Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Protocolo guía para caracterización microbiana Fecal por secuencia de 16S rRNA-productos

doi: 10.3791/56845 Published: March 19, 2018

Summary

Este manuscrito describe un detallado protocolo estandarizado de secuenciación de amplicones de rRNA 16S de alto rendimiento. El protocolo presenta un protocolo integrado, uniformado, factible y de bajo costo a partir de la recolección de muestras fecales a través de análisis de datos. Este protocolo permite el análisis de un gran número de muestras con estándares rigurosos y varios controles.

Abstract

El microbioma intestinal humana juega un papel central en la protección de las células de la lesión, en el procesamiento de energía y nutrientes y en promover la inmunidad. Desviaciones de lo que se considera una composición de la microbiota saludable (disbiosis) pueden influenciar las funciones vitales que conduce a condiciones patológicas. Esfuerzos de investigación recientes y en curso se han dirigido hacia la caracterización de las asociaciones entre la composición microbiana y la salud humana y la enfermedad.

Los avances en tecnologías de secuenciación de alto rendimiento permiten la caracterización de la composición microbiana del intestino. Estos métodos incluyen amplicon de rRNA 16S que ordena y secuencia de la escopeta. Secuenciación de amplicones de rRNA 16S se utiliza para Perfil de composición taxonómica, mientras que la secuenciación shotgun proporciona información adicional acerca de las predicciones del gene y anotación funcional. Una ventaja en el uso de un método de secuenciación específica de la región variable del 16S rRNA gene es su costo sustancialmente inferior en comparación con la secuencia de la escopeta. Las diferencias de secuencia en el gene del rRNA 16S se utilizan como una huella microbiana para identificar y cuantificar diferentes taxones dentro de una muestra individual.

Grandes esfuerzos internacionales han alistado estándares para secuenciación de amplicones de rRNA 16S. Sin embargo, varios estudios reportan una fuente común de variación causada por el efecto de lote. Para minimizar este efecto, uniformados protocolos para toma de muestras, procesamiento y la secuencia deben implementarse. Este protocolo propone la integración de protocolos ampliamente usados a partir de muestras fecales para el análisis de datos. Este protocolo incluye un enfoque directo-PCR libre de columnas, que permite el manejo simultáneo y la extracción de ADN de un gran número de muestras fecales, junto con la amplificación por PCR de la región V4. Además, el protocolo describe la tubería análisis y proporciona un script usando la última versión de QIIME (QIIME 2 versión 2017.7.0 y DADA2). Este protocolo paso a paso está destinado a los interesados en iniciar el uso de productos de rRNA 16S que ordena de manera robusta, reproductiva, fácil de usar, detallada orientar a.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Concentración de esfuerzos se hicieron para entender mejor el microbioma diversidad y abundancia, como otro aspecto de la captura de diferencia y semejanzas entre los individuos en condiciones sanas y patológicas. Edad2,3, geografía4, estilo de vida5,6y5 de la enfermedad fueron demostrados para ser asociado con la composición del microbioma de la tripa, pero muchas condiciones y poblaciones aún no han sido completamente caracterizado. Recientemente se ha divulgado que el microbioma puede ser modificado para aplicaciones terapéuticas7,8,9. Por lo tanto, la penetración adicional en la relación entre diferentes condiciones fisiológicas y la composición microbiana es el primer paso hacia la optimización de posibles modificaciones futuras.

Los métodos tradicionales de cultivo microbiano están limitados por bajos rendimientos10,11y se conceptualizan como un estado binario donde es una bacteria presente en el intestino o no. Secuenciación de alto rendimiento basado en el ADN ha revolucionado la ecología microbiana, lo que permite la captura de todos los miembros de la comunidad microbiana. Sin embargo, la secuencia Lee longitud y calidad siguen siendo barreras significativas a la taxonomía exacta asignación12. Además, basado en experimentos de alto rendimiento pueden sufrir de efectos por lotes, donde las mediciones son afectadas por variables no biológicas o no científica13. En los últimos años, se han establecido varios programas para estudiar el microbioma humano, incluyendo el proyecto americano Gut, el proyecto microbioma humano de Estados Unidos (US) y el proyecto MetaHIT de Reino Unido (Reino Unido). Estas iniciativas han generado grandes cantidades de datos que no son fácilmente comparables debido a la falta de coherencia en sus planteamientos. Una variedad de proyectos internacionales tales como el consorcio internacional de microbioma humano, el proyecto del microbioma humano normas y el National Institute of Standards and Technology (NIST) intentó abordar algunos de estos temas14 y desarrolla estándares para la medición de microbioma que permita el logro de resultados reproductivos confiables. Se describe aquí es un protocolo integrado de15,varios métodos ampliamente utilizados de16 para 16S rRNA alto rendimiento secuencia (16S-seq) a partir de la recogida de muestras fecales a través del análisis de datos. El protocolo describe un enfoque PCR libre de columnas, diseñado originalmente para la extracción directa de la planta DNA16, para permitir el manejo simultáneo de grandes cantidades de heces las muestras en un tiempo relativamente corto con alta calidad amplificaron la DNA para la apuntada secuenciación de la región variable microbiana de V4 en una plataforma común de la secuencia. Este protocolo tiene como objetivo guiar a los científicos interesados en iniciar el uso de productos de rRNA 16S que ordena de manera robusta, reproductiva, fácil de usar, detallada, usando controles importantes. Tener un protocolo de visitas guiadas y detallada paso a paso puede minimizar el efecto de lote y así permitirá resultados de secuenciación más comparables entre laboratorios.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aprobación ética para el estudio fue otorgada por el Comité de ética de investigación Local de Sheba y todos los métodos fueron realizados conforme a las normas y directrices pertinentes. El protocolo recibió una excepción del consentimiento del paciente de la Junta de revisión ética local, desde la materia fecal que se utilizaron fueron ya sometidos a la base de la microbiología como parte del workup clínico y sin paciente identificable que no sea de edad, Género y resultados microbianos. Escrito, el consentimiento informado fue obtenido de voluntarios sanos y la Junta de revisión institucional aprobó el estudio. Algunas de las muestras ya han sido incluidas en un análisis anterior1.

1. manejo de la muestra

  1. Recoger un frotis aproximadamente 5 de2 mm (aproximadamente del tamaño de un borrador de lápiz) de una muestra fecal fresca con un hisopo estéril en una prueba de tubo (véase Tabla de materiales). Guarde los hisopos que contiene muestras de heces a-80 ° C en 24 h. Los hisopos fecales pueden permanecer allí hasta que la transformación posterior.

2. extracción de ADN

  1. Descongelar las soluciones de extracción y dilución a temperatura ambiente (véase Tabla de materiales).
  2. Transferencia el hisopo fecal en una colección vacía 2 mL del tubo (véase Tabla de materiales). Ajustar el tamaño de la stick de hisopo cortando con unas tijeras limpias para permitir el cierre del tubo con mínima contaminación. Añadir 250 μL de solución de extracción para cada tubo de la colección que contiene el hisopo fecal y vortex para mezclar.
  3. Calentar las muestras durante 10 min en un baño de agua hirviendo (95 – 100° C). Añadir 250 μL de solución de dilución para cada muestra y agitar para mezclar.
  4. Almacenar los tubos de 2 mL que contiene el ADN extraído y el hisopo a 4 ° C.

3. PCR y preparación de la biblioteca

Para los pasos 3.1 y 3.2, ambiente de trabajo en una estación de trabajo PCR que proporciona limpio, plantilla y productos gratis.

  1. Los iniciadores (tabla 1) según su código de barras de la etiqueta. Diluir cada cartilla en agua bidestilada (DDW) a una concentración μM 50 y almacenar a-20 ° C.
  2. Utilice una placa de 96 pocillos para reacciones de PCR. Cada placa puede contener 32 muestras diferentes, que son etiquetadas por 32 iniciadores de índice diferentes. Descongelar la cartilla hacia adelante y los cebadores inversos 32 a temperatura ambiente y diluir a 5 μM.
  3. Preparar mezclas de reacción de PCR para 100 reacciones (volumen final en cada pozo será 20 μl) mediante la mezcla de 100 μL del primer avance de 5 μM, 1 mL 2 X PCR Master mix y 400 μL DDW. Poner 15 μL de esta mezcla PCR en cada pozo (un total de 96 pocillos). Añadir 1 μL de cada cebador indexadas inversa 5 μM a 3 diferentes pozos (32 diferentes cartillas en triplicado da un total de 96 pocillos).
  4. En una zona dedicada a pre-PCR, lo que significa un banco limpio de la plantilla y productos gratis, añadir 4 μL de cada muestra de ADN extraída a las mezclas de reacción (cada muestra de ADN extraída se amplifica por triplicado — 32 muestras por placa de 96 pocillos).
  5. Ejecutar la polimerización en cadena con los siguientes ajustes: desnaturalización inicial de 94 ° C por 3 min; seguido de 35 ciclos de desnaturalización a 94 ° C por 1 min, recocido a 55 ° C por 1 min y extensión a 72 ° C por 1 min; y una extensión final a 72 ° C durante 10 minutos.
  6. En un banco diferente, que se define como una zona dedicada a post-PCR, combinar cada reacción de PCR por triplicado en un tubo de volumen (60 μL por muestra).
  7. Para evaluar la calidad de los amplicones de PCR, ejecute 4 μL de cada reacción de PCR combinada en un gel de agarosa al 1% teñidos de bromuro de etidio. Bajo longitud de onda de UV de 260 nm, los amplicones positivo aparecerá en un tamaño de banda esperado de 375-425 bp. Sólo estos amplicones se incluirán en los pasos posteriores.
    Nota: Cada muestra se amplifica en triplicado, significa que cada muestra se amplifica en 3 diferentes reacciones de PCR. No escale.

4. Biblioteca cuantificación y limpieza

  1. Para conseguir una piscina de concentración equimolar de todas las muestras PCR, cuantificar cada amplicón por una doble trenzada DNA (dsDNA cuantificar reactivo) de la mancha fluorescente ácidos nucleicos (véase Tabla de materiales), adecuado para la cuantificación simultánea de un gran cantidad de muestras.
    Nota: Dado que el rango de tamaño de los amplicones es equívoco, la cantidad real en nanogramos se utiliza para cargar una concentración equimolar.
  2. Combinar 500 ng de cada muestra en un tubo único, estéril. Vortex para mezclar.
  3. Ejecutar 200 μL de la biblioteca agrupada en un gel de agarosa 1% teñido de bromuro de etidio. Extracto de las bandas de 375-425 bp del gel utilizando un kit de extracción de gel según las instrucciones del fabricante (véase Tabla de materiales) y eluir la biblioteca agrupada en 80 μL DDW.
    Nota: La biblioteca combinada debe ser el tamaño seleccionado para reducir productos de amplificación no específica de anfitrión DNA.
  4. Medir la concentración de final de la biblioteca utilizando un dsDNA altamente sensible detectar kit según las instrucciones del fabricante (véase Tabla de materiales). Medir el tamaño exacto de la biblioteca con el equipo de separación y análisis muy sensible para las bibliotecas de DNA según las instrucciones del fabricante (véase Tabla de materiales).

5. la secuencia

  1. Diluir la biblioteca combinada de 19:00 con la adición de biblioteca de control de 20% (véase Tabla de materiales), según el protocolo de la máquina de la secuencia.
  2. Para la secuencia, diseñada personalizado de uso Lee cartillas que son complementarios a los cebadores de amplificación V4 (véase tabla 1).
  3. Cartilla de la secuencia diseñada personalizada uso un tercero que lee el código de barras en un ciclo (véase tabla 1) y genera lecturas de extremo apareado de 175 bases de longitud en cada dirección, según las especificaciones del fabricante.
  4. Funcionar la máquina de secuenciación y obtener archivos FASTQ según protocolo del fabricante.

6. procesamiento de datos

  1. Unir y procesar los archivos FASTQ extremo apareado superpuestos en una tubería de conservación de datos implementado en 2 QIIME versión 2017.7.017. Demultiplexar las lecturas según muestra determinados códigos de barras.
  2. Utilice DADA218 para la detección de variante (SVs) de control de calidad y secuencia. Truncar lee en 13 bases del extremo 3' y 15 bases desde el extremo 5', descarte Lee con más de 2 errores esperados. Identificar y eliminar las quimeras usando el método de consenso — quimeras son detectadas en las muestras individualmente, y se eliminan secuencias encuentran quiméricas en una fracción suficiente de muestras.
  3. Realizar la clasificación taxonómica de la SVs mediante un clasificador Naive Bayes equipado, entrenado en agosto de 2013 99% identidad Greengenes base de datos6, para 175 largo Lee y la cartilla de reversa/sistema.
  4. Espiritualizado todas las muestras a profundidad de 2.146 secuencias.
  5. Use Unweighted UniFrac para la medición de la β-diversidad (entre muestra diversidad19,20) en las muestras enrarecidas, para evitar un efecto de tamaño de muestra.
  6. Utilizar la matriz resultante de la distancia para realizar un análisis de coordenadas principales (PCoA).
    Nota: Los archivos de script y mapeo de proceso de datos se suministran como material complementario (Material complementario 1 y 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figura 1muestra una ilustración esquemática del protocolo.

Forma prospectiva hemos recogido muestras de heces de pacientes hospitalizados con diarrea infecciosa sospechada. Las muestras fueron sometidas al laboratorio de microbiología clínica en el Sheba Medical Center entre febrero y mayo de 2015, como fue descrito previamente1. Muestras de heces fueron sometidas a cultivo microbiológico convencionales realizadas en el laboratorio de microbiología clínica y a amplia gama alto rendimiento 16S-seq en paralelo. Además, las muestras de heces de los adultos sanos fueron ordenadas para la comparación.

En este análisis, el foco estaba en el control de calidad de los datos y mostrar resultados representativos de la producción obtenida de QIIME217. Inicialmente, se revisaron resultados de secuenciación en 6 muestras control negativo para control de calidad incluyendo: i) PCR sin plantilla, ii) PCR en hisopos limpios y estériles en la solución de extracción y dilución y iii) PCR en extracción de mezcla y dilución soluciones. Tabla 2 se muestra que todas las muestras control negativo tenían ≤118 total Lee (promedio de 29 secuencias), sobre todo de los taxa de Mycoplasma, mientras que el resto de las muestras analizada mostró media total Lee de 10622.57 (error estándar de ±1211.34) y no leyó micoplasma pasado el control de calidad de las muestras principales.

Como controles positivos se utilizaron dieciséis muestras cada uno originó de la misma muestra de heces que pasó a través de la preparación de la biblioteca diferentes con las cartillas diferentes barras inversas. Las 16 muestras incluyen 8 con cultivos positivos para Campylobacter, Salmonellao Shigella que fueron reportados por el laboratorio de microbiología clínica y 8 que fueron registrados como teniendo cultivos negativos. Una parcela de área en el nivel de phyla se muestra en la figura 2. Las muestras que se originaron de la misma muestra de heces pero fueron a través de la preparación de diferentes biblioteca con cebadores diferentes barras inversas muestran abundancia relativa muy consistente (prueba de Mantel entre duplicados de nivel abundancia relativa taxonómica phylum valores simularon p-valor = 1 x 10-04 basado en 9999 repeticiones).

Análisis de coordenadas principales (PCoA), que reduce la dimensionalidad de los datos de entrada, se utilizó la matriz UniFrac para explorar visualmente la similitud y la separación de la muestra. En la Figura 3A, se colorean muestras secuenciadas que se originaron de la misma muestra de heces original pero fueron a través de la preparación de la biblioteca diferentes la misma. De hecho, son situados relativamente cerca en la trama de PCoA (prueba de Mantel entre duplicados PC1 PC2 valores simulado p-valor = 1e-04 basado en 9999 repeticiones). Además, la distancia de diversidad beta medio unweighted unifrac entre muestras en este estudio es 0.706, mientras que la distancia promedio entre dos duplicados es 0.235 (Wilcoxon rank sum test p-valor = 4.205 x 10-11). Curiosamente, las muestras que fueron de cultivo positivo para enteropatógenos Campylobacter, Salmonellao Shigella mostraron valores significativamente diferentes de la PC1 (Wilcoxon rank sum test valor de p = 0.011) en comparación con las muestras con resultados negativos de la cultura. Figura 3B muestra la misma trama de PCoA pero ahora las muestras son coloreadas por la abundancia relativa de proteobacterias. Muestras con alta abundancia de proteobacterias tuvieron valores significativamente diferentes de la PC1 (correlación de Spearman r =-0.533, p-value = 0.000975). Estos resultados son consistentes con análisis previo de los datos, donde pacientes hospitalizados tienen profunda aumenta en taxa de proteobacterias phylum1. Aquí mostramos que PC1 está correlacionado con la abundancia de Proteobacteria, con muestras positivas de cultura clustering sobre todo a un lado de las PC1 eje y cultura muestras negativas clustering sobre todo en el otro lado, junto con las muestras saludables.

Figure 1
Figura 1 : Diagrama de flujo de muestras de heces a la relativa abundancia microbiana. 1) manejo de la muestra: izquierda, muestras de heces se recogen en un tubo de hisopo estéril. Derecha, el tamaño de palo del hisopo se ajusta por corte para permitir el cierre del tubo de 2ml y almacenamiento de información. 2) la extracción de ADN: ADN se extrae por acercamiento libre de columnas PCR directo. 3) preparación de biblioteca: a la izquierda, 4 μL del ADN extraído se amplifica con las cartillas de avance/reversa-índice. Cada cebador reverso contiene un código de barras base 12. Se amplifica cada muestra por triplicado. Una placa de 96 pocillos contiene 32 códigos de barras diferentes. A la derecha, combinar cada código de barras por triplicado en un tubo de volumen único. Una placa de 96 pocillos contiene 96 códigos de barras diferentes. 4) cuantificación de la biblioteca: panel superior, detección de muestras positivas, amplicones fueron detectados en gel de agarosa 1% teñido de bromuro de etidio. Inferior de cuantificación de los amplicones positivo para alcanzar concentración equimolar de 500 productos de ng de cada muestra en una piscina única biblioteca. 5) purificación de biblioteca: panel superior, la biblioteca combinada es gel extraído para selección del tamaño y la purificación. Panel inferior, el tamaño exacto de la biblioteca y la concentración se mide. 6) secuenciación: secuenciación de alto rendimiento de la biblioteca combinada. 7) los datos de la secuencia es analizados por una tubería de bioinformática para 16S rRNA amplicon ecología microbiana. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Abundancia relativa consistente entre las muestras que se originó de la misma muestra de heces pero fue a través de la preparación de la biblioteca diferentes. Abundancia relativa taxonómica a nivel de phylum se muestra por muestra como se indica. Se muestra la abundancia relativa para 16 muestras fecales obtenidas de pacientes hospitalizados con diarrea infecciosa sospecha que cada uno pasó a través de la preparación de la biblioteca diferentes (duplicado 1 y 2) con las cartillas diferentes barras inversas y de controles sanos 3. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Diversidad filogenética muestran resultados consistentes para las muestras que se originaron de la misma muestra de heces pero fueron a través de la preparación de la biblioteca diferentes. Análisis de coordenadas principales (PCoA) que reduce la dimensionalidad de los datos de entrada se utilizan en la matriz UniFrac para explorar visualmente la similitud y la separación de la muestra. La distancia entre dos muestras representa la diferencia en la composición del microbioma. (A) Unweighted UniFrac PCoA parcela. Cada punto representa una muestra secuencial. Muestras que se originó de la misma muestra de heces original se colorean igual. Muestras de pacientes hospitalizados con coprocultivo positivo reportado por la microbiología clínica1 están marcadas por los cuadrados, pacientes hospitalizados con cultivo negativo en los triángulos1y adultos sanos de un funcionamiento independiente de la secuencia1 están marcados con lleno en los círculos. (B) mismo PCoA como en A, pero las muestras son coloreadas ahora por su abundancia relativa de proteobacterias, tal como se indica. Haga clic aquí para ver una versión más grande de esta figura.

Nombre de la cartilla Secuencia de primer Descripción de la cartilla
Primer avance AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' secuencia del adaptador - adelante cojín cartilla - adelante vinculador de cartilla - primer avance
Primer índice inverso CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Revertir el complemento de 3' adaptador secuencia - código de barras de Golay - cartilla reversa pad - cartilla reversa linker - inversa primer
Cartilla de lectura 1 secuenciación TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Adelante cojín cartilla - adelante a vinculador de cartilla - primer avance
Cartilla de la secuencia de lectura 2 AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Inversa inversa cartilla de primer pad - cartilla reversa linker-
Índice secuencia cartilla ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Complemento reverso de complemento reverso de cartilla reversa - complemento reverso de vinculador cartilla reversa - de almohadilla cartilla reversa

Tabla 1: Lista de cartilla.

Muestra Número de lecturas post
control de calidad inicial en
QIIME
PCR en hisopos limpios en la solución de extracción y dilución -1 118
PCR en hisopos limpios en la solución de extracción y dilución -2 39
PCR sin plantilla -1 0
PCR sin plantilla -2 0
PCR en extracción y dilución soluciones mix - 1 16
PCR en extracción y dilución soluciones mix - 2 0
Muestras (media ± error de estándar) 10622.57 ± 1211.34

Tabla 2: Número de lecturas de controles negativos y para muestras de heces.

Material complementario 1: script de procesamiento de datos Haga clic aquí para descargar este archivo.

Material complementario 2: asignación de archivo. Haga clic aquí para descargar este archivo.

Material complementario 3: esquema de la cartilla. Haga clic aquí para descargar este archivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16S rRNA-amplicones y metagenómica escopeta secuenciación han ganado popularidad en microbiología clínica aplicaciones21,22,23. Estas técnicas son ventajosas en su mayor capacidad para capturar taxa cultivables y no cultivables, proporcionando datos sobre la abundancia relativa de inóculo patógeno y su capacidad para identificar más precisamente un polimicrobial infecciosa 24de la huella digital. Los avances en el campo de la investigación microbioma han generado grandes cantidades de datos que no son fácilmente comparables debido a la falta de consistencia en los diferentes enfoques. En los últimos años, varios consorcios han intentado abordar algunos de estos temas. Este protocolo sigue preparación similar de la biblioteca como el proyecto del microbioma de la tierra (EMP). Sin embargo, ha añadido es un protocolo detallado paso a paso para la extracción de ADN de muestras fecales a través de tubería de análisis.

Previamente, secuenciación de ARNr 16S se ha utilizado para caracterizar los patrones de la composición microbiana de muestras fecales de individuos no hospitalizados sanos y de pacientes hospitalizados con diarrea infecciosa sospechada y resultados de los cultivos tradicionales. Los resultados de ese análisis demostraron que los pacientes hospitalizados tienen profunda aumenta en taxa de proteobacterias phylum1. Se describe aquí es un protocolo integrado de métodos ampliamente usados para 16S rRNA gene amplicon ordena usando el PCR libre de columnas el acercamiento directo que fue diseñado originalmente para la extracción de la planta DNA16. Este enfoque puede eficientemente y extraer rápidamente bibliotecas de DNA amplificada de buena calidad dirigidos a la región variable V4 del gene del rRNA 16S de un gran número de muestras adecuados para la secuenciación de rRNA 16S de alto rendimiento.

Como se trata de un método de secuenciación de ADN, se obtienen datos sobre comunidades microbianas tanto aerobios como anaerobios presentes en una muestra fecal individual. El protocolo había adoptado los iniciadores que fueron originalmente diseñados15 contra la región V4 del gene del rRNA 16S. Lo importante es la cartilla de amplificación inversa contienen una secuencia de código de barras base doce que apoya la puesta en común de hasta 2.167 muestras diferentes en cada carril15. El primer avance de amplificación incluye nueve extras bases en la región de adaptador que apoyan la secuencia final emparejados en la secuencia de la plataforma25 (tabla 1 y 3 Material complementario). Este enfoque permitida manejar una biblioteca compuesta de 250 muestras de heces que fueron ordenadas en un carril con una profundidad corriente de 10622,57 ± 1211,34 (media ± error de estándar) lecturas por muestra a un costo de 30 dólares por muestra.

Para asegurar el control de calidad, se sugiere utilizar los siguientes controles negativos; i) PCR sin la plantilla de la DNA, ii) PCR sobre ADN extraído de una torunda limpia estéril y iii) PCR en mezcla solución de extracción y dilución. En cuanto a los controles positivos, se recomiendan muestras que originó de la misma muestra de heces, pero fue a través de elaboración de la biblioteca diferentes cartillas diferentes barras inversas y las muestras de carreras anteriores como control de calidad interno. De nota, otros controles positivos opcionales que se utilizará son los estándares de medición de microbioma proporcionados por NIST. La media lee la cobertura de los controles negativos es notablemente inferior en comparación con las muestras de taburete real (tabla 1) y fue compuesta sobre todo de los taxa de Mycoplasma. Además mostramos la consistencia de los resultados de la secuencia obtenida con las muestras que cada uno originó de la misma materia fecal, pero que pasó a través de la preparación de la biblioteca diferentes (figura 3). Este resultado también confirma que, cuando se utiliza el método integrado, no existe ninguna contaminación cruzada entre muestras.

En este protocolo se introduce un protocolo integrado de uniformados, factible para analizar gran número de muestras. Este protocolo tiene como objetivo guiar a científicos interesados en iniciar el uso de productos de rRNA 16S que ordena de manera robusta, reproductiva, fácil de usar, barata, detalle de colección fecal para análisis de datos, utilizando controles importantes. Usando este protocolo estandarizado de guía detallada, puede minimizar efectos por lotes y permite resultados de secuenciación más comparables entre diferentes laboratorios.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado en parte por el programa I-CORE (convocatoria nº 41/11), el Israel Science Foundation (grant no. 908/15) y la Europea de Crohn y Colitis organización (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Protocolo guía para caracterización microbiana Fecal por secuencia de 16S rRNA-productos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter