Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Cancer Research

Generación de modelos de celulares de cáncer de próstata de la resistencia a lo agente anti-mitotic Docetaxel

doi: 10.3791/56327 Published: September 8, 2017

Summary

Resistencia a las terapias de cáncer contribuye a la muerte y la progresión de la enfermedad. Determinar los fundamentos mecanicistas de la resistencia es fundamental para mejorar la respuesta terapéutica. Datos de este manuscrito el protocolo para generar modelos resistentes a taxanos de la célula del cáncer de próstata (PC) para ayudar a la disección de las vías implicado en la progresión a la resistencia de Docetaxel en pacientes de PC.

Abstract

Agentes dirigidos a microtúbulos (ATM) son un pilar en el tratamiento de una amplia gama de tumores. Sin embargo, la resistencia adquirida a los fármacos quimioterapéuticos es un mecanismo común de progresión de la enfermedad y una característica determinante de pronóstico de los tumores malignos. El cáncer de próstata (PC), resistencia a ATM como el taxano Docetaxel dicta el fracaso del tratamiento como la progresión hacia etapas letales de la enfermedad que se definen por un mal pronóstico y alta mortalidad. Aunque estudiado por décadas, el conjunto de mecanismos que contribuyen a la resistencia adquirida no se entienden completamente y por lo tanto representan una limitación importante para el desarrollo de nuevas estrategias terapéuticas que podrían beneficiar a los pacientes en estos estadios de avanzados de la enfermedad. En este protocolo, se describe la generación de resistentes a Docetaxel líneas celulares de cáncer de próstata que imitar características de letales etapa avanzada del cáncer de próstata y por lo tanto puede utilizarse para estudiar los mecanismos por los cual quimiorresistencia adquirida se presenta. A pesar de posibles limitaciones intrínsecas a un modelo basado en la célula, como la pérdida de propiedades de resistencia con el tiempo, las líneas celulares resistentes a Docetaxel producidas por este método se han utilizado con éxito en estudios recientes y ofrecen la oportunidad para avanzar en nuestra comprensión molecular de quimiorresistencia adquirida en el letal cáncer de próstata.

Introduction

Una mayor tasa de proliferación causada por la pérdida de control del ciclo celular es un sello distintivo del cáncer1. Esta propiedad funcional hace que las células cancerosas depende únicamente de la fidelidad de los procesos clave del ciclo celular durante S-M-fases y, que ha llevado al desarrollo de varios ciclo celular perturbando la drogas que inducen daño en el ADN o defectos de mitóticos. Aunque numerosos agentes anti-mitotic, como inhibidores de quinasas mitóticas o proteínas motoras, están actualmente siendo desarrollado y probado en ensayos clínicos, los agentes dirigidos a microtúbulos legado (MTAs) continúan siendo el único enfoque clínico aprobado para objetivos de mitosis en cáncer2,3,4. MTA de desestabilizan (vinblastina, vincristina, vinorelbina) o estabilizan microtúbulos (derivados del taxano agentes Paclitaxel, Docetaxel o Cabazitaxel) y evitan la formación de un huso mitótico funcionamiento5,6. Estos agentes activan el eje Asamblea checkpoint7,8, que se traduce en una prolongada detención mitótica y la muerte eventual de la célula en células cultivadas9,10 y defectos mitóticos en tumores11 ,12 y son por tanto útiles para tratar una gran variedad de cánceres, entre ellos el cáncer de próstata13.

Lo más frecuentemente se diagnostica el cáncer de próstata cáncer y una causa principal de cáncer relacionados con las muertes en hombres14. Los agentes antimitótica como Docetaxel mejoran la supervivencia del paciente de cáncer de próstata y son un pilar fundamental en el tratamiento de esta enfermedad15,16,17. Desafortunadamente, a pesar de la contracción del tumor inicial, las células del tumor a menudo desarrollan resistencia a los medicamentos durante el tratamiento. Varios mecanismos celulares han sido implicados en causar el desarrollo de quimiorresistencia, incluyendo desregulación de apoptosis y vías inflamatorias o la activación/sobreexpresión de bombas de eflujo de drogas como el ATP-binding cassette transporter P-glicoproteína (P-gp/ABCB1), que se traduce en la exportación de agentes quimioterápicos de las células18,19. Resistencia a taxanos también se ha relacionado con otras causas, tales como cambios en la expresión de tubulina isotipos o mutaciones de la tubulina, que impiden la interacción entre el fármaco y su Diana 20,21. Además, se ha relacionado la resistencia a la acumulación de inestabilidad del genoma y tumor heterogeneidad22,23. Sin embargo, los mecanismos que contribuyen a la resistencia a taxanos no se entienden completamente, que es evidente por la ausencia de estrategias terapéuticas que previenen su aparición. Por lo tanto, es urgente generar modelos experimentales que ayudan en la disección de estos mecanismos y a identificar nuevos enfoques terapéuticos que impiden el desarrollo de la resistencia a estos fármacos.

En este artículo se describe un método que permite la generación de resistentes a Docetaxel (DR) las células de cáncer de próstata. Además describiremos cómo validar el estado de resistencia de estas células mediante ensayos de formación de Colonia y RT-PCR cuantitativa. Las células producidas por este método tienen la ventaja de muchas de las características moleculares encontradas en bases de datos de muestra tumor humano disponible para el público con el beneficio añadido de proporcionar la versatilidad para llevar a cabo una amplia variedad de ensayos experimentales sobre Recapitulando períodos más largos de tiempo que el permitido por las muestras de tumor. Estos modelos de resistencia de la terapia de cáncer pueden ampliados durante muchas semanas en cultivo de tejidos y entre otros enfoques, pueden ser genéticamente manipulados, visualizados por métodos de microscopía y análisis de expresión génica. Además, pueden ser xenotrasplanted en ratones para analizar los efectos en la formación y crecimiento de tumor in vivo. Actualmente, el principal método alternativo para el estudio de resistencia a los medicamentos en el contexto del cáncer de próstata es el análisis directo de muestras tumorales. Mientras que estas muestras presentan un sistema muy potente para recoger información sobre la expresión génica y el estado mutacional de los tumores dados, el acceso a ellos puede ser muy limitado y son difíciles de mantener para más manipulaciones y análisis experimental, que puede hacerse fácilmente con las líneas celulares generadas con este protocolo24,25. Lo importante, en el futuro, enfoques alternativos, como la generación de humanos organoides derivados directamente de pacientes sería una herramienta muy poderosa y alternativa al actual método26,27. Que se recapitulan en un contexto 3D qué tumor fue en su ambiente original, organitas será el modelo perfecto entre líneas celulares y los tumores humanos. Sin embargo, los modelos de celular experimental descritos en el presente Protocolo son todavía más asequible para mantener y de análisis más rápidos. Los resultados obtenidos mediante el estudio de estas líneas celulares pueden extrapolarse a y corroborados en muestras humanas y culturas 3D. Por lo tanto, este protocolo puede ser de interés para los investigadores que buscan modelos de célula estudiar mecanismos de quimiorresistencia en cualquier línea celular, ya que nuestro protocolo puede ser adaptado para el estudio de otras drogas y tipos de cáncer. Los métodos descritos aquí son fáciles de aplicar en cualquier laboratorio, asequible y dejar los estudios preliminares de los mecanismos moleculares y celulares de resistencia a los medicamentos.

Protocol

1. determinación de la concentración de Docetaxel que causa 50% disminución de la capacidad de formación de Colonia (IC50)

Nota: en el presente Protocolo, Docetaxel IC50 concentración ha sido evaluado mediante la formación de la Colonia capacidad. Pueden utilizarse métodos alternativos utilizados para evaluar la viabilidad de las células (es decir, ensayos MTS) basado en los investigadores ' preferencias.

  1. Crecer DU145 o 22Rv1 células en un frasco de 75 cm 2 y preparar suficiente población diluido en DMSO para ser utilizado en futuros experimentos de Docetaxel de 10 mm.
  2. Placa de células para la determinación de CL50 de Docetaxel, eliminar los medios de comunicación del frasco, lavar cuidadosamente las células con 5 mL de PBS e incubar con 2 mL 0.05% tripsina-EDTA durante 3-5 min a 37 ° C para separar las células de la superficie del frasco.
  3. Enjuague tripsinizaron células del frasco con 5 mL de medio fresco y recoger la suspensión de células en un tubo de 15 mL. Pellet de células por centrifugación (300 x g, 3 minutos, temperatura (RT)).
  4. Eliminar el sobrenadante, Resuspender el precipitado de células en 5 mL de medio fresco y contar las células. Diluir la suspensión celular a 2-2.5 x 10 5 células/mL de DU145 y 4-4.5 x 10 5 células/mL de 22Rv1, mezclar bien mediante pipeteo arriba y abajo y 2 mL de la suspensión en cada pozo de dos placas de 6 pocillos de semillas.
  5. Después de 24 h, cuando las células están en 70-80% de confluencia, añade concentraciones crecientes dosis de Docetaxel de 1 nM, 2.5 nM, 5 nM, 10 nM 25 nM, 50 nM, 100 nM, 250 nM, 500 nM y 1000 nM para cada pocillo. Tratar el control con DMSO en el volumen más alto utilizado para Docetaxel ( figura 2A).
  6. Después de 72 h, Aspire drogas que contienen los medios de comunicación y añadir 2 mL de medio fresco. Dentro de aproximadamente 4-5 días, las placas estará listas para la tinción de.
  7. Para las colonias de la mancha, lavar con 2-3 mL de PBS e incubar con solución de cristal violeta 2-3 mL (0,1% p/v en formalina al 10%) durante 20 minutos dentro de la campana de cultivo de tejidos o una campana de humos.
  8. Saque tinción solución y lavar con 2-3 mL de H 2 O, quitar H 2 O y seque las placas de.
  9. Analizar los resultados, visualizando los pozos para determinar cuál tiene la concentración de Docetaxel que disminuye la viabilidad celular en un 50% (IC50). Contar las colonias con la ayuda de un rotulador (para evitar contar dos veces las mismas colonias) y representan el porcentaje de viabilidad celular en un gráfico ( figura 2A) manualmente. Por último, tomar imágenes digitales de las placas para la representación de la figura (como se muestra en la Figura 3A).

2. Generación de células de cáncer de próstata resistente al Docetaxel

Nota: realizar tratamientos con células con el mismo stock de solución Docetaxel utilizado para la determinación de la concentración de la droga de IC50 (preparar suficiente stock para experimental uso). Siempre mantenga un frasco pequeño de las células del paso anterior, en caso de que algo no funciona bien. Las células de los padres deben ser crecidas en paralelo en un matraz pequeño a lo largo de todo el procedimiento y expuestas al vehículo (DMSO) en los volúmenes correspondientes mímico las cantidades utilizadas en los frascos tratado Docetaxel.

  1. Células DU145 placa o 22Rv1 en frascos de 2 150 cm que contiene 20 mL de medios de comunicación (3.5 x 10 6 células cada frasco de DU145 y 6.5 * 10 6 cada frasco para 22Rv1). Se recomienda utilizar de 10 a 20 frascos de células para tener suficientes células en el final del protocolo.
  2. Después de 24 h, cuando las células están en alrededor del 70-80% confluencia ( figura 2B, antes Docetaxel), añadir Docetaxel en la concentración de IC50 determinada en el paso 1 del Protocolo (5 nM para las células descritas en el presente Protocolo).
  3. Después de 72 h, Aspire drogas que contienen los medios de comunicación y añadir medio fresco, libre de Docetaxel ( figura 2B, 72 h después de Docetaxel). Cambiar el medio cada 3-4 días. Dentro de aproximadamente 1-2 semanas, clones resistentes aparece evidentes bajo el microscopio ( figura 2B, 7 y 14 días después de Docetaxel).
  4. Aspirar los medios, lavar cuidadosamente las células con 15 mL PBS e incubar 4 mL 0.05% tripsina-EDTA durante 3-5 min a 37 ° C para separar las células de la superficie del frasco.
  5. Resuspender células tripsinizaron del frasco con 8 mL de medio fresco. Las células de todos los matraces tratadas de la piscina. Pellet de células por centrifugación (300 x g, 3 min, RT).
  6. Eliminar el sobrenadante, Resuspender el precipitado de células en 20 mL de medio fresco y placa de las células en 2 frascos de 150 cm (3.5 x 10 6 células cada frasco de DU145 y 6.5 * 10 6 cada frasco para 22Rv1).
  7. Después de 24 h, cuando las células están en alrededor del 70-80% confluencia, añadir 5 nM Docetaxel (concentración inicial de IC50) otra vez.
  8. Repetir los pasos 2.3 a 2.6 en el día 3.
  9. Después de 24 h, cuando las células están en alrededor del 70-80% confluencia, tratar las células con concentración de Docetaxel de IC50 de X 2 (10 nM para las células descritas en el presente Protocolo).
  10. Repetir los pasos 2.3 a 2.8, después de una escalada de dosis de Docetaxel concentraciones (25 nM, 50 nM, 100 nM y 250 nM), para generar una población estable de células creciendo en sus frascos en la concentración más alta final. Para concentraciones más altas, se puede implementar el protocolo de dosis escalada hasta por 6 meses hasta alcanzar la concentración de 1.000 nM ( figura 1A).

3. Funcional caracterización de adquirido Docetaxel resistencia por formación de Colonia ensayo

Nota: en el presente Protocolo, quimiorresistencia se ha evaluado mediante ensayos de formación de Colonia. Pueden utilizarse métodos alternativos utilizados para evaluar la viabilidad de las células (es decir, ensayos MTS) basado en los investigadores ' preferencias.

  1. Placa 2.000 células (DU145 o 22Rv1, los padres y resistentes a Docetaxel) por pozo en placas de 6 pozos, usando 2 mL de medio por pozo.
  2. Después de 24 h, agregar cada vez mayor concentración de Docetaxel (células parentales: 0.25, 0.5, 1, 2.5 y 5 nM; Células de DR: 50, 125, 250, 500 y 1.000 nM). Para las líneas de células DU145 y 22Rv1. Agregar DMSO solamente a un bien como un control en el mismo volumen utilizado para la mayor dosis de Docetaxel.
  3. Después de 72 h, aspirar droga que contienen los medios de comunicación y añadir fresco libre de Docetaxel con los medios de comunicación.
  4. Incubar las placas durante 1-2 semanas hasta que las colonias son visibles bajo el microscopio.
  5. Para las colonias de la mancha, lavar con 2-3 mL de PBS e incubar con solución de cristal violeta 2-3 mL (0,1% p/v en formalina al 10%) durante 20 minutos dentro de la campana de cultivo de tejidos o una campana de humos.
  6. Saque tinción solución y lavar con 2-3 mL de H 2 O, quitar H 2 O y seque las placas de.
  7. Analizar resultado visualizando los pozos y contando manualmente las colonias con la ayuda de un rotulador (para evitar contar dos veces las mismas colonias) y representan el porcentaje de viabilidad celular en un gráfico. Tomar imágenes digitales de las placas para la representación de la figura ( Figura 3A).

4. Fenotípica caracterización de Docetaxel resistencia adquirida fenotipo mediante qRT-PCR Análisis

Nota: las células resistentes a Docetaxel (DR) exhiben un perfil de expresión diferente en comparación con las líneas de la célula parental 28 , 29. por lo tanto, el éxito de la selección puede ser verificado por qRT-PCR usando las cartillas para los marcadores específicos (secuencias de la cartilla, consulte la sección materiales; para más detalles, consulte la sección de resultados). Esto debe hacerse después de cada ronda de selección a partir después de la tercera ronda. Por otra parte, también es posible evaluación del fenotipo resistente al Docetaxel por borrar occidental.

  1. Extraer ARN de células parentales y resistentes a Docetaxel con un kit de extracción de RNA y el fabricante ' instrucciones de s (véase la Tabla de materiales y reactivos para más detalles). Se recomienda el uso de un mínimo de 1-2 x 10 6 células.
  2. Cuantificar RNA en 260 absorbancia de nm, usando un espectrofotómetro. De la mejor pureza, las proporciones de absorbancia 260/280 nm nm deben estar cerca de 2.0.
  3. Perfotranscripción para obtener el ADN complementario (ADNc) con el kit de transcripción inversa y el fabricante de reversa RM ' instrucciones (ver la Tabla de materiales y reactivos para los detalles), con 1 μg de RNA en 20 μl mezcla de reacción (si es necesario una mayor cantidad de cDNA, ampliar la mezcla de reacción en consecuencia).
  4. Preparar la reacción de qPCR por triplicado para cada gen de interés como sigue:
    - 2 μl de cebador forward de 10 μm
    - 2 μl de cebador inverso de 10 μm
    - 10 μl mezclar maestro de SYBR Green PCR
    - 5 μl de H 2 O
    -1 μl de el cDNA recién preparado en el paso 4.3.
    Nota: Ver Tabla de materias para las secuencias de los primers utilizados en el presente Protocolo.
  5. Establecidas en el programa PCR:
    - 95 ° C durante 15 min
    - 94 ° C por 30 s |
    -56 ° C durante 40 s | 40 veces
    - 72 ° C por 30 s |
  6. Para analizar resultados de qPCR y determinar los cambios en la expresión génica entre los padres y DR las muestras, los valores del ciclo umbral (Ct) para cada gen de interés se determinan por triplicado y el promedio normalizado para el control de carga (promedio triplicado de actina ) para DR (Ct DR) y células parentales (parental del Ct). Valores de las celdas de los padres se normalizan a 1. ΔCt (DR Ct - Ct parental) se obtener mRNA final veces cambios y representada en un gráfico. Un aumento de > 2 o una disminución de < 0,5 se consideran significativos y una buena validación del establecimiento del Docetaxel adquirido fenotipo resistente ( figura 3B).

Representative Results

Presente Protocolo dará lugar a la generación de las células de cáncer de próstata resistentes a Docetaxel (DR). El plazo de ejecución puede variar de 4 a 7 meses como resumido en la representación esquemática de los pasos de protocolo en la figura 1A y figura 1B. La inversión de tiempo podría variar según la línea celular de preferencia y el rango de concentraciones de la droga utilizada como se describe en el protocolo. Lo importante es la determinación de la concentración de Docetaxel IC50 para cada línea celular permite el diseño de la droga creciente rango de concentración a utilizar en el protocolo para las células de elección (figura 2A). Una vez iniciado el protocolo, se observan efectos iniciales del Docetaxel en células DU145 y 22Rv1 en diferentes puntos temporales bajo el microscopio para controlar si el protocolo está funcionando correctamente. Sugieren los siguientes puntos del tiempo para controlar el proceso de tratamiento de Docetaxel: antes de la exposición de Docetaxel (línea de base), después de la exposición de Docetaxel por 72 h, 7 días y 14 días. Tenga en cuenta que sólo una minoría de las células tumorales sobreviven a la exposición de Docetaxel y generar clones, que pueden ser observados bajo el microscopio (figura 2B).

Ensayos de formación de colonias representativas y gráficos de la cuantificación de los padres y el recién generadas células resistentes a Docetaxel (DR) se muestran en la Figura 3A. Tenga en cuenta que las células resistentes a Docetaxel generadas pueden sobrevivir a concentraciones de la droga hasta 1,000-fold superiores de las células parentales.

Finalmente, el fenotipo resistente al Docetaxel puede validarse por qRT-PCR (figura 3B). Tenga en cuenta que las células resistentes a Docetaxel, comparadas con las células de los padres, Mostrar la característica para arriba-regulación de ABCB1 y GATA2 y abajo-regulación de CK19 y CDH1. Estos genes fueron seleccionados para la validación porque ya experimentalmente hemos demostrado en nuestro trabajo previamente publicado upregulation de GATA2 y downregulation de CK19 junto con CDH1 en ambos DR celular modelos28,29. El gen ABCB1 también fue seleccionado como un gen básico que ha sido demostrado por otros constantemente ser upregulated en las células resistentes a drogas18,19. Sin embargo, es importante tener en cuenta que otros genes pueden ser elegidos según la literatura y en función de los modelos de la célula y los fármacos elegidos para la generación de células resistentes por el investigador.

Figure 1
Figura 1: línea de tiempo para la generación de modelos de celulares de cáncer de próstata resistente al Docetaxel. (A) diagrama representativo de la línea de tiempo del protocolo para la generación de modelos de celulares resistentes a Docetaxel. Ilustración muestra el tratamiento de Docetaxel, pasos de validación y tiempo necesario para cada parte. (B) representación esquemática de los pasos de validación del protocolo incluyendo ensayos de formación de Colonia funcional de las células parentales y Docetaxel-resistente tratados con las concentraciones indicadas de Docetaxel por 72 h (en rojo), representante gráfico de porcentaje de Colonia y qRT-PCR para la validación de fenotípica. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: generación de sistemas de modelo de células de cáncer de próstata resistente al Docetaxel. (A) diagrama que representa la determinación de la Docetaxel IC50 en las líneas celulares de cáncer de próstata los padres DU145 y 22Rv1 (paso 1 del Protocolo). Se incluyen los porcentajes esperados de viabilidad celular y el Docetaxel dosis en aumento de las concentraciones necesitan. Representante de DU145 y 22Rv1 celular gráficos de viabilidad que indica 5 nM como la IC50 después de 72 h de exposición de Docetaxel se incluyen. Los experimentos son triplicados y datos representan las imágenes de microscopía de campo brillante representante de media ± SD. (B) de DU145 y células 22Rv1 en indicaron durante la generación de resistencia de Docetaxel (paso 2 del Protocolo). Flechas rojas indican un clon resistente al Docetaxel después de completa el protocolo. Barras de escala = 50 nm. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: caracterización fenotípica y funcional de los modelos de células resistentes a Docetaxel. Ensayos de formación (A) representante de la colonia de células parentales y Docetaxel-resistente tratados con las concentraciones indicadas de Docetaxel para 72 h. porcentaje de colonias para cada concentración de tratamiento se representa en el gráfico incluido. Los experimentos son triplicados y datos representan la media ± SD. escala barras = 5 mm. (B) DR/parental aumento relativo del mRNA veces cuantificado por qRT-PCR de ABCB1, GATA2, CK19 y CDH1 se muestran. Todos los datos crudos de qPCR se normaliza a la actina (ver protocolo para más detalles). Los experimentos son triplicados y los datos representan la media ± SD. * p < 0.05. Haga clic aquí para ver una versión más grande de esta figura.

Discussion

En este manuscrito, se describe un método para generar sistemas de modelo de células de cáncer de próstata resistentes a Docetaxel que permite el estudio de los mecanismos que contribuyen a la adquisición del fenotipo de quimiorresistencia. Aunque este método es altamente confiable y reproducible, deben considerarse algunas limitaciones potenciales. Desde entonces sólo una pequeña fracción de la población mayor de células exhibirán quimiorresistencia28, se recomienda iniciar con una gran población de células (generalmente la placa de 20 frascos de 150 cm2, que representan aproximadamente 1.2 x 108 células). Pasos clave del Protocolo se deben considerar para asegurar el éxito del procedimiento. En primer lugar, es muy importante usar el Docetaxel mismo preparada acciones para el uso de largo plazo (acción de 10 mM pueden utilizarse para alícuotas de años cuando está almacenado correctamente en a-80 ° C). Ligeros cambios en la alícuota de Docetaxel pueden afectar los resultados de la CL50, generación de la sincronización de la línea de celular y los resultados de la formación de la Colonia. En segundo lugar, es crucial iniciar el protocolo de determinación de la IC50 en cada línea de células individuales, puesto que las variaciones pueden ocurrir cuando se usa un nuevo lote de células. En tercer lugar, es esencial controlar que el tratamiento farmacológico es eficaz controlando las células bajo el microscopio con frecuencia por lo que cualquier error puede ser detectado rápidamente y corregido. Por último, recomendamos siempre mantener un stock de pasos intermedios en caso de contaminación o problemas inesperados que pueden afectar la viabilidad de las células en el medio del protocolo. Lo importante, nuestro protocolo tiene como objetivo generar modelos de resistencia a los medicamentos al exponer las células de cáncer de próstata a altas dosis de Docetaxel para 72 h seguido por períodos de recuperación largos, en lugar de una concentración constante de la droga en un intento de imitar la mejor clínica escenario informado para el tratamiento de cáncer de próstata con este taxano agente15,16.

Además, cabe señalar que las células resistentes a drogas exhiben una alta plasticidad, que puede llevar a una pérdida progresiva de las propiedades de resistencia adquirida con el tiempo. Por lo tanto, extender el uso de estas células durante más de 2-3 meses en cultivo no se recomienda. Si es necesario un suministro permanente es recomendable para generar continuamente nuevos lotes de células resistentes. Sin embargo, si lotes de células han sido cultivados durante un tiempo prolongado, ensayos de formación de Colonia y qPCR pueden utilizarse para evaluar su resistencia. Otra alternativa es aumentar la resistencia menguante tratando las células con una alta dosis de Docetaxel por 72 h (500-1.000 nM). Después de un período de recuperación de una a dos semanas, el fenotipo puede comprobarse nuevamente por qPCR y Colonia formación ensayos. También es posible, aunque no se recomienda, para almacenar alícuotas de células tratadas en nitrógeno líquido (en FBS, 10% DMSO). Tenga en cuenta que después de un ciclo de congelación y descongelación, el fenotipo de quimiorresistencia debe siempre volver a evaluarse con los métodos antes mencionados.

A pesar de estas advertencias,28,29 y otros30,31,32,33 fueron capaces de emplear con éxito estos sistemas modelo para identificar celular clave novela y mecanismos moleculares que conducen a elevan iniciadoras del tumor de capacidad, supervivencia celular y agresividad en las células resistentes a Docetaxel. Utilizando estos sistemas de modelo de célula de cáncer, hemos descubierto que las células exhibiendo un fenotipo indiferenciado, caracterizado por la ausencia de marcadores de diferenciación epitelial y relacionados con la próstata y la sobreexpresión de targetable del desarrollo (muesca y Vías de señalización de Hedgehog), sobrevivir exposición quimioterapéuticos28. En un segundo estudio, usando estos modelos junto con conjuntos de datos disponible para el público gene paciente24,25, hemos descubierto que el factor de transcripción pionero GATA2 es altamente overexpressed en metastático resistente a la castración células de cáncer de próstata resistente a la quimioterapia. GATA2 aumenta la supervivencia de las células activando directamente un IGF2-quinasa dependiente de aguas abajo de señalización de red29. En particular, estos estudios ayudos a identificar nuevas funciones clave de GATA2 en agresividad de cáncer de próstata metastásico avanzado34.

El desarrollo de resistencia a los medicamentos es un problema que no se limita a Docetaxel y el cáncer de próstata, ya que es frecuente entre muchos otros tipos de cánceres tratados con una amplia gama de drogas quimioterapéuticas. De hecho, aplican restricciones similares en la disponibilidad de modelos experimentales, y es concebible que nuestro protocolo puede ser adaptado para el estudio de otros tipos de cáncer y sus mecanismos de quimiorresistencia respectivos.

La generación de las células resistentes a Docetaxel como se describe en este protocolo puede utilizarse como una herramienta funcional para identificar nuevos mecanismos moleculares y celulares relevantes de quimiorresistencia. Esto abre la puerta a la búsqueda de nuevos objetivos, que podría articular el desarrollo de nuevos tratamientos para el cáncer de próstata altamente maligno, una vez más empujando los límites de lo que sabemos sobre esta enfermedad y cómo tratar a sus pacientes.

Disclosures

Los autores declaran que no tienen intereses financieros que compiten.

Acknowledgments

V.R.-B. recibe fondos de la Secretaría de salud de Estados Unidos & número 1 de concesión de humanos servicios, NIH, Instituto Nacional del cáncer CA207458 K22-01 y J.D.-D. recibe fondos del Departamento de salud & humanos servicios, NIH, Instituto Nacional del cáncer otorga número 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).
Generación de modelos de celulares de cáncer de próstata de la resistencia a lo agente anti-mitotic Docetaxel
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).More

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter