mesmas duas vezes) e representam o percentual de viabilidade celular em um gráfico ( Figura 2A). Finalmente, tirar imagens digitais das placas para representação de figura (como mostrado na Figura 3A).

2. Geração de células de câncer de próstata resistente ao Docetaxel

Nota: realizar tratamentos de célula usando o mesmo estoque de solução de Docetaxel utilizado para determinação da concentração de fármaco IC50 (preparar estoque suficiente antecipadamente a experimental Use). Mantenha sempre um pequeno frasco de células da etapa anterior, no caso de algo não funciona bem. Células parentais devem ser cultivadas em paralelo em um pequeno frasco durante todo o processo e expostas ao veículo (DMSO) em volumes correspondentes imitando os montantes utilizados em balões o Docetaxel Tratado.

  1. Células DU145 placa ou 22Rv1 em frascos de 2 a 150 cm, contendo 20 mL de mídia (3.5 x 10 6 células por balão para DU145 e 6.5 * 10 6 células por balão para 22Rv1). Recomenda-se uso de balões de 10 a 20 de células ter células suficientes, ao final do protocolo.
  2. Após 24 h, quando as células estão em cerca de 70-80% confluência ( Figura 2B, antes Docetaxel), adicionar Docetaxel na concentração IC50 determinada na etapa 1 do protocolo (5 nM para as células descrito neste protocolo).
  3. Depois de 72 h, aspirar a droga contendo mídia e adicionar mídia fresca, livre de Docetaxel ( Figura 2B, 72 h após Docetaxel). Altere os meios de comunicação a cada 3-4 dias. Aproximadamente 1-2 semanas, clones resistentes aparecerão evidentes sob o microscópio ( Figura 2B, 7 e 14 dias depois de Docetaxel).
  4. Mídia, Aspire, lavar cuidadosamente as células com 15 mL de PBS e incubar com 4 mL 0,05% Trypsin-EDTA para 3-5 min a 37 ° C para separar as células da superfície do balão.
  5. Resuspend trypsinized células de frasco com 8 mL de mídia fresca. Células de piscina de todos os frascos de tratados. Células de pelotas por centrifugação (300 x g, 3 min, RT).
  6. Remover o sobrenadante e ressuspender as células em 20 mL de mídia fresca placa as células em frascos de 2 150 cm (3.5 x 10 6 células por balão para DU145 e 6.5 * 10 6 células por balão para 22Rv1).
  7. Após 24 h, quando as células estão em cerca de 70-80% confluência, adicione 5 nM Docetaxel (concentração inicial de IC50) novo.
  8. Repita as etapas de 2,3 para 2,6 no dia 3.
  9. Após 24 h, quando as células estão em cerca de 70-80% confluência, células de deleite com 2 X IC50 Docetaxel concentração (10 nM para as células descrito neste protocolo).
  10. Repetir passos 2.3 a 2.8, seguindo uma dose-escalonamento das concentrações de Docetaxel (25 nM, 50 nM, 100 nM e 250 nM), para gerar uma população estável de células crescendo em seus balões sob a mais alta concentração final. Para concentrações mais elevadas, o protocolo de escalonamento de dose pode ser implementado por até 6 meses até que a concentração de 1.000 nM é alcançado ( figura 1A).

3. Funcionais caracterização de adquiriu Docetaxel resistência por ensaio de formação de colônia

Nota: neste protocolo, chemoresistance foi avaliada utilizando ensaios de formação de colônia. Métodos alternativos usados para avaliar a viabilidade celular (i.e., ensaios MTS) podem ser usados com base na investigadores ' preferências.

  1. Placa 2.000 células (DU145 ou 22Rv1, parental e Docetaxel-resistente) por bem em placas de 6-poços, usando 2 mL de mídia por alvéolo.
  2. Após 24 h, adicionar o aumento das concentrações de Docetaxel (células parentais: 0.25, 0.5, 1, 2,5 e 5 nM; Células de DR: 50, 125, 250, 500 e 1.000 nM). Para tanto, DU145 e 22Rv1 linhas de célula. Adicionar o DMSO somente para um bem como um controle no mesmo volume utilizado para a dose mais elevada de Docetaxel.
  3. Após 72 h, aspirar a droga contendo mídia e adicionar mídia fresca livre de Docetaxel.
  4. Incubar as placas durante 1-2 semanas até que colônias são visíveis sob o microscópio.
  5. Para manchar as colônias, lave-os delicadamente com 2-3 mL de PBS e incube-os com 2-3 mL de solução de cristal violeta (0,1% p/v em formol a 10%) por dentro do capô de cultura de tecidos ou uma coifa de 20 min.
  6. Remover placas coloração de solução e lavagem com 2-3 mL de H 2 O, retire H 2 O e placas de secar ao ar.
  7. Analisar resultado visualizando os poços e manualmente, contando as colónias com a ajuda de uma caneta (para evitar a contagem das colônias mesmas duas vezes) e representam o percentual de viabilidade celular em um gráfico. Levar imagens digitais das placas para representação de figura ( Figura 3A).

4. Fenotípica caracterização de Docetaxel resistência adquirida fenótipo através de análise de qRT-PCR

Nota: células Docetaxel-resistente (DR) apresentam um perfil de expressão diferente em comparação com suas linhas de célula parental 28 , 29. portanto, o sucesso da seleção pode ser verificado por qRT-PCR utilizando primers para marcadores específicos (para sequências da primeira demão, consulte a seção materiais; para obter detalhes, consulte a seção de resultados). Isso deve ser feito após cada rodada de seleção começam após a terceira rodada. Alternativamente, também é possível a avaliação do fenótipo resistente ao Docetaxel pela mancha ocidental.

  1. Extrair RNA das células parentais e Docetaxel resistente usando um kit de extração de RNA e a seguir o fabricante ' instruções de s (veja a Tabela de materiais e reagentes para detalhes). Usando um mínimo de 1-2 x 10 6 células recomenda-se.
  2. Quantify RNA em 260 nm a absorvência, usando um espectrofotômetro. Para melhor pureza, os rácios de absorvância nm nm/280 260 devem estar perto de 2.0.
  3. PerfoRM reverso transcrição para obter DNA complementar (cDNA) usando o kit de transcrição reversa e seguindo o fabricante ' instruções de s (consulte a Tabela de materiais e reagentes para detalhes), usando 1 µ g de RNA em um 20 µ l mistura de reação (se é necessário uma maior quantidade de cDNA, ampliar o mix de reação conformemente).
  4. Preparar a reação de qPCR em triplicado para cada gene de interesse, como segue:
    - 2 µ l de primer para a frente de 10 µM
    - 2 µ l de primer reverso de 10 µM
    - 10 mistura de mestre SYBR Green PCR µ l
    - 5 µ l H 2 O
    -1 µ l de o cDNA recém preparado da etapa 4.3.
    Nota: Consulte a Tabela de materiais para as sequências dos primers utilizados neste protocolo.
  5. Definir o programa PCR como segue:
    - 95 ° C por 15 min
    - 94 ° C por 30 s |
    -56 ° C durante 40 s | 40 vezes
    - 72 ° C por 30 s |
  6. Para analisar resultados de qPCR e determinar alterações na expressão gênica entre parentais e DR amostras, os valores de limiar (Ct) de ciclo para cada gene de interesse são determinados em triplicado e a média normalizada para o controle de carregamento (média três vias de actina ) para DR (Ct DR) e células parentais (parental do Ct). Valores das células parentais são normalizados para 1. ΔCt (DR - Ct, Ct parental) é determinado a obter mRNA final prega mudanças e representado em um gráfico. Um aumento de > 2 ou uma diminuição de < 0,5 são considerados significativos e uma boa validação do estabelecimento do Docetaxel adquiriu o fenótipo resistente ( Figura 3B).

Representative Results

Este protocolo vai levar à geração de células de câncer de próstata resistente a Docetaxel (DR). O cronograma para conclusão pode variar de 4 a 7 meses como resumidos na representação esquemática das etapas protocolo na figura 1A e figura 1B. O investimento de tempo pode diferir dependendo da linhagem celular de escolha e a gama de concentrações de droga usado conforme descrito no protocolo. Importante, a determinação da concentração de Docetaxel IC50 para cada linha de celular permite o desenho da droga aumentando o intervalo de concentração para uso no protocolo para as células de escolha (Figura 2A). Uma vez que o protocolo é iniciado, os efeitos iniciais Docetaxel em células DU145 e 22Rv1 podem ser observados em pontos diferentes do tempo sob o microscópio para monitorar se o protocolo está funcionando corretamente. Sugeriu que os pontos de tempo para monitorar o processo de tratamento de Docetaxel são: antes da exposição ao Docetaxel (linha de base), após a exposição de Docetaxel para 72 h, dias 7 e 14 dias. Observe que apenas uma minoria de células tumorais sobreviver à exposição de Docetaxel e gerar clones, que podem ser observadas ao microscópio (Figura 2B).

Ensaios de formação de colônia representativa e gráficos de quantificação de parental e as células recém-gerado Docetaxel-resistente (DR) são mostradas na Figura 3A. Observe que as células resistentes ao Docetaxel geradas podem sobreviver as concentrações de drogas até 1,000-fold mais elevadas do que as células parentais.

Finalmente, o fenótipo resistente ao Docetaxel pode ser validado por qRT-PCR (Figura 3B). Observe que células resistentes ao Docetaxel, em comparação com as células parentais, exibem regulação característica de ABCB1 e GATA2 e para baixo-regulamento de CK19 e CDH1. Estes genes foram selecionados para validação porque temos já experimentalmente demonstrado no nosso trabalho anteriormente publicado GATA2 upregulation e downregulation de CK19 juntamente com CDH1 em ambos de28,de modelos de célula DR29. O gene ABCB1 também foi selecionado como um gene descontínuas que tem sido mostrado por outros para ser consistentemente upregulated em células resistentes aos medicamentos18,19. No entanto, é importante notar que outros genes podem ser escolhidos de acordo com a literatura e dependendo dos modelos de célula e as drogas escolhidas para a geração de células resistentes pelo pesquisador.

Figure 1
Figura 1: linha do tempo para a geração de modelos de célula de câncer de próstata resistente ao Docetaxel. (A) diagrama representativo do protocolo cronograma para geração de modelos de célula Docetaxel-resistente. Ilustração retrata o tratamento Docetaxel, etapas de validação e tempo necessário para cada parte. (B) representação esquemática das etapas de validação do protocolo incluindo ensaios de formação de colônia funcional das células parentais e Docetaxel-resistente, tratados com as concentrações de Docetaxel indicadas para 72 h (em vermelho), representante gráfico da percentagem de colônia e qRT-PCR para validação fenotípica. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: geração de sistemas de modelo de células de câncer de próstata resistente ao Docetaxel. (A) diagrama representando a determinação do Docetaxel IC50 nas linhas de células de câncer de próstata parental DU145 e 22Rv1 (etapa 1 do protocolo). Esperado percentagens de viabilidade celular e o Docetaxel concentrações crescentes de dose necessária estão incluídas. Gráficos de viabilidade indicando 5 de células DU145 representante e 22Rv1 nM como o IC50 após 72 h de exposição Docetaxel são incluídos. Os experimentos são triplica e dados representam as imagens de microscopia de campo claro representante SD. (B) média ± de DU145 e células de 22Rv1 no indicaram vezes durante a geração da resistência Docetaxel (etapa 2 do protocolo). Setas vermelhas indicam um clone Docetaxel resistente após a conclusão do protocolo. Barras de escala = 50 nm. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Caracterização fenotípica e funcional dos modelos de célula resistente ao Docetaxel. (A) ensaios de formação de representante da colônia de células parentais e Docetaxel-resistente, tratados com as concentrações de Docetaxel indicadas por 72 h. percentagem de colônias para cada concentração de tratamento é representada no gráfico incluído. Os experimentos são triplica e dados representam a média ± SD. escala barras = 5 mm. (B) DR/parental mRNA dobra aumento relativo quantificada por qRT-PCR de ABCB1, GATA2, CK19 e CDH1 são mostrados. Todos os dados brutos de qPCR é normalizado de actina (Veja o protocolo para obter detalhes). Os experimentos são triplica e dados representam a média ± DP. * p < 0,05. Clique aqui para ver uma versão maior desta figura.

Discussion

Este manuscrito, descrevemos um método para gerar sistemas de modelo de células de câncer de próstata resistente ao Docetaxel que permite o estudo dos mecanismos que contribuem para a aquisição do fenótipo chemoresistance. Enquanto essa abordagem é altamente confiáveis e reprodutíveis, devem ser consideradas algumas limitações potenciais. Desde que somente uma pequena fração da população em massa de células irá expor chemoresistance28, recomenda-se começar com uma grande população de células (nós geralmente chapear 20 frascos de 150 cm2, que representam aproximadamente 1,2 x 108 células). Etapas-chave do protocolo devem ser consideradas para garantir o sucesso do procedimento. Em primeiro lugar, é muito importante usar o mesmo Docetaxel preparadas ações para uso de longo prazo (estoque de 10mm alíquotas podem ser usadas por anos quando armazenado adequadamente na-80 ° C). Pequenas mudanças na alíquota do Docetaxel podem afetar os resultados de IC50, geração de sincronismo de linha da célula e os resultados de formação de colônia. Em segundo lugar, é fundamental iniciar o protocolo determinando o IC50 em cada linha da célula individual, desde que as variações podem ocorrer ao usar um novo lote de células. Em terceiro lugar, é essencial para monitorar o que o tratamento medicamentoso é eficaz, verificando as células sob o microscópio frequentemente para que quaisquer erros podem ser detectados rapidamente e corrigidos. Finalmente, recomendamos sempre manter um estoque de etapas intermediárias em caso de contaminação ou problemas inesperados que poderiam afetar a viabilidade das células no meio do protocolo. Importante, o nosso protocolo visa gerar modelos de resistência aos medicamentos, expondo as células de câncer de próstata a altas doses de Docetaxel para 72 h seguido por períodos de tempo de recuperação, em vez de concentrações constantes da droga na tentativa de imitar o melhor clínico cenário relatado para tratamento de câncer de próstata com este agente de taxano15,16.

Além disso, note-se que as células resistentes apresentam uma alta plasticidade, o que pode levar a uma perda progressiva das propriedades de resistência adquirida ao longo do tempo. Portanto, estendendo o uso dessas células para mais de 2-3 meses em cultura não é recomendado. Se uma fonte permanente é necessário é aconselhável gerar continuamente novos lotes de células resistentes. No entanto, se os lotes de células têm sido cultivadas por um tempo prolongado, ensaios de formação de colônia e qPCR podem ser usados para reavaliar sua resistência. Outra alternativa é aumentar a resistência minguante, tratando as células com uma alta dose de Docetaxel para 72 h (500-1.000 nM). Após um período de recuperação de uma a duas semanas, o fenótipo pode ser re-testado por qPCR e colônia formação ensaios. Também é possível, embora não seja recomendado, para armazenar as alíquotas de células tratadas em nitrogênio líquido (em FBS, 10% DMSO). Por favor, note que depois de um ciclo de congelamento e descongelamento, o fenótipo chemoresistance deve sempre ser reavaliado com os métodos acima mencionados.

Apesar dessas limitações, nós28,29 e outros30,31,32,33 foram capazes de empregar com êxito esses sistemas modelo para identificar a chave romance celular e mecanismos moleculares, levando a elevados tumor-iniciando capacidade de sobrevivência da célula e agressividade nas células resistentes ao Docetaxel. Usando estes sistemas de modelo de células de câncer, descobrimos que as células exibem um fenótipo indiferenciado, caracterizado pela ausência de marcadores de diferenciação epitelial e relacionadas com a próstata e a superexpressão de targetable do desenvolvimento (entalhe e Vias de sinalização Hedgehog), sobreviver exposição quimioterápicos28. Em um segundo estudo, usando estes modelos juntamente com os conjuntos de dados de gene paciente publicamente disponível24,25, descobrimos que o fator de transcrição pioneiro GATA2 é altamente overexpressed em metastático resistente a castração células de câncer de próstata resistente a quimioterapia. GATA2 aumenta a sobrevivência das células, ativando diretamente uma quinase a jusante IGF2 dependente sinalização rede29. Notadamente, estes estudos ajudados a identificar novos papéis-chave de GATA2 no câncer de próstata metastático avançado agressividade34.

O desenvolvimento de resistência às drogas é um problema que não está limitado a Docetaxel e câncer de próstata, como é comum entre muitos outros tipos de cancros tratados com uma grande variedade de medicamentos quimioterápicos. Com efeito, aplicam restrições semelhantes sobre a disponibilidade de modelos experimentais, e é concebível que nosso protocolo pode ser adaptado para estudar outros tipos de câncer e seus mecanismos de chemoresistance respectivos.

A geração de células resistentes ao Docetaxel, conforme descrito no presente protocolo pode ser usada como uma ferramenta funcional para identificar mecanismos moleculares e celulares relevantes romance de chemoresistance. Isso abre a porta para encontrar novos destinos, sobre a qual o desenvolvimento de novos tratamentos para câncer de próstata altamente maligno pode articular, mais uma vez empurrando as fronteiras do que sabemos sobre essa doença e como tratar seus pacientes.

Disclosures

Os autores declaram que eles têm não tem interesses financeiro concorrente.

Acknowledgments

V.R.-B. recebe financiamento do departamento E.U. de saúde & humanos serviços, NIH, National Cancer Institute conceder número 1 K22 CA207458-01 e J.D.-D. recebe financiamento do departamento E.U. de saúde & humanos serviços, NIH, National Cancer Institute conceder número 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).
Geração de modelos de célula de câncer de próstata de resistência para o agente antimitótica Docetaxel
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).More

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter