Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Protocolo guiado para caracterização microbiana Fecal de 16S rRNA-Amplicon sequenciação

doi: 10.3791/56845 Published: March 19, 2018

Summary

Este manuscrito descreve um protocolo padronizado detalhado de arranjar em sequência do elevado-throughput 16S rRNA-amplicon. O protocolo apresenta um protocolo integrado, uniformizado, viável e barato a partir de coleta de amostra fecal através de análises de dados. Este protocolo permite a análise de um grande número de amostras com padrões rigorosos e vários controles.

Abstract

A humana microbiome intestinal desempenha um papel central em proteger as células de uma lesão, no processamento de energia e nutrientes e na promoção da imunidade. Desvios do que é considerado uma composição da microbiota saudável (disbiose) podem prejudicar as funções vitais levando a condições patológicas. Esforços recentes e em curso de investigação tem sido direcionados para a caracterização das associações entre composição microbiana e a saúde humana e a doença.

Avanços em tecnologias de sequenciamento do elevado-throughput permitem a caracterização a composição microbiana do intestino. Estes métodos incluem 16S rRNA-amplicon sequenciamento e sequenciamento de espingarda. 16s rRNA-amplicon sequenciamento é usado para perfil composição taxonômica, enquanto o sequenciamento de espingarda fornece informações adicionais sobre as previsões de gene e anotação funcional. Uma vantagem em usar um método de sequenciamento alvo da região variável do gene de rRNA 16S é seu custo substancialmente menor comparado ao sequenciamento de espingarda. Diferenças de sequência no gene 16S rRNA são usadas como uma impressão digital microbiana para identificar e quantificar diferentes táxons dentro de uma amostra individual.

Grandes esforços internacionais tem alistado padrões para 16S rRNA-amplicon sequenciamento. No entanto, vários estudos relatam uma fonte comum de variação causada pelo efeito do lote. Para minimizar esse efeito, protocolos uniformizados para colheita de amostras, processamento e sequenciamento devem ser implementado. Este protocolo propõe a integração de protocolos amplamente usados a partir de coleta de amostra fecal para análises de dados. Este protocolo inclui uma abordagem direta-PCR coluna-livre, que permite a manipulação simultânea e extração de DNA de um grande número de amostras fecais, juntamente com a amplificação por PCR da região V4. Além disso, o protocolo descreve o pipeline de análise e fornece um script usando a versão mais recente do QIIME (QIIME 2 versão 2017.7.0 e DADA2). Este protocolo passo a passo é destinado a orientar os interessados em iniciar o uso do 16S rRNA-amplicon sequenciamento de forma robusta, reprodutiva, fácil de usar, detalhada.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Esforços concentrados foram feitos para entender melhor microbiome diversidade e abundância, como outro aspecto de captar a diferença e semelhanças entre os indivíduos em condições saudáveis e patológicos. Idade2,3, geografia4, estilo de vida5,6e doença5 foram mostrados para ser associado com a composição de microbiome o intestino, mas muitas condições e populações ainda não foram totalmente caracteriza-se. Recentemente foi relatado que o microbiome pode ser modificado para aplicações terapêuticas7,8,9. Portanto, insights adicionais sobre a relação entre várias condições fisiológicas e a composição microbiana é o primeiro passo para a otimização dos potenciais futuras modificações.

Os métodos tradicionais de cultura microbiana são limitados por baixos rendimentos de10,11e são conceitualizados como um estado binário, onde uma bactéria está presente no intestino, ou não. Sequenciamento de alto rendimento baseado em DNA revolucionou a ecologia microbiana, permitindo a captura de todos os membros da comunidade microbiana. No entanto, a sequência ler comprimento e qualidade permanecem entraves significativos à taxonomia exata atribuição12. Além disso, experimentos com base alta produtividade podem sofrer de efeitos em lote, onde as medições são afetadas por variáveis não-biológicos ou não-científica13. Nos últimos anos, vários programas foram estabelecidos para estudar a microbiome humano, incluindo o projeto americano Gut, o projeto de Microbiome humano dos Estados Unidos (EUA) e o projeto MetaHIT do Reino Unido (UK). Estas iniciativas têm gerado grandes quantidades de dados que não são facilmente comparáveis devido à falta de consistência em suas abordagens. Uma variedade de projetos internacionais como o consórcio internacional de Microbiome humano, o projeto humana Microbiome as normas internacionais e o National Institute of Standards e tecnologia (NIST) tentou abordar algumas dessas questões14 e desenvolveu padrões para medições de microbiome que deverá permitir a obtenção de resultados reprodutivos confiáveis. Aqui descrito é um protocolo integrado de vários métodos amplamente utilizados15,16 para 16S rRNA elevado-throughput sequenciamento (16S-seq) a partir de coleta de amostra fecal através de análises de dados. O protocolo descreve uma abordagem PCR coluna-livre, projetada originalmente para extração direta de planta DNA16, para habilitar a manipulação simultânea de um grande número de fecal amostras em um tempo relativamente curto com alta qualidade amplificado DNA para alvo sequenciamento da região de V4 microbiana da variável sobre uma plataforma comum de sequenciamento. Este protocolo visa orientar cientistas interessados em iniciar o uso do 16S rRNA-amplicon sequenciamento de forma robusta, reprodutiva, fácil de usar, detalhada, usando controles importantes. Tendo um protocolo guiada e detalhadas passo-a-passo pode minimizar o efeito de lote e assim permitirá resultados de sequenciamento mais comparáveis entre laboratórios.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aprovação ética para o estudo foi concedida pelo Comitê Local de ética pesquisa de Sheba e todos os métodos foram realizados em conformidade com as normas orientadoras aplicáveis e regulamentos. O protocolo recebido uma exceção de consentimento paciente do Conselho local de revisão ética, desde o material fecal que foram usados foram já apresentados para o núcleo de microbiologia como parte do exame clínico e sem informações identificáveis do paciente além de idade, gênero e resultados microbianos. Escrito, foi obtido o consentimento de voluntários saudáveis e o Conselho de revisão institucional aprovado o estudo. Algumas dessas amostras já foram incluídas em um anterior análise1.

1. manipulação de amostra

  1. Recolher um esfregaço2 mm com aproximadamente 5 (aproximadamente do tamanho de uma borracha de lápis) de uma amostra fecal fresca com um cotonete estéril em um teste de tubo (ver Tabela de materiais). Armazene todos os esfregaços contendo amostras fecais a-80 ° C dentro de 24 h. Os esfregaços fecais podem permanecer lá até o processamento adicional.

2. extração de DNA

  1. Descongelar as soluções de extração e diluição à temperatura ambiente (ver Tabela de materiais).
  2. Transferência o swab fecal em uma coleção vazia de 2 mL do tubo (ver Tabela de materiais). Ajuste o tamanho da vara cotonete cortando-o usando uma tesoura limpa para permitir o fechamento do tubo com contaminação mínima. Adicione 250 μL de solução de extração para cada tubo de coleta contendo o swab fecal e vórtice para misturar.
  3. Aquecer as amostras por 10 min em um banho de água a ferver (95-100° C). Adicione 250 μL de solução de diluição para cada amostra e o vórtice para misturar.
  4. Armazenar os tubos de 2 mL contendo o DNA extraído e o cotonete a 4 ° C.

3. PCR e preparação de biblioteca

Para obter as etapas 3.1 e 3.2, ambiente de trabalho em uma estação de trabalho PCR que fornece limpa, modelo e amplicon livre.

  1. Rotule os primers (tabela 1), de acordo com seu código de barras. Diluir cada primer na água bidestilada (DDW) a uma concentração de μM 50 e loja a-20 ° C.
  2. Use uma placa de 96 poços para reações de PCR. Cada placa pode conter 32 amostras diferentes, que são marcadas por 32 primeiras demão índice diferente. Descongelar o primer para a frente e os 32 primers inverso à temperatura ambiente e diluí-los a 5 μM.
  3. Prepare misturas de reação de PCR para 100 reações (volume final em cada poço será 20 μl) misturando-se 100 μL de cartilha para a frente de 5 μM, 1ml 2 X PCR Master mix e 400 μL DDW. Colocar 15 μL desta mistura de PCR em cada poço (total de 96 poços). Adicione 1 μL de cada 5 μM de primer indexado reverso 3 diferentes poços (32 diferentes cartilhas em triplica dá um total de 96 poços).
  4. Em uma zona dedicada do pre-PCR, significando uma bancada limpa que é modelo e amplicon livre, adicionar 4 μL de cada amostra de DNA extraída de misturas de reação (cada amostra de DNA coletada é amplificada em triplicado — 32 amostras por placa de 96 poços).
  5. Executar o PCR com as seguintes configurações: desnaturação inicial de 94 ° C por 3 min; seguido por 35 ciclos de desnaturação a 94 ° C por 1 min, recozimento a 55 ° C, durante 1 minuto e extensão a 72 ° C por 1 min; e uma extensão final a 72 ° C por 10 min.
  6. Em um banco diferente, que será definido como uma zona dedicada post-PCR, combine cada reação de PCR triplicada em um tubo de volume único (60 μL por amostra).
  7. Para avaliar a qualidade do PCR amplicons, execute 4 μL de cada reação de PCR combinados em um gel de agarose a 1% manchadas de brometo de ethidium. Sob UV comprimento de onda de 260 nm, o positivo amplicons aparecerá em um tamanho de banda esperada da bp 375-425. Só estes amplicons serão incluídos nas etapas subsequentes.
    Nota: Cada amostra é amplificada em triplicado, significado que cada amostra é amplificada em 3 diferentes reações de PCR. Não aumenta.

4. Biblioteca quantificação e limpeza

  1. A fim de obter uma piscina de concentração equimolar de todas as amostras PCR, quantificar cada amplicon por um ADN encalhado dobro (dsDNA quantificar reagente) fluorescente ácido nucleico mancha (ver Tabela de materiais), adequado para a quantificação simultânea de um grande quantidade de amostras.
    Nota: Uma vez que a escala do tamanho do amplicon é equívoca, a quantidade real em nanogramas é usada para carregar uma concentração equimolar.
  2. Combine 500 ng de cada amostra para um tubo estéril e único. Vórtice de misturar.
  3. Execute 200 μL da biblioteca em pool em um gel de agarose a 1% manchadas de brometo de etídio. Extraia faixas de bp de 375-425 do gel usando um kit de extração do gel de acordo com as instruções do fabricante (ver Tabela de materiais) e eluir a biblioteca agrupada em 80 μL DDW.
    Nota: A biblioteca em pool deve ser tamanho selecionado para reduzir os produtos de amplificação não-específica do host DNA.
  4. Medir a concentração final de biblioteca usando um dsDNA altamente sensível detectando o kit de acordo com as instruções do fabricante (ver Tabela de materiais). Medir o tamanho exato de biblioteca usando um kit de separação e análise altamente sensível para bibliotecas de DNA de acordo com as instruções do fabricante (ver Tabela de materiais).

5. sequenciamento

  1. Diluir a biblioteca em pool para 19:00 com adição de biblioteca de controle de 20% (ver Tabela de materiais), de acordo com o protocolo de máquina de sequenciamento.
  2. Para sequenciamento, uso personalizado projetado Leia as primeiras demão que são gratuitas para os primers de amplificação de V4 (ver tabela 1).
  3. Cartilha de uso um terço personalizado projetado sequenciamento que lê o código de barras em um adicional ciclo (ver tabela 1) e gera leituras emparelhado-fim de 175 bases de comprimento em cada sentido, de acordo com as especificações do fabricante.
  4. Executar a máquina de sequenciamento e obter os arquivos FASTQ de acordo com o protocolo do fabricante.

6. processamento de dados

  1. Costurar e processar os arquivos FASTQ emparelhado-final sobrepostos em um pipeline de curadoria de dados implementado em QIIME 2 versão 2017.7.017. Demultiplex as leituras de acordo com a amostra de códigos de barras específicas.
  2. Use DADA218 para a deteção de variante (SVs) controle de qualidade e sequência. Truncar leituras 15 bases da extremidade 5', e 13 bases da extremidade 3' descarte lê com mais de 2 erros esperados. Identificar e remover as quimeras usando o método do consenso — quimeras são detectadas em amostras individualmente, e sequências encontradas quiméricoes em uma fração suficiente de amostras são removidas.
  3. Executar a classificação taxonômica de SVs usando um classificador Naive Bayes equipado, treinado em de 2013 a agosto 99% identidade Greengenes banco de dados6, para 175 tempo leituras e o primer de avanço/retrocesso definido.
  4. Rarefy todas as amostras, a profundidade de 2.146 sequências.
  5. Use UniFrac não ponderada para medição da diversidade-β (entre amostra diversidade19,20) nas amostras de rarefeita, para evitar um efeito de tamanho de amostra.
  6. Use a matriz de distância resultante para realizar uma análise de coordenadas principais (PCoA).
    Nota: Os arquivos de script e mapeamento de processamento de dados são fornecidos como material suplementar (complementar Material 1 e 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Uma ilustração esquemática do protocolo é mostrada na Figura 1.

Prospectivamente, nós recolhemos amostras de fezes de pacientes hospitalizados com diarreia infecciosa suspeita. As amostras foram submetidas ao laboratório de Microbiologia clínica no centro médico de Sheba entre fevereiro e maio de 2015, como foi descrito anteriormente1. Amostras de fezes foram submetidas a cultura microbiológica convencional, realizado no laboratório de Microbiologia clínica e a ampla gama alta produtividade 16S-seq em paralelo. Além disso, amostras de fezes de adultos saudáveis foram sequenciadas para comparação.

Nesta análise, o foco foi sobre o controle de qualidade dos dados e mostrar resultados representativos da produção obtidos de QIIME217. Inicialmente, resultados de sequenciamento em 6 amostras de controlo negativo foram revistos para controle de qualidade incluindo: i) PCR sem modelo ii) PCR em cotonetes limpos e esterilizados na solução de extração e diluição e iii) PCR na extração mista e diluição soluções. A tabela 2 mostra que todas as amostras de controlo negativo tinham ≤118 total leituras (média de 29 sequências), principalmente os táxons de Mycoplasma, enquanto todas as outras amostras analisadas mostraram média total lê de 10622.57 (±1211.34 erro-padrão) e não há leitura de Mycoplasma passado o controle de qualidade das principais amostras.

Dezesseis amostras que cada originou-se a mesma amostra de fezes, mas passou pela preparação de biblioteca diferente com primers barcoded reversa diferentes foram usadas como controles positivos. As 16 amostras incluíam 8 com culturas positivas para Campylobacter, Salmonellaou Shigella que foram relatadas pelo laboratório de Microbiologia clínica e 8 que foram relatadas como tendo culturas negativas. Uma trama de área no nível de filos é mostrada na Figura 2. Amostras que originaram-se a mesma amostra de fezes, mas passaram pela preparação de biblioteca diferente com primers diferentes barcoded reversa mostram abundância relativa muito consistente (teste de Mantel entre duplicatas de abundância relativa taxonômica nível de filo valores simularam p-valor = 1 x 10-04 , com base em 9999 repetições).

Análise de coordenadas principais (PCoA), que reduz a dimensionalidade dos dados de entrada, foi usado na matriz da UniFrac para explorar visualmente a similaridade e a separação da amostra. Na Figura 3A, amostras sequenciais que originaram-se a mesma amostra de fezes original, mas passaram pela preparação de biblioteca diferente são coloridas o mesmo. Com efeito, são relativamente localizados perto na trama PCoA (teste de Mantel entre duplicatas PC1 PC2 valores simulado p-valor = 1e-04, com base em 9999 repetições). Além disso, a distância de diversidade beta média não ponderada unifrac entre amostras neste estudo é 0.706, enquanto a distância média entre duas duplicatas é 0,235 (teste de Wilcoxon rank soma p-valor = 4.205 x 10-11). Curiosamente, as amostras que foram cultura positiva para Campylobacter, Salmonellaou Shigella enteropatógenos mostraram valores significativamente diferentes do PC1 (teste de Wilcoxon rank soma p-valor = 0.011) em comparação com amostras com resultados de cultura negativa. Figura 3B mostra o mesmo enredo de PCoA mas agora amostras são coloridas pela abundância relativa de Proteobacteria. Amostras com alta abundância de Proteobacteria tinham valores significativamente diferentes do PC1 (Spearman correlação r =-0.533, p-valor = 0.000975). Esses resultados são consistentes com a anterior análise destes dados, onde pacientes hospitalizados têm aumentos profundos dos táxons de Proteobacteria filo1. Aqui nós mostramos que o PC1 está correlacionada com abundância de proteobactérias, com amostras positivas para cultura de clustering na maior parte, de um lado das amostras negativas PC1 eixo e cultura principalmente no outro lado, juntamente com as amostras saudáveis de clustering.

Figure 1
Figura 1 : Fluxograma de amostras fecais de abundância relativa microbiana. 1) manipulação de amostra: à esquerda, amostras fecais são coletadas em um tubo de cotonete estéril. Bem, o tamanho do pau de cotonete é ajustado por cortá-lo para permitir o encerramento do tubo 2ml e armazenamento. 2) extração de DNA: DNA é extraído pela abordagem direta livre de colunas PCR. 3) preparação de biblioteca: à esquerda, 4 μL de DNA extraído é amplificado com primers Forward/Reverse-índice. Cada primer reverso contém uma base de código de barras 12. Cada amostra é amplificada em triplicado. Uma placa de 96 poços contém 32 diferentes códigos de barras. Bem, combine cada três vias de código de barras em um tubo de volume único. Uma placa de 96 poços contém 96 diferentes códigos de barras. 4) quantificação de biblioteca: painel superior, triagem para amostras positivas, amplicons foram detectados em gel de agarose a 1% manchadas de brometo de etídio. Painel inferior, quantificação dos amplicons positivo para atingir a concentração equimolar de 500 ng amplicons de cada amostra em uma piscina única biblioteca. 5) purificação biblioteca: painel superior, a biblioteca em pool é gel extraído para a seleção do tamanho e da purificação. Painel inferior, o tamanho exato da biblioteca e concentração é medido. 6) sequenciamento: sequenciamento de alto rendimento da biblioteca em pool. 7) os dados de sequenciamento são analisados por um pipeline de bioinformatic para 16S rRNA-amplicon ecologia microbiana. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Abundância relativa consistente entre as amostras que originou-se a mesma amostra de fezes, mas passou pela preparação de biblioteca diferente. Abundância relativa taxonômica no nível de filo é mostrada por amostra conforme indicado. Abundância relativa é mostrada para 16 amostras fecais, obtidas de pacientes hospitalizados com diarreia infecciosa suspeita que cada um passou pela preparação de biblioteca diferente (duplicata 1 e 2) com primers barcoded reversa diferentes e de 3 controles saudáveis. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Diversidade filogenética mostrar resultados consistentes para amostras que originaram-se a mesma amostra de fezes, mas passaram pela preparação de biblioteca diferente. Análise de coordenadas principais (PCoA) que reduz a dimensionalidade dos dados de entrada foi usado na matriz da UniFrac para explorar visualmente a similaridade e a separação da amostra. A distância entre duas amostras representa a diferença na sua composição microbiome. (A) não ponderada UniFrac PCoA plotar. Cada ponto representa uma única amostra sequenciada. Amostras originadas-se a amostra de fezes original mesmo são o mesmo coloridas. Amostras de pacientes hospitalizados com cultura de fezes positiva relatada pelo Microbiologia clínica1 são marcadas por quadrados, pacientes hospitalizados com cultura negativa em triângulos1e adultos saudáveis de uma corrida de sequenciamento separado1 são marcadas com círculos preenchidos. (B) mesma PCoA como em A, mas amostras agora são coloridos por sua abundância relativa de proteobactérias, conforme indicado. Clique aqui para ver uma versão maior desta figura.

Nome da primeira demão Sequência da primeira demão Descrição da primeira demão
Cartilha para a frente AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' sequência de adaptador - encaminhar a almofada da primeira demão - encaminhar vinculador cartilha - cartilha para a frente
Cartilha de índice reverso CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Reverter o complemento de 3' adaptador sequência - Golay barcode - primer reverso almofada - linker primer reverso - reverso primer
Cartilha de sequenciamento de leitura 1 TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Encaminhar a almofada da primeira demão - encaminhar vinculador cartilha - cartilha para a frente
Cartilha de sequenciamento de leitura 2 AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Reverter o reverso da primeira demão de almofada - linker inversa da primeira demão - de cartilha
Cartilha de sequência de índice ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Complemento reverso do reverso da primeira demão - reversa complementar de vinculador primer reverso - reversa complementar almofada inversa da primeira demão

Tabela 1: Lista de Primer.

Amostra Número de leituras post
controle de qualidade inicial em
QIIME
PCR em cotonetes limpos na extração e diluição solução -1 118
PCR em cotonetes limpos na solução de extração e diluição -2 39
PCR sem modelo -1 0
PCR sem modelo -2 0
PCR na extração e diluição mistura de soluções - 1 16
PCR na extração e diluição mistura de soluções - 2 0
Amostras (média ± erro-padrão) 10622.57 ± 1211.34

Tabela 2: Número de leituras para controles negativos e para amostras fecais.

1 de Material complementar: script de processamento de dados Clique aqui para baixar este arquivo.

Complementar Material 2: mapeamento de arquivo. Clique aqui para baixar este arquivo.

3 de Material complementar: regime Primer. Clique aqui para baixar este arquivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16s rRNA-amplicon e sequenciamento de espingarda metagenomics ganharam popularidade em aplicações de Microbiologia clínica21,22,23. Estas técnicas são vantajosas em sua capacidade aumentada para capturar táxons viáveis e não viáveis, fornecendo dados sobre a abundância relativa de inóculo patogênico e sua capacidade de identificar mais precisamente um polymicrobial infecciosa impressão digital24. Os avanços no campo da pesquisa microbiome têm gerado grandes quantidades de dados que não são facilmente comparáveis devido à falta de consistência nas várias abordagens. Nos últimos anos, vários consórcios tentou abordar algumas dessas questões. Este protocolo segue preparação de biblioteca similar como o projeto de microbiome terra (EMP). No entanto, acrescentou é um protocolo detalhado passo a passo para extração de DNA de amostras fecais através do pipeline de análises.

Anteriormente, sequenciação de rRNA 16S tem sido usada para caracterizar os padrões de composição microbiana de amostras fecais de indivíduos saudáveis não-hospitalizado e de pacientes hospitalizados com diarreia infecciosa suspeita e aos resultados de cultura tradicional. Os resultados da análise mostraram que pacientes hospitalizados têm aumentos profundos dos táxons de Proteobacteria filo1. Aqui descrito é um protocolo integrado de métodos amplamente utilizados para 16S rRNA gene amplicon em sequência usando a abordagem direta de colunas-livre do PCR que foi originalmente projetada para extração de DNA16de planta. Esta abordagem pode eficientemente e rapidamente extrair bibliotecas de DNA amplificado de boa qualidade visando a região variável V4 do gene 16S rRNA de um grande número de amostras adequados para arranjar em sequência do elevado-throughput 16S rRNA.

Como este é um método de sequenciamento de DNA-baseados, são obtidos dados sobre comunidades microbianas tanto aeróbios e anaeróbios, presentes em uma amostra fecal individual. O protocolo adotou os primers que foram originalmente concebidos15 contra a região V4 do gene 16S rRNA. Importante, o primer de amplificação reversa contém uma sequência de doze base de código de barras que ofereça suporte a agrupamento de até 2.167 amostras diferentes em cada pista15. O primer de amplificação direta inclui nove bases extras na região de adaptador que suportam emparelhado-final sequenciamento o sequenciamento plataforma25 (tabela 1 e 3 de Material complementar). Essa abordagem permitida uma biblioteca de manipulação é composta por 250 amostras fecais que foram sequenciadas em uma pista com uma profundidade de execução de 10622,57 ± 1211,34 (média ± erro-padrão) leituras por amostra a um custo de ~ 30 dólares por amostra.

Para garantir o controle de qualidade, nós sugerimos usar os seguintes controles negativos; i) PCR sem modelo de DNA, ii) PCR em DNA extraído de um cotonete estéril limpo e iii) PCR na mistura de solução de extração e diluição. Quanto aos controlos positivos, recomendamos incluindo amostras que originaram-se a mesma amostra de fezes, mas passou por preparação biblioteca diferentes com diferentes barcoded reversa primers e as amostras de execuções anteriores como controlo de qualidade interno. Digno de nota, outros controles positivos opcionais para ser usado são os padrões de medição microbiome fornecidos pelo NIST. A média lê a cobertura para os controles negativos é notavelmente mais baixa em comparação com as amostras de fezes reais (tabela 1) e foi composta principalmente dos táxons de Mycoplasma. Ainda mais, mostramos a consistência dos resultados obtidos com amostras que cada um se originou do mesmo material fecal, mas que passou por preparação biblioteca diferentes (Figura 3) sequenciamento. Este resultado confirma também que, quando usando nosso método integrado, lá não é nenhuma contaminação entre amostras.

Este protocolo, apresentamos um protocolo integrado de uniformizados, viável para analisar um grande número de amostras. Este protocolo visa orientar cientistas interessados em iniciar o uso do 16S rRNA-amplicon sequenciamento de forma robusta, reprodutiva, fácil de usar, barata, detalhada da coleção fecal para análises de dados, usando controles importantes. Usando este protocolo guiado detalhado padronizado, pode minimizar os efeitos de lote e permitir resultados de sequenciamento mais comparáveis entre diferentes laboratórios.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Este trabalho foi financiado em parte pelo programa-CORE (subvenções n º 41/11), a Israel Science Foundation (grant no. 908/15) e o Europeu de Crohn e colite organização (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Protocolo guiado para caracterização microbiana Fecal de 16S rRNA-Amplicon sequenciação
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter