Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Protocollo guidata per caratterizzazione microbica fecale mediante sequenziamento del 16S rRNA-amplicone

doi: 10.3791/56845 Published: March 19, 2018

Summary

Questo manoscritto descrive un dettagliato protocollo standardizzato di alta-16S rRNA-amplicone sequenziamento. Il protocollo introduce un protocollo integrato, in uniforme, fattibile ed economico a partire dalla raccolta del campione fecale attraverso l'analisi dei dati. Questo protocollo consente l'analisi di un gran numero di campioni con rigorosi standard e diversi controlli.

Abstract

Il microbioma intestinale umano svolge un ruolo centrale nella protezione delle cellule dall'infortunio, nella trasformazione di energia e nutrienti e nel promuovere l'immunità. Deviazioni da quello che è considerato una composizione del microbiota sano (disbiosi) possono compromettere le funzioni vitali, portando a condizioni patologiche. Gli sforzi recenti e continue ricerche che sono state rivolte verso la caratterizzazione delle associazioni fra composizione microbica e la salute umana e la malattia.

Advances in tecnologie di sequenziamento ad alta velocità consente la caratterizzazione della composizione microbica dell'intestino. Questi metodi includono sequenziamento del 16S rRNA-amplicone e sequenziamento shotgun. Sequenziamento del 16S rRNA-amplicon viene utilizzata per analizzare la composizione tassonomica, mentre sequenziamento shotgun fornisce ulteriori informazioni su previsioni di gene e annotazione funzionale. Un vantaggio nell'utilizzo di un metodo di sequenziamento mirato della regione variabile del 16S rRNA gene è il suo costo notevolmente inferiore rispetto al sequenziamento shotgun. Differenze di sequenza nel gene del rRNA 16S vengono utilizzate come un'impronta digitale microbica per identificare e quantificare i diversi taxa all'interno di un singolo campione.

Principali iniziative internazionali hanno arruolato standard per sequenziamento del 16S rRNA-amplicon. Tuttavia, parecchi studi segnalano una fonte comune di variazione causato dall'effetto di batch. Per minimizzare questo effetto, in uniforme protocolli per la raccolta del campione, l'elaborazione e l'ordinamento deve essere implementato. Questo protocollo propone l'integrazione dei protocolli ampiamente utilizzati a partire dalla raccolta dei campioni fecali per analisi dei dati. Questo protocollo include un approccio diretto-PCR privo di colonna, che consente la gestione simultanea ed estrazione di DNA di un gran numero di campioni di feci, insieme con l'amplificazione di PCR della regione V4. Inoltre, il protocollo descrive la pipeline di analisi e fornisce uno script utilizzando l'ultima versione di QIIME (QIIME 2 versione 2017.7.0 e DADA2). Questo protocollo passo dopo passo si rivolge a chi è interessato a iniziare l'uso del sequenziamento del 16S rRNA-amplicone in modo robusto, riproduttivo, facile da usare e dettagliato guida.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sono concentrato sforzi per comprendere meglio microbiome diversità e abbondanza, come un altro aspetto di catturare la differenza e le somiglianze tra individui in condizioni sane e patologiche. Età2,3, Geografia4, lifestyle5,6e malattia5 sono stati indicati per essere associati con la composizione del microbioma intestinale, ma molte condizioni e popolazioni non sono ancora state completamente caratterizzata. Recentemente è stato segnalato che il microbioma può essere modificato per applicazioni terapeutiche7,8,9. Di conseguenza, ulteriori approfondimenti sul rapporto tra varie condizioni fisiologiche e la composizione microbica sono il primo passo verso l'ottimizzazione di potenziali future modifiche.

I metodi tradizionali di coltura microbica sono limitati da basse rese10,11e sono concettualizzati come uno stato binario dove è un batterio presente nell'intestino o non. Alto-rendimento di sequenziamento del DNA ha rivoluzionato l'ecologia microbica, consentendo la cattura di tutti i membri della comunità microbica. Tuttavia, la sequenza legge lunghezza e qualità rimangono significativi ostacoli alla tassonomia accurata assegnazione12. Inoltre, esperimenti di basati ad alta velocità possono soffrire di effetti di batch, dove misure sono influenzate da variabili non biologico o non-scientifica13. Negli ultimi anni, diversi programmi sono stati istituiti per studiare il microbioma umano, compreso il progetto americano Gut, il progetto microbioma umano di Stati Uniti (US) e il progetto MetaHIT Regno Unito (UK). Queste iniziative hanno generato grandi quantità di dati che non sono facilmente paragonabili a causa di una mancanza di coerenza nei loro approcci. Una varietà di progetti internazionali come International Human Microbiome Consortium, il progetto di International Human Microbiome standard e il National Institute of Standards e tecnologia (NIST) ha tentato di risolvere alcuni di questi problemi14 e sviluppato standard per misure di microbiome che dovrebbero consentire il raggiungimento di risultati riproduttivi affidabile. È descritto qui un protocollo integrato di diversi metodi ampiamente usati15,16 per 16S rRNA high throughput sequenziamento (16S-seq) a partire dalla raccolta del campione fecale attraverso l'analisi dei dati. Il protocollo descrive un approccio privo di colonna PCR, originariamente progettato per estrazione diretta della pianta del DNA16, per abilitare la gestione simultanea di un numero elevato di fecale campioni in un tempo relativamente breve di alta qualità ha amplificato il DNA per mirati sequenziamento della regione V4 variabile microbica su una comune piattaforma di sequenziamento. Questo protocollo mira a guidare gli scienziati interessati a iniziare l'uso del sequenziamento del 16S rRNA-amplicone in modo robusto, riproduttivo, facile da usare, dettagliato, utilizzando controlli importanti. Avendo un protocollo guidate e dettagliate passo a passo può minimizzare l'effetto di batch e così vi permetterà risultati di sequenziamento più comparabili tra i laboratori.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Approvazione etica per lo studio è stato concesso dal comitato di etica Sheba locale ricerca e tutti i metodi sono stati eseguiti in conformità con le direttive e i regolamenti. Il protocollo ha ricevuto un'eccezione di consenso del paziente dal locale comitato di revisione etica, poiché il materiale fecale che sono stati utilizzati sono stati già presentati al nucleo di microbiologia come parte del workup clinico e senza informazioni identificabili paziente diverso da età, genere e microbiche risultati. Scritto, il consenso informato è stato ottenuto da volontari sani e Institutional Review Board ha approvato lo studio. Alcuni di quei campioni sono già stati inclusi in una precedente analisi1.

1. trattamento del campione

  1. Raccogliere una sbavatura di2 mm di circa 5 (circa le dimensioni di una gomma da matita) da un campione fecale fresco con un tampone sterile in un test tube (Vedi Tabella materiali). Memorizzare tutti i tamponi contenenti i campioni fecali a-80 ° C entro 24h. I tamponi fecali possono rimanere là fino al procedimento successivo.

2. DNA estrazione

  1. Scongelare le soluzioni di estrazione e diluizione a temperatura ambiente (Vedi Tabella materiali).
  2. Trasferimento il tampone fecale in un insieme vuoto 2 mL tubo (vedere Tabella materiali). Regolare le dimensioni di bastone di tampone di taglio utilizzando un paio di forbici pulita per consentire la chiusura del tubo con minima contaminazione incrociata. Aggiungere 250 μL di soluzione di estrazione per ogni provetta contenente il tampone fecale e vortexare per mescolare.
  3. Riscaldare i campioni per 10 min in un bagno di acqua bollente (95 – 100° C). Aggiungere 250 μL di soluzione di diluizione per ogni campione e vortexare per mescolare.
  4. Conservare i capillari di 2 mL contenente il DNA estratto e il tampone a 4 ° C.

3. PCR e preparazione di biblioteca

Ai punti 3.1 e 3.2, lavorare in una workstation PCR che fornisce pulito, ambiente privo di modello e amplicon.

  1. Etichettare i primer (tabella 1) secondo il loro codice a barre. Diluire ciascun primer in doppia acqua distillata (DDW) per un 50 μM concentrazione e conservare a-20 ° C.
  2. Utilizzare una piastra a 96 pozzetti per reazioni di PCR. Ogni piatto può contenere 32 campioni differenti, che sono contrassegnati da 32 primer indice diverso. Scongelare il primer forward e i 32 iniettori d'inversione a temperatura ambiente e diluirli a 5 μM.
  3. Preparare miscele di reazione di PCR per 100 reazioni (volume finale in ciascun pozzetto sarà 20 μl) con 100 µ l di primer in avanti di 5 μM, 1 mL 2 X PCR Master mix e 400 μL DDW. Mettere 15 μL di questo mix PCR in ciascun pozzetto (totale di 96 pozzetti). Aggiungere 1 μL di ogni primer indicizzata inverso 5 μM a 3 diversi pozzi (32 diversi primer in triplici copie dà un totale di 96 pozzetti).
  4. In una zona dedicata per pre-PCR, significato un banco pulito che è modello e amplicon gratis, aggiungere 4 μL di ciascun campione di DNA estratto a miscele di reazione (ogni campione di DNA estratto è amplificato in triplice copia — 32 campioni per piastra a 96 pozzetti).
  5. Eseguire PCR con le seguenti impostazioni: denaturazione iniziale di 94 ° C per 3 min; seguita da 35 cicli di denaturazione a 94 ° C per 1 min, ricottura a 55 ° C per 1 min e l'estensione a 72 ° C per 1 min; e un'estensione finale a 72 ° C per 10 min.
  6. Su un banco diverso, che viene definito come una zona dedicata per il post-PCR, combinare ogni reazione di PCR triplicate in un tubo singolo volume (60 µ l per campione).
  7. Per valutare la qualità degli ampliconi PCR, eseguire 4 μL di ogni reazione combinato-PCR su un gel di agarosio all'1% macchiato di bromuro di etidio. Sotto UV lunghezza d'onda di 260 nm, gli ampliconi positivi apparirà in una dimensione di banda prevista di 375 – 425 bp. Solo questi ampliconi saranno inclusi nei passaggi successivi.
    Nota: Ciascun campione viene amplificato in triplice copia, significato che ogni campione è amplificato in 3 differenti reazioni di PCR. Non scalabilità.

4. Biblioteca quantificazione e pulizia

  1. Al fine di ottenere una piscina di concentrazione equimolare di tutti i campioni PCR, quantificare ciascun amplicon di un DNA a doppio filamento (dsDNA quantificare reagente) fluorescente dell'acido nucleico macchia (Vedi Tabella materiali), adatto per la quantificazione simultanea di un grande quantità di campioni.
    Nota: Poiché la gamma di dimensioni del amplicon è equivoca, l'importo effettivo nei nanograms viene utilizzato per caricare una concentrazione equimolare.
  2. Combinare 500 ng di ciascun campione in un singolo tubo sterile. Vortice di mescolare.
  3. Eseguire 200 μL della biblioteca riunita su un gel di agarosio all'1% il bromuro di etidio-macchiato. Estrarre le bande di bp di 375 – 425 dal gel utilizzando un kit di estrazione del gel secondo le istruzioni del produttore (Vedi Tabella materiali) ed eluire la libreria riunita in 80 μL DDW.
    Nota: La libreria pool deve essere formato selezionato per ridurre i prodotti di amplificazione aspecifica da DNA ospite.
  4. Misurare la concentrazione finale libreria utilizzando un dsDNA altamente sensibile rilevare kit secondo le istruzioni del produttore (Vedi Tabella materiali). Misurare la dimensione di biblioteca accurato utilizzando un kit di separazione e analisi altamente sensibile per le librerie di DNA secondo le istruzioni del produttore (Vedi Tabella materiali).

5. sequenziamento

  1. Diluire la libreria riunita a 19 con aggiunta di libreria di controlli del 20% (Vedi Tabella materiali), secondo il protocollo di macchina di sequenziamento.
  2. Per il sequenziamento, progettato su misura uso leggere gli iniettori che sono gratuiti per i primer di amplificazione V4 (Vedi tabella 1).
  3. Primer di sequenziamento progettato personalizzato uso un terzo che legge il codice a barre in un ulteriore ciclo (Vedi tabella 1) e genera fine accoppiato letture di 175 basi di lunghezza in ogni direzione, secondo le specifiche del produttore.
  4. Eseguire la macchina di sequenziamento e ottenere file FASTQ secondo il protocollo del produttore.

6. elaborazione dei dati

  1. Cucire insieme ed elaborare i file FASTQ accoppiato-fine sovrapposti in una pipeline di curatela di dati implementato in QIIME 2 versione 2017.7.017. Demultiplex letture secondo campione specifici codici a barre.
  2. Utilizzare DADA218 per il rilevamento di variante (SVs) di controllo di qualità e sequenza. Troncare letture alle 13 basi dall'estremità 3' e 15 dall'estremità 5', scartare legge con più di 2 errori previsti. Identificare e rimuovere le chimere utilizzando il metodo del consenso — chimere vengono rilevate in campioni singolarmente e sequenze individuate chimerici in una frazione sufficiente di campioni vengono rimossi.
  3. Eseguire SVs classificazione tassonomica usando un classificatore Naive Bayes montato, addestrati su agosto 2013 99% identità Greengenes database6, per 175 lunghe letture e il set di primer Forward/Reverse.
  4. Rarefarsi tutti i campioni a profondità di 2.146 sequenze.
  5. Utilizzare UniFrac non ponderata per la misurazione della β-diversità (tra campione diversità19,20) sui campioni rarefatti, per evitare un effetto di dimensione del campione.
  6. Utilizzare la matrice delle distanze risultante per eseguire un'analisi di coordinate principali (PCoA).
    Nota: I file di script e mappatura di elaborazione dati vengono forniti come materiale supplementare (complementare materiale 1 e 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Un'illustrazione schematica del protocollo è illustrato nella Figura 1.

Prospetticamente abbiamo raccolto campioni di feci da pazienti ospedalizzati con sospetta diarrea infettiva. Tali campioni sono stati presentati al laboratorio di microbiologia clinica presso il centro medico di Sheba tra febbraio e maggio 2015, come è stato descritto in precedenza1. Campioni di feci sono stati sottoposti a coltura microbiologica convenzionale eseguita presso il laboratorio di microbiologia clinica e alla vasta gamma high throughput 16S-seq in parallelo. Inoltre, i campioni di feci da adulti sani sono stati sequenziati per il confronto.

In questa analisi, il fuoco era sul controllo della qualità dei dati e visualizza risultati rappresentativi dell'output ottenuto dal QIIME217. Inizialmente, i risultati di sequenziamento raggiunti in 6 campioni di controllo negativo sono stati esaminati per controllo di qualità tra cui: i) PCR senza modello, ii) PCR su tamponi puliti e sterili in soluzione di estrazione e diluizione e iii) PCR misto estrazione e diluizione soluzioni. Tabella 2 Mostra che tutti i campioni di controllo negativo ha avuto ≤118 totale letture (media di 29 sequenze), principalmente dai taxa del micoplasma, mentre tutti gli altri campioni analizzati hanno mostrate la media totale legge di 10622.57 (±1211.34 errore standard) e nessuna lettura del micoplasma passato il controllo di qualità dei principali campioni.

Sedici campioni che ciascuno ha avuto origine dallo stesso campione di feci ma è andato attraverso la preparazione di libreria diverso con gli iniettori diversi inversa con codice a barre sono stati utilizzati come controlli positivi. Quei 16 campioni incluso 8 con le colture positive per il Campylobacter, Salmonellao Shigella che sono stati segnalati al laboratorio di microbiologia clinica e 8 che sono stati segnalati come avendo le colture negative. Una trama di zona a livello di phyla è illustrata nella Figura 2. Campioni che ha avuto origine dallo stesso campione di feci, ma è andato attraverso la preparazione di libreria diverso con gli iniettori diversi inversa con codice a barre mostrano molto coerenza relativa abbondanza (test di Mantel tra duplicati di phylum livello tassonomico relativa abbondanza i valori simulati p-valore = 1 x 10-04 basato su 9999 repliche).

Coordinate principali analisi (PCoA), che riduce la dimensionalità dei dati di input, è stata usata sulla matrice UniFrac ad per esplorare visivamente somiglianza e separazione del campione. In Figura 3A, campioni sequenziati che è provenuto dallo stesso campione Sgabello originale ma è andato attraverso la preparazione di diversi biblioteca sono colorati lo stesso. Infatti, coloro che si trovano relativamente molto attentamente nella trama PCoA (test di Mantel tra duplicati PC1 PC2 valori simulati p-valore = 1e-04 basato su 9999 repliche). Inoltre, la distanza di diversità di beta unifrac non ponderata medio tra i campioni in questo studio è 0.706, mentre la distanza media tra due duplicati è 0.235 (p-valore di prova di somma rigogliosa di Wilcoxon = 4,205 x 10-11). Interessante, i campioni che erano positive per il Campylobacter, Salmonellao Shigella enteropatogeni cultura hanno mostrato valori significativamente diversi PC1 (somma rigogliosa di Wilcoxon test valore p = 0,011) rispetto ai campioni con risultati negativi della coltura. Figura 3B Mostra la stessa trama di PCoA ma ora i campioni sono colorati dall'abbondanza relativa di Proteobacteria. Campioni con abbondanza di Proteobacteria alta avevano valori significativamente diversi PC1 (correlazione Spearman r =-0.533, valore di p = 0.000975). Tali risultati sono coerenti con la precedente analisi di questi dati, dove pazienti ospedalizzati hanno profondi aumenti in taxa di phylum Proteobacteria1. Qui abbiamo mostrato che PC1 è correlato con abbondanza di Proteobacteria, con i campioni positivi di cultura clustering per lo più su un lato del PC1 asse e cultura campioni negativi di clustering per lo più sul lato opposto, insieme ai campioni sani.

Figure 1
Figura 1 : Diagramma di flusso da campioni di feci di relativa abbondanza microbica. 1) manipolazione del campione: a sinistra, i campioni fecali sono raccolti in una provetta sterile tampone. Bene, la dimensione di bastone tampone viene regolata dal taglio di esso per attivare la chiusura della provetta da 2ml e deposito. 2) estrazione del DNA: il DNA è Estratto da approccio privo di colonne diretto di PCR. 3) preparazione di biblioteca: a sinistra, 4 μL di DNA estratto è amplificato con primer Forward/Reverse-indice. Ogni primer reverse contiene un codice a barre base 12. Ogni campione è amplificato in triplice copia. Una piastra a 96 pozzetti contiene 32 diversi codici a barre. Bene, è possibile combinare ogni codice a barre triplicate in un tubo singolo volume. Una piastra a 96 pozzetti contiene 96 diversi codici a barre. 4) quantificazione di biblioteca: pannello superiore, lo screening per campioni positivi, ampliconi sono stati rilevati su gel di agarosio all'1% il bromuro di etidio-macchiato. Pannello inferiore, quantificazione degli ampliconi positivi per raggiungere la concentrazione equimolare di 500 ng amplicone da ciascun campione in una piscina unica libreria. 5) purificazione biblioteca: pannello superiore, la libreria di pool è gel estratto per la selezione della dimensione e purificazione. Pannello inferiore, la dimensione esatta di biblioteca e la concentrazione viene misurata. 6) sequenziamento: sequenziamento ad alta velocità della biblioteca in pool. 7) i dati di sequenziamento sono analizzati da una pipeline di bioinformatica per 16S rRNA-amplicone ecologia microbica. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Abbondanza relativa coerenza tra i campioni che ha avuto origine dallo stesso campione di feci, ma è andato attraverso la preparazione di diversi biblioteca. Tassonomica abbondanza relativa al livello di phylum è indicato per campione come indicato. Abbondanza relativa viene visualizzata per 16 campioni fecali ottenuti da pazienti ospedalizzati con sospetta diarrea infettiva che ognuno è andato attraverso la preparazione di libreria diverso (duplicato 1 e 2) con gli iniettori diversi inversa con codice a barre e dei 3 comandi sani. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Diversità filogenetica Visualizza risultati coerenti per i campioni che ha avuto origine dallo stesso campione di feci, ma è andato attraverso la preparazione di diversi biblioteca. Coordinate principali analisi (PCoA) che riduce la dimensionalità dei dati di input è stata usata sulla matrice UniFrac ad per esplorare visivamente somiglianza e separazione del campione. La distanza tra due campioni rappresenta la differenza nella loro composizione microbioma. (A) non ponderata UniFrac PCoA trama. Ogni punto rappresenta un singolo campione sequenziato. Campioni ha avuto originari dallo stesso campione originale sgabello sono colorati lo stesso. Campioni da pazienti ospedalizzati con la coltura delle feci positivi riportati dalla microbiologia clinica1 sono contrassegnati da piazze, pazienti ospedalizzati con cultura negativa in triangoli1e adulti in buona salute da una corsa separata sequenziamento1 sono contrassegnati con riempito nei circoli. (B) stesso PCoA come in A, ma i campioni ora sono colorate da loro abbondanza relativa di Proteobacteria, come indicato. Clicca qui per visualizzare una versione più grande di questa figura.

Nome di primer Sequenza più superelegante Descrizione di primer
Forward primer AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' sequenza adattatore - Forward pad primer - Forward linker primer - primer Forward
Indice inverso primer CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Invertire il complemento di 3' adattatore sequenza - Golay barcode - Reverse primer pad - Reverse primer del linker - Reverse primer
Primer di sequenziamento di lettura 1 TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Forward pad primer - Forward linker primer - primer Forward
Primer di sequenziamento di lettura 2 AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Reverse primer Reverse di pad - linker Reverse primer - primer
Indice sequenza primer ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Complemento inverso di primer reverse - Reverse complemento del linker reverse primer - Reverse complemento del pad reverse primer

Tabella 1: Elenco di Primer.

Campione Numero di letture post
controllo di qualità iniziale in
QIIME
PCR su pulita tamponi in soluzione di estrazione e diluizione -1 118
PCR su pulita tamponi in soluzione di estrazione e diluizione -2 39
PCR senza modello -1 0
PCR senza modello -2 0
PCR il mix di soluzioni di estrazione e diluizione - 1 16
PCR su estrazione e diluizione soluzioni mix - 2 0
Campioni (media ± errore standard) 10622.57 ± 1211.34

Tabella 2: Numero di letture per i controlli negativi e per campioni di feci.

Complementare materiale 1: script. elaborazione dei dati Per favore clicca qui per scaricare questo file.

Complementare materiale 2: Mapping file. Per favore clicca qui per scaricare questo file.

Complementare materiale 3: schema di Primer. Per favore clicca qui per scaricare questo file.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16S rRNA-amplicone e sequenziamento shotgun metagenomica hanno guadagnato popolarità in microbiologia clinica applicazioni21,22,23. Queste tecniche sono vantaggiose in loro una maggiore capacità di catturare taxa coltivabili e non coltivabili, fornendo dati relativi l'abbondanza relativa dell'inoculo di patogeno e la loro capacità di identificare più precisamente un polimicrobica infettiva 24di impronte digitali. I progressi nel campo della ricerca microbiome hanno generato grandi quantità di dati che non sono facilmente paragonabili a causa di una mancanza di coerenza tra i vari approcci. Negli ultimi anni, diversi consorzi hanno tentato di affrontare alcuni di questi problemi. Questo protocollo segue simili libreria preparazione come il progetto microbioma earth (EMP). Tuttavia, si aggiunge un protocollo dettagliato passo-passo per l'estrazione di DNA da campioni di feci attraverso pipeline di analisi.

In precedenza, del rRNA 16S è stato utilizzato per caratterizzare i modelli di composizione microbica di campioni di feci da soggetti non ospedalizzati sani e da pazienti ospedalizzati con sospetta diarrea infettiva e ai risultati di cultura tradizionale. I risultati di tale analisi ha mostrato che pazienti ospedalizzati hanno profondi aumenti in taxa di phylum Proteobacteria1. È descritto qui un protocollo integrato di metodi largamente usati per sequenziamento del 16S rRNA gene amplicone utilizzando la PCR privo di colonne approccio diretto che è stato originariamente progettato per l'estrazione della pianta del DNA16. Questo approccio può efficacemente e rapidamente estrarre librerie di DNA amplificato di buona qualità V4 regione variabile del gene del rRNA 16S da un gran numero di campioni adatti per il sequenziamento di alto-rendimento 16S rRNA di targeting.

Come si tratta di un metodo di sequenziamento del DNA, vengono ottenuti i dati su entrambi gli aerobi e anaerobi comunità microbiche presenti in un singolo campione fecale. Il protocollo adottato i primers che erano originariamente progettato15 contro la regione V4 del gene del rRNA 16S. D'importanza, il primer di amplificazione d'inversione contengono una sequenza di dodici base codice a barre che supporta il pool di campioni fino a 2.167 differenti in ogni corsia15. Il primer di amplificazione avanti include nove basi supplementari nella regione adattatore che supportano l'ordinamento accoppiato-fine sul sequenziamento piattaforma25 (tabella 1 e 3 di materiale supplementare). Questo approccio abilitato gestisce una biblioteca composta da 250 campioni di feci che sono stati sequenziati su una corsia con una profondità in esecuzione di 10622,57 ± 1211,34 (media ± errore standard) letture per campione al costo di circa 30 dollari per esempio.

Per assicurare il controllo di qualità, si consiglia di utilizzare i seguenti controlli negativi; i) PCR senza mascherina del DNA, ii) PCR su DNA Estratto da un tampone pulito sterile e iii) PCR sul misto soluzione di estrazione e diluizione. Per quanto riguarda i controlli positivi, si consiglia di compresi i campioni che ha avuto origine dallo stesso campione di feci, ma è andato attraverso la preparazione di diversi biblioteca con primer diversi inversa con codice a barre e campioni da precedenti esecuzioni come controllo di qualità interno. Di nota, altri controlli positivi opzionali da utilizzare sono quelle standard di misurazione microbiome fornite dal NIST. La media legge copertura per i controlli negativi è notevolmente inferiore rispetto ai campioni di feci effettivo (tabella 1) ed è stato composto principalmente dai taxa del micoplasma. Abbiamo mostrato ulteriormente la consistenza dei risultati sequenziamento ottenuti usando campioni che ciascuno ha avuto origine dallo stesso materiale fecale, ma che è andato attraverso la preparazione di libreria diverso (Figura 3). Questo risultato conferma anche che, quando si utilizza il nostro metodo integrato, non c'è nessuna contaminazione tra campioni.

In questo protocollo introduciamo un protocollo integrato in uniforme, fattibile per analizzare un numero elevato di campioni. Questo protocollo mira a guidare gli scienziati interessati nel promuovere l'uso del sequenziamento del 16S rRNA-amplicone in modo robusto, riproduttivo, facile da usare, poco costoso, dettagliato da collezione fecale per analisi dei dati, utilizzo dei controlli importanti. Utilizzando questo protocollo standardizzato di guidate dettagliata, possono minimizzare gli effetti di batch e consentire risultati di sequenziamento più comparabili tra i diversi laboratori.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Questo lavoro è stato supportato in parte dal programma-CORE (concede n. 41/11), la Israel Science Foundation (concessione n. 908/15) e l'europeo di Crohn e colite organizzazione (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Protocollo guidata per caratterizzazione microbica fecale mediante sequenziamento del 16S rRNA-amplicone
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter