Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Protocole de guidée pour la caractérisation microbienne fécale par 16 s rRNA-Amplicon séquençage

doi: 10.3791/56845 Published: March 19, 2018

Summary

Ce manuscrit décrit un protocole normalisé détaillé du séquençage de haut débit 16 s rRNA-amplicon. Le protocole introduit un protocole intégré, en uniforme, possible et peu coûteux à partir de prélèvement d’échantillons fécaux au moyen d’analyses de données. Ce protocole permet l’analyse d’un grand nombre d’échantillons contenant des normes rigoureuses et plusieurs contrôles.

Abstract

Le microbiome humain intestinal joue un rôle central dans la protection des cellules contre les blessures, dans le traitement de l’énergie et des nutriments et dans la promotion de l’immunité. Écarts par rapport à ce qui est considéré comme une composition de la microflore saine (dysbiose) peuvent altérer les fonctions vitales conduisant à des conditions pathologiques. Des recherches récentes et en cours ont été dirigées vers la caractérisation des associations entre la composition microbienne et la santé humaine et la maladie.

Percées dans les technologies de séquençage haut débit permettent de caractériser la composition microbienne de l’intestin. Ces méthodes incluent 16 s rRNA-amplicon séquençage et le séquençage de fusil de chasse. 16 s rRNA-amplicon séquençage sert à profil composition taxonomique, tandis que le séquençage de fusil de chasse fournit des informations supplémentaires sur les prédictions de gène et d’annotation fonctionnelle. Un avantage en utilisant une méthode de séquençage ciblé de la région variable du gène 16 s ARNr est son coût nettement inférieur par rapport au séquençage de fusil de chasse. Différences de séquence dans le gène de l’ARNr 16 s sont utilisés comme une empreinte digitale microbienne pour identifier et quantifier les différents taxons au sein d’un échantillon individuel.

Efforts internationaux majeurs ont fait appel à des normes pour l’ordonnancement de 16 s rRNA-amplicon. Toutefois, plusieurs études signalent une source commune de variation causée par l’effet du traitement par lots. Pour minimiser cet effet, des protocoles en uniforme pour le prélèvement d’échantillons, le traitement et le séquençage doivent être implémentée. Ce protocole propose l’intégration des protocoles largement utilisés à partir de prélèvement d’échantillons fécaux à des analyses de données. Ce protocole comprend une approche directe-PCR sans colonne, qui permet le traitement simultané et extraction de l’ADN d’un grand nombre d’échantillons de matières fécales, ainsi que de l’amplification par PCR de la région de V4. En outre, le protocole décrit le pipeline de l’analyse et fournit un script en utilisant la dernière version de QIIME (2 QIIME version 2017.7.0 et DADA2). Ce protocole étape par étape vise à guider ceux qui s’intéressent à amorcer l’utilisation du séquençage amplicon-ARNr 16 s de façon robuste, reproduction, facile à utiliser, détaillée.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Concentré efforts ont été faits afin de mieux comprendre la diversité microbiome et l’abondance, sous un autre aspect de capturer la différence et les similitudes entre les individus dans des conditions saines et pathologiques. Âge2,3, géographie4, mode de vie5,6et5 de la maladie se sont avérées être associé à la composition de la microbiome du tube digestif, mais beaucoup de troubles et les populations n’ont pas encore été entièrement caractérisé. Récemment, il a été signalé que le microbiome peut être modifié pour des applications thérapeutiques7,8,9. Des indications supplémentaires sur la relation entre les diverses conditions physiologiques et la composition microbienne sont donc la première étape vers l’optimisation des modifications futures possibles.

Les méthodes traditionnelles de culture microbienne sont limités par les faibles rendements de10,11et est conceptualisés comme un État binaire où une bactérie est présente dans le tube digestif ou pas. Haut débit basées sur l’ADN séquençage a révolutionné l’écologie microbienne, permettant la capture de tous les membres de la communauté microbienne. Cependant, séquence lu durée et la qualité restent des obstacles importants à la taxinomie exacte affectation12. En outre, expériences de base haut débit peuvent souffrir d’effets du lot, où les mesures sont touchés par des variables non biologiques ou non scientifique13. Ces dernières années, plusieurs programmes ont été établis afin d’étudier le microbiome humain, notamment le projet américain Gut, le Microbiome humain du projet des États-Unis (US) et le projet MetaHIT United Kingdom (UK). Ces initiatives ont généré de grandes quantités de données qui ne sont pas facilement comparables en raison d’un manque de cohérence dans leurs approches. Une variété de projets internationaux tels que le Consortium International Microbiome humain, le projet de normes de Microbiome humain International et le National Institute of Standards and Technology (NIST) a tenté de répondre à certaines de ces questions14 et mis au point des normes pour les mesures de microbiome qui doivent permettre la réalisation des résultats fiables de reproduction. Décrit ici est un protocole intégré de plusieurs méthodes largement utilisées15,16 pour 16 s rRNA haut débit séquençage (16 s-seq) à partir de prélèvement d’échantillons fécaux à travers des analyses de données. Le protocole décrit une approche sans colonne PCR, initialement conçue pour l’extraction directe d’usine ADN16, permettant le traitement simultané d’un grand nombre de selles dans un temps relativement court avec la qualité des échantillons ADN amplifié ciblée le séquençage de la région variable microbienne de V4 sur une plate-forme commune de séquençage. Ce protocole vise à guider les scientifiques intéressés par lancer l’utilisation de 16 s rRNA-amplicon séquençage de façon robuste, reproduction, facile à utiliser, détaillée, l’utilisation des contrôles importants. Ayant un protocole de guidée et détaillée étape par étape peut minimiser l’effet des lots et permettra ainsi à des résultats de séquençage plus comparables entre les laboratoires.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Approbation éthique pour l’étude a été accordée par le Saba Local Research Ethics Committee et toutes les méthodes ont été effectuées conformément aux directives et règlements. Le protocole a reçu une exception de consentement du patient de la Commission d’examen éthique locale, depuis les matières fécales qui ont été utilisés étaient déjà soumis à la base de la microbiologie dans le cadre du bilan clinique et sans information patiente identifiable autres que l’âge, sexe et résultats microbiennes. Écrit, le consentement éclairé a été obtenu de volontaires sains et l’Institutional Review Board a approuvé l’étude. Certains de ces échantillons ont déjà été incluses dans une précédente analyse1.

1. manipulation des échantillons

  1. Recueillir un frottis environ 5 de2 mm (à peu près la taille d’une gomme à crayon) auprès d’un échantillon de selles fraîche avec un écouvillon stérile dans un test tube (voir Table des matières). Rangez tous les écouvillons contenant des échantillons de matières fécales à-80 ° C en 24 h. Les écouvillons fécales peuvent y rester jusqu'à ce que la poursuite de la procédure.

2. Extraction d’ADN

  1. Décongeler les solutions d’Extraction et de la Dilution à température ambiante (voir Table des matières).
  2. Transfert de l’écouvillon fécale dans une collection vide 2 mL de tube (voir Table des matières). Ajuster la taille de bâton d’écouvillon en coupant à l’aide d’une paire de ciseaux propre pour permettre la fermeture de tube avec minimum la contamination croisée. Ajouter 250 μL de solution d’Extraction à chaque tube de prélèvement contenant l’écouvillon fécale et les vortex pour mélanger.
  3. Chauffer les échantillons pendant 10 min dans un bain d’eau bouillante (95 – 100° C). Ajouter 250 μL de solution de Dilution pour chaque échantillon et le vortex pour mélanger.
  4. Stocker les tubes de 2 mL contenant l’extrait d’ADN et l’écouvillon à 4 ° C.

3. PCR et préparation de la bibliothèque

Pour obtenir la procédure 3.1 et 3.2, environnement de travail dans une station de travail PCR offre propre, modèle et amplicon gratuit.

  1. Étiqueter les amorces (tableau 1) selon leur code à barres. Diluer chaque amorce dans l’eau bidistillée (DDW) à une concentration μM de 50 et les conserver à-20 ° C.
  2. Utiliser une plaque à 96 puits pour les réactions de PCR. Chaque plaque peut contenir 32 échantillons différents, qui sont marqués par 32 amorces d’indice différent. Décongeler l’amorce vers l’avant et les 32 amorces inverses à la température ambiante et diluer à 5 μM.
  3. Préparer des mélanges de réaction PCR pour 100 réactions (volume final dans chaque puits sera 20 μl) en mélangeant 100 μL d’apprêt avant de 5 μM, 1 mL 2 X PCR Master mix et 400 μL DDW. Mettre 15 μL de ce mélange PCR dans chaque puits (total de 96 puits). Ajouter 1 μL de chaque amorce indexée inverse 5 μM à 3 puits différents (32 différentes amorces dans réanalysés donne un total de 96 puits).
  4. Dans une zone dédiée de pre-PCR, ce qui signifie un banc propre qui est modèle et amplicon libre, ajouter 4 μL de chaque échantillon d’ADN extrait de mélanges réactionnels (chaque échantillon d’ADN prélevé est amplifié en triple exemplaire — 32 échantillons par plaque à 96 puits).
  5. Exécuter PCR avec les paramètres suivantes : une dénaturation initiale 94 ° c pendant 3 min ; suivi par 35 cycles de dénaturation à 94 ° C pendant 1 min, recuit à 55 ° C pendant 1 min et l’extension à 72 ° C pendant 1 minute ; et une extension finale à 72 ° C pendant 10 min.
  6. Sur un banc différent, qui sera défini comme une zone dédiée de post-PCR, combiner chaque réaction PCR en triple dans un tube de volume unique (60 μL / échantillon).
  7. Pour évaluer la qualité des amplicons PCR, exécutez 4 μL de chaque réaction combinée-PCR sur le gel de l’agarose à 1 % teinté bromure d’éthidium. En vertu de la longueur d’onde UV de 260 nm, les amplicons positifs apparaissent dans une taille de bande attendue de 375 à 425 bp. Seulement ces amplicons figureront dans les étapes ultérieures.
    Remarque : Chaque échantillon est amplifié en triple, sens que chaque échantillon est amplifié dans les 3 différentes réactions de PCR. N’évoluent pas vers le haut.

4. Bibliothèque Quantification et nettoyage

  1. Afin d’obtenir une piscine de concentration équimolaire de tous les échantillons PCR, quantifier chaque amplicon par un ADN bicaténaire (dsDNA quantifier réactif) fluorescent nucleic acid stain (voir Table des matières), permettant la quantification simultanée d’un grand nombre d’échantillons.
    Remarque : Étant donné que le calibre de l’amplicon est équivoque, le montant réel en nanogrammes est utilisé pour charger une concentration équimolaire.
  2. Mélanger 500 ng de chaque échantillon dans un tube unique et stérile. Vortex pour mélanger.
  3. Courir 200 μL de la bibliothèque regroupée sur un gel coloré au bromure d’éthidium 1 %. Extraire les bandes de bp 375-425 du gel à l’aide d’un gel extraction kit selon les instructions du fabricant (voir Table des matières) et Éluer la bibliothèque regroupée dans 80 μL DDW.
    NOTE : La bibliothèque de mise en commun doit avoir la taille choisie afin d’éviter les produits d’amplification non spécifique de l’hôte ADN.
  4. Mesurer la concentration finale de bibliothèque à l’aide d’un ADN double brin ultrasensible Detection kit selon les instructions du fabricant (voir Table des matières). Mesurer la taille de la bibliothèque précise en utilisant un kit de séparation et d’analyse très sensible pour les bibliothèques d’ADN selon les instructions du fabricant (voir Table des matières).

5. séquençage

  1. Diluer la bibliothèque regroupée à 19:00 avec ajout de bibliothèque de contrôles de 20 % (voir la Table des matières), selon le protocole de machine de séquençage.
  2. Pour le séquençage, conçu sur mesure utilisation lire amorces qui sont gratuits pour les amorces d’amplification V4 (voir tableau 1).
  3. Apprêt de séquençage conçu personnalisé utilisation une troisième qui lit le code barre dans un autre cycle (voir tableau 1) et génère des lectures jumelé-fin des 175 bases de longueur dans chaque direction, selon les spécifications du fabricant.
  4. Faire fonctionner la machine de séquençage et obtenir des fichiers FASTQ selon le protocole du fabricant.

6. traitement des données

  1. Assembler et traiter les fichiers FASTQ jumelé-fin qui se chevauchent dans un pipeline de curation de données implémenté dans QIIME 2 version 2017.7.017. Démultiplexer les lectures selon échantillon des codes à barres spécifique.
  2. Utiliser DADA218 pour la détection de variante (SVs) contrôle de la qualité et de la séquence. Tronquer les lectures à 13 bases de l’extrémité 3' et de l’extrémité 5', dans 15 bases jeter se lit avec plus de 2 Erreurs attendues. Identifier et supprimer les chimères à l’aide de la méthode du consensus — chimères sont détectées dans les échantillons individuellement et séquences trouvés chimériques dans une fraction suffisante des échantillons sont supprimés.
  3. Effectuer la classification taxonomique de SVs à l’aide d’un classifieur de Bayes Naive équipés, formés sur l’août 2013 99 % d’identité Greengenes de bases de6, pour 175 longtemps lectures et l’amorce de marche avant/marche arrière définie.
  4. Raréfier tous les échantillons à une profondeur de 2 146 séquences.
  5. Utilisez UniFrac non pondérée pour la mesure de la β-diversité (entre échantillon diversité19,20) sur les échantillons raréfiés, afin d’éviter un effet de taille d’échantillon.
  6. La matrice des distances qui en résulte permet d’effectuer une analyse des coordonnées principales (PCoA).
    Remarque : Les fichiers de script et cartographie du traitement des données sont fournis comme des éléments supplémentaires (matériel supplémentaire 1 et 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Une illustration schématique du protocole est illustrée à la Figure 1.

Nous avons recueilli prospectivement de selles de patients hospitalisés atteints de diarrhée infectieuse soupçonnée. Ces échantillons ont été soumis au laboratoire de microbiologie clinique au centre médical Sheba entre février et mai 2015, comme ce fut précédemment décrit1. Échantillons de selles ont été soumis aux formes conventionnelles de culture microbiologique effectuée au laboratoire de microbiologie clinique et à large gamme haut débit 16 s-seq en parallèle. En outre, les échantillons de selles des adultes en bonne santé ont été séquencés pour comparaison.

Dans cette analyse, l’accent était mis sur le contrôle de la qualité des données et afficher les résultats représentatifs de la production obtenue du QIIME217. Au départ, les résultats de séquençage dans 6 échantillons de contrôle négatif ont été examinées pour contrôle de la qualité, y compris : i) PCR sans modèle ii) PCR sur écouvillons propres et stériles dans la solution d’extraction et de la dilution et iii) PCR sur mixte d’extraction et de la dilution solutions. Le tableau 2 montre que tous les échantillons de contrôle négatif avaient ≤118 total lectures (moyenne de 29 séquences), principalement des taxons mycoplasmes, tandis que tous les autres échantillons analysés ont montré moyenne totale se lit 10622.57 (erreur de type ±1211.34) et aucune lecture de Mycoplasma passé le contrôle de la qualité des échantillons principales.

Seize échantillons que chacun provenance du même échantillon de selles mais traversé de préparation différentes bibliothèque avec des amorces différentes barcoded inverse ont été utilisés comme témoins positifs. Ces 16 échantillons inclus 8 avec cultures positives pour Campylobacter, Salmonellaou Shigella qui ont été signalés par le laboratoire de microbiologie clinique et 8 qui ont été signalées comme ayant des cultures négatives. Une parcelle de la zone au niveau des phyla est montrée dans la Figure 2. Les échantillons qui provenaient du même échantillon de selles, mais traversé de préparation différentes bibliothèque avec des amorces différentes barcoded inverse montrent très cohérente relative abondance (test de Mantel entre doublons de niveau taxonomique relative abondance de phylum les valeurs simulant p-value = 1 x 10-04 issu des 9999 réplicats).

Analyse de coordonnées principales (PCoA), qui réduit la dimensionnalité des données d’entrée, était posée sur la matrice de UniFrac à explorer visuellement similitude et la séparation de l’échantillon. Dans la Figure 3 a, séquencées échantillons qui proviennent de l’échantillon de selles original même mais est passé par la préparation de différentes bibliothèques sont de couleur même. En effet, ceux sont trouvent relativement près de la placette de PCoA (test de Mantel entre doublons PC1 PC2 valeurs simulée p-value = 1e-04 issu des 9999 réplicats). En outre, la distance de la diversité bêta unifrac non pondérée moyenne entre les échantillons dans la présente étude est 0,706, tandis que la distance moyenne entre deux doublons est 0,235 (test de Wilcoxon somme p-valeur = 4.205 x 10-11). Fait intéressant, échantillons culture bactérienne positive pour Campylobacter, Salmonella, Shigella ou entéropathogènes a montré des valeurs significativement différentes de PC1 (rang de Wilcoxon somme test valeur p = 0,011) comparativement aux échantillons avec résultats de culture négative. Figure 3 b montre la même parcelle PCoA, mais maintenant les échantillons sont colorées par l’abondance relative des Proteobacteria. Échantillons avec grande abondance de Proteobacteria présentaient des valeurs significativement différentes de PC1 (Spearman corrélation r =-0.533, p-value = 0.000975). Ces résultats concordent avec la précédente analyse de ces données, où les patients hospitalisés présentent des augmentations profondes taxons de Proteobacteria phylum1. Ici, nous avons montré que PC1 est corrélée avec l’abondance de Proteobacteria, avec échantillons positifs de la culture de clustering pour la plupart d’un côté des PC1 axe et la culture des échantillons négatifs clustering principalement sur l’autre côté, avec les échantillons sains.

Figure 1
Figure 1 : Diagramme de fèces de relative abondance microbienne. 1) manipulation des échantillons : à gauche, échantillons de matières fécales sont recueillies dans un tube stérile. À droite, la taille de bâton écouvillon est ajustée en le coupant pour permettre la fermeture de tube 2ml et le stockage. 2) l’extraction d’ADN : l’ADN est extrait par approche directe de colonnes libres de PCR. 3) préparation de bibliothèque : à gauche, 4 μl d’extrait d’ADN est amplifié avec des amorces de marche avant/marche arrière-index. Chaque amorce inversée contient un code à barres de base 12. Chaque échantillon est amplifié en trois exemplaires. Une plaque à 96 puits contient 32 différents codes à barres. À droite, combiner chaque code-barres en triple dans un tube de volume unique. Une plaque à 96 puits contient 96 différents codes à barres. 4) quantification de bibliothèque : panneau supérieur, dépistage des échantillons positifs, les amplicons ont été détectés sur gel d’agarose à 1 % du bromure d’éthidium teinté. Panneau inférieur, quantifier les amplicons positives pour atteindre une concentration équimolaire de 500 ng amplicon chaque échantillon dans un pool unique de bibliothèque. 5) purification de bibliothèque : panneau supérieur, la bibliothèque de mise en commun est gel extrait de sélection de la taille et de la purification. Panneau inférieur, la taille exacte de la bibliothèque et la concentration est mesurée. 6) séquençage : séquençage haut-débit de la bibliothèque de mise en commun. 7) les données de séquençage sont analysées par un pipeline de bioinformatique pour 16 s rRNA-amplicon écologie microbienne. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Abondance relative cohérente entre les échantillons qui proviennent du même échantillon de selles, mais traversé de préparation différentes bibliothèque. Taxonomique abondance relative au niveau de l’embranchement est montré par exemple comme indiqué. L’abondance relative est montré pour 16 échantillons de matières fécales provenant de patients hospitalisés souffrant de diarrhée infectieuse présumée, que chacun a traversé préparation autre bibliothèque (deux exemplaires 1 et 2) avec des amorces différentes inverse avec code à barres et de 3 témoins sains. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Diversité phylogénétique montrent des résultats cohérents pour les échantillons qui proviennent du même échantillon de selles, mais traversé de préparation différentes bibliothèque. Analyse de coordonnées principales (PCoA) qui réduit la dimensionnalité des données d’entrée était posée sur la matrice de UniFrac à explorer visuellement similitude et la séparation de l’échantillon. La distance entre deux échantillons correspond à la différence dans leur composition microbiome. (A) non pondérée UniFrac PCoA plot. Chaque point représente un seul échantillon séquencé. Les échantillons provenaient de l’échantillon de selles original même sont de couleur même. Échantillons provenant de patients hospitalisés avec coproculture positive signalée par la microbiologie clinique1 sont marqués par des carrés, des patients hospitalisés avec culture négative en triangles1et des adultes en bonne santé d’une exécution de séquençage distinct1 sont marqués avec rempli dans les cercles. (B), même PCoA comme dans A, mais les échantillons sont maintenant colorés par leur abondance relative des Proteobacteria, tel qu’indiqué. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Nom de l’apprêt Séquence d’amorce Description de l’apprêt
Primer avant AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' séquence adaptateur - pad amorce en avant - transmettre linker amorce - apprêt avant
Apprêt d’index inversé CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Inverser le complément de 3' adaptateur séquence - Golay barcode - Reverse primer pad - Reverse primer linker - Reverse primer
Apprêt de séquençage de lecture 1 TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Coussin d’apprêt en avant - transmettre linker amorce - apprêt avant
Apprêt de séquençage de lecture 2 AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Inverser l’apprêt inverse pad - Reverse primer linker - apprêt
Apprêt de séquence index ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Inverser le complément d’apprêt inverse - inverse complément de linker apprêt inverse - inverse complément de coussin apprêt inverse

Tableau 1 : Liste de Primer.

Échantillon Nombre de lectures de post
contrôle de la qualité initiale en
QIIME
PCR sur écouvillons propres dans une solution d’extraction et de la dilution -1 118
PCR sur écouvillons propres dans une solution d’extraction et de la dilution -2 39
PCR sans modèle -1 0
PCR sans modèle -2 0
PCR sur l’extraction et la dilution des solutions mix - 1 16
PCR sur l’extraction et la dilution des solutions mix - 2 0
Échantillons (moyenne ± écart) 10622.57 ± 1211.34

Tableau 2 : Nombre de lectures pour les contrôles négatifs et des échantillons les.

Supplémentaire 1 matériel : script de traitement des données S’il vous plaît cliquez ici pour télécharger ce fichier.

Complémentaire 2 matériel : cartographie fichier. S’il vous plaît cliquez ici pour télécharger ce fichier.

Matériel supplémentaire 3 : amorce. S’il vous plaît cliquez ici pour télécharger ce fichier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16 s rRNA-amplicon et métagénomique fusil séquençage ont gagné en popularité en microbiologie clinique demandes21,22, 23. Ces techniques sont avantageuses dans leur capacité accrue pour capturer des taxons cultivables et non cultivables, fournissant des données sur l’abondance relative de l’inoculum de pathogène et de leur capacité à identifier plus précisément un polymicrobienne infectieuse empreintes digitales24. Les avancées dans le domaine de la recherche sur le microbiome ont généré des grandes quantités de données qui ne sont pas facilement comparables en raison d’un manque de cohérence dans les approches diverses. Ces dernières années, plusieurs consortiums ont tenté de répondre à certaines de ces questions. Ce protocole suit préparation similaire de bibliothèque comme la terre microbiome projet (EMP). Cependant, s’ajoute un protocole détaillé étape par étape pour l’extraction de l’ADN d’échantillons de matières fécales par oléoduc d’analyses.

Auparavant, le séquençage des ARNr 16 s a été utilisé pour caractériser les patrons de composition microbienne des échantillons de matières fécales de sujets sains non hospitalisés et des patients hospitalisés atteints de diarrhée infectieuse soupçonnée et aux résultats de la culture traditionnelle. Les résultats de cette analyse a montré que les patients hospitalisés présentent des augmentations profondes taxons de Proteobacteria phylum1. Décrit ici est un protocole intégré des méthodes généralement utilisées pour 16 s rRNA gene amplicon séquençage à l’aide de la PCR exempt de colonnes approche directe qui a été initialement conçu pour l’extraction de plantes ADN16. Cette approche peut efficacement et extraire rapidement des bibliothèques d’ADN amplifié-bonne qualité ciblant la région variable V4 du gène de l’ARNr 16 s d’un grand nombre d’échantillons pour le séquençage des ARNr 16 s de haut-débit.

Comme il s’agit d’une méthode de séquençage de l’ADN, des données sur les communautés microbiennes des aérobies et anaérobies présentes dans un échantillon de selles individuel sont obtenues. Le protocole adopté les amorces qui ont été initialement conçus15 contre la région de la V4 du gène de l’ARNr 16 s. Ce qui est important, l’amorce de l’amplification inverse contiennent une séquence de douze barcode base qui prend en charge la mise en commun de jusqu'à 2 167 différents échantillons dans chaque voie15. L’apprêt avant amplification comprend neuf bases supplémentaires dans la région d’adaptateur qui prennent en charge le séquençage jumelé-fin sur le séquençage plate-forme25 (tableau 1 et 3 de matériel supplémentaire). Cette approche a permis gère une bibliothèque composée de 250 échantillons de matières fécales qui ont été séquencés sur une seule voie avec une profondeur en cours d’exécution de 10622,57 ± 1211,34 (moyenne ± écart) lectures par exemple à un coût d’environ 30 dollars par exemple.

Afin d’assurer le contrôle de la qualité, nous vous suggérons d’utiliser les contrôles négatifs suivants ; i) PCR sans matrice d’ADN, ii) PCR sur l’ADN extrait d’un écouvillon stérile propre et iii) PCR sur mélange de solution d’extraction et de la dilution. En ce qui concerne les contrôles positifs, nous vous recommandons d’y compris les échantillons qui proviennent du même échantillon de selles, mais traversé préparation autre bibliothèque des exemples et des amorces différentes inverse avec code à barres de courses précédentes comme contrôle de qualité interne. Noter, autres contrôles positifs en option à utiliser sont les étalons de mesure microbiome fournis par le NIST. La moyenne lit couverture pour les contrôles négatifs est remarquablement faible en comparaison avec les échantillons de selles réelles (tableau 1) et se compose principalement de taxons Mycoplasma. De plus, nous avons montré la cohérence des résultats séquençage obtenus à l’aide d’échantillons qui chacun provenance de la même matière fécale mais qui est passé par la préparation de différentes bibliothèques (Figure 3). Ce résultat confirme aussi que, lorsque vous utilisez notre méthode intégrée, il n’y a aucune contamination croisée entre les échantillons.

Dans ce protocole, nous introduisons un protocole intégré en uniforme, réalisable pour analyser un grand nombre d’échantillons. Ce protocole vise à guider les scientifiques intéressés par lancer l’utilisation de 16 s rRNA-amplicon séquençage d’une manière robuste, reproduction, facile à utiliser, peu coûteuse, détaillée de collection fécale à des analyses de données, l’utilisation des contrôles importants. En utilisant ce protocole normalisé de visite détaillée, peut minimiser les effets du traitement par lots et permettent des résultats de séquençage plus comparables entre les différents laboratoires.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été soutenu en partie par le programme I-CORE (subventions no 41/11), l’Israël Science Foundation (subvention no 908/15) et l’European Crohn et Colitis Organisation (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Protocole de guidée pour la caractérisation microbienne fécale par 16 s rRNA-Amplicon séquençage
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter