Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Сотовый агрегации анализов для оценки привязки дрозофилы паз с транс-лигандов и его ингибирование СНГ-лигандами

doi: 10.3791/56919 Published: January 2, 2018

Summary

Сложность систем в естественных условиях делает его трудно отличить активации и торможения рецептора Notch транс- и СНГ-лигандов, соответственно. Здесь мы представляем протокол, основанный на в пробирке клеток агрегации анализов для качественного и полуколичественного оценки привязки дрозофилы Notch транс-лигандов против СНГ-лигандами.

Abstract

Вырезка сигнализации является эволюционно сохранены ячеек системы связи, широко используется в развития животных и взрослых обслуживания. Взаимодействие рецептора Notch с лигандами из соседних клеток вызывает активацию сигнальный путь (транс-активации), в то время как взаимодействие с лигандами из той же клетке подавляет сигнализации (СНГ-торможение). Надлежащий баланс между транс-Активация и СНГ-ингибирование помогает создавать оптимальные уровни Notch сигнализации в некоторых контекстах во время развития животных. Из-за перекрывающихся выражений домены Notch и его лигандов во многих типах клеток и существование механизмов обратной связи, изучению влияния данного столб-поступательные изменения на транс- против СНГ-взаимодействий выемки и его лигандов в естественных условиях трудно. Здесь мы описываем протокол для использования дрозофилы S2 клеток в клетки агрегации анализов для оценки последствий стучать вниз паз путь модификатор в привязке паз для каждого лиганда в транс и в СНГ. S2 клетки стабильно или временно transfected с Notch выражая вектора смешиваются с клетками, выражая каждый паз лиганда (S2-Дельта или зазубренными S2). Транс-связывание рецептора и лигандами приводит к образованию агрегатов гетеротипичной клеток и измеряется количество агрегатов на мл, состоящий из > 6 клеток. Для изучения тормозящий эффект СНГ-лигандов, S2 клетки совместно выражая Notch и каждого лиганда смешиваются с S2-Дельта или S2-зазубренными клеток и количество агрегатов количественно как описано выше. Относительное сокращение числа агрегатов благодаря наличию СНГ-лигандов представляет собой меру СНГ-лиганд-опосредованной ингибирование транс-привязки. Эти просто анализов может обеспечить полу количественные данные о воздействии генетических или фармакологических манипуляций в привязке выемки его лигандов и может помочь расшифровка молекулярные механизмы, лежащие в основе в естественных условиях эффекты Подобные манипуляции на выемку сигнализации.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Канонические Notch сигнализации является механизм ближней связи к ячейке, который требует физический контакт соседних клеток для облегчения взаимодействия между Notch рецепторов и их лиганды1. Взаимодействие с лигандами рецептора Notch (присутствует на поверхности клеток приема сигнала) (на поверхности отправки сигнала клетки) инициирует Notch сигнализации и известен как транс-активации2. С другой стороны, взаимодействие между Notch и его лигандов в той же ячейке приводит к ингибированию Notch путь и известен как СНГ-ингибирование3. Баланс между транс- и СНГ-взаимодействий необходим для обеспечения оптимальной лиганд зависимых Notch сигнализации4. Дрозофилы имеет один рецептора Notch и два лигандами (Дельта и Серрате) в отличие от млекопитающих, которые имеют четыре Notch рецепторов и пять лигандов [зубчатые 1 (JAG1), JAG2, 1 (DLL1), Дельта как DLL3 и DLL4]5. Имея это простота, дрозофилы модель предлагает простота учиться анализировать/эффекты модификаторы пути на паз лиганд взаимодействий и впоследствии Notch сигнализации. В некоторых контекстах во время развития животных (включая развитие крыла у дрозофилы), СНГ- и транс-взаимодействий участвуют для достижения надлежащего Notch сигнализации и клеточной судьба1,6 . Важно различать воздействия Notch путь модификаторов в этих контекстах на СНГ- против транс-взаимодействий паз с ее лигандами.

Наша группа ранее сообщалось, что добавление углеводный остаток, называется Ксилоза дрозофилы Notch отрицательно регулирует Notch сигнализации в определенных контекстах, включая крыло развития7. Потеря Шамс (фермента, xylosylates выемка) приводит к фенотип «потеря крыла вен»7. Совсем недавно гена дозировка экспериментов и клоновых анализа были использованы для показать, что потеря Шамс повышает выделение Дельта опосредованной Notch. Чтобы отличить ли расширение сигнализации паз в мутантов Шамс является результатом снижения СНГ-ингибирование или увеличение транс-активации, внематочная гиперэкспрессия исследования Notch лигандов в личиночной крыла имагинальных дисков с помощью dpp-GAL4 драйвера были исполнены. Эти эксперименты представила доказательства о том, что Шамс регулирует транс-активация Notch Дельта не затрагивая Notch СНГ-ингибирование лигандов8. Однако, обратной связи правила и эффекты эндогенного лиганда может усложнить толкование внематочная гиперэкспрессия исследования1,6,9.

Для решения этой проблемы, дрозофила S2 клетки10 были использованы, которые обеспечивают простой в vitro системы паз лиганд взаимодействия исследования11,12. S2 клетки не выразить эндогенного рецептора Notch и Дельта лигандом11 и Экспресс низкий уровень зубчатыми13, которая не влияет на паз лиганд агрегации эксперименты8. Таким образом S2 клетки могут стабильно или временно transfected Notch и/или отдельных лигандами (Дельта или Серрате) для генерации клеток, которые исключительно Экспресс рецептора Notch или один из его лигандов, или их комбинации. Смешивание Notch выражая S2 клеток с лигандом выражая S2 клеток приводит к образованию гетеротипичной агрегатов, при посредничестве рецептор лиганд привязки11,12,14. Количественная оценка совокупного образования представляет собой меру транс-привязки между Notch и его лигандов15 (рис. 1). Аналогичным образом, S2 клетки могут быть совместно transfected с Notch и Дельта или Серрате лигандами (т.е. СНГ-лигандами). СНГ-лигандов в этих клетках Notch выражая S2 отменить привязку паз с транс-лигандов и результат в снижение совокупного формирования8,12,14. Относительное уменьшение совокупного формирования, вызванных СНГ-лигандов представляет собой меру тормозящий эффект СНГ-лигандов на привязку между Notch и транс-лигандами (рис. 2). Соответственно, анализов агрегации клеток были использованы для изучения влияния потери xylosylation на транс- и СНГ-взаимодействий между Notch и его лигандами.

Здесь мы представляем подробный протокол для анализов агрегации клеток, направленных для оценки привязки паз с транс-лигандов и его ингибирование СНГ-лигандов с использованием дрозофилы S2 клеток. В качестве примера, мы предоставляем данные, которые позволили нам определить эффект xylosylation паз на привязку между Notch и транс-Дельта8. Эти просто анализы полуколичественного оценку Notch лиганд взаимодействий в пробирке и помочь определить молекулярные механизмы, лежащие в основе эффекты в vivo Notch путь модификаторов.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Подготовка двойной мель РНК (dsRNA) Шамс нокдаун

  1. Амплификации PCR продукции
    1. Используйте одичал тип Желтый Белый (y w) геномной ДНК и pAc5.1-EGFP как шаблон и следующие пары праймера для того чтобы усилить фрагментов ДНК используется в синтезе двуцепочечной ДНК. Используйте следующие ПЦР теплового профиля: денатурация (95 ° C, 30 s), отжига (58 ° C, 30 s) и расширения (72 ° C, 1 мин).
      Более Зеленый флуоресцирующий белок Праймеры двуцепочечной ДНК (EGFP) (5' - 3')-
      Форвард грунт GAAATTAATACGACTCACTATAGGGGGTGAGCAAGGGCGAGGAG
      Обратный грунт GAAATTAATACGACTCACTATAGGGGGTCTTTGCTCAGGGCGG
      Шамс dsRNA грунтовки (5' - 3')-
      Форвард грунт TTAATACGACTCACTATAGGGGAGATGCTGTATGTGGACACGGAT
      Обратный грунт TTAATACGACTCACTATAGGGGAGATCCGTGGATAACCTTAACGA
      Примечание: EGFP двуцепочечной ДНК используется в качестве отрицательного контроля.
  2. Гель очищайте и полимеразной цепной реакции (ПЦР) продуктов с использованием коммерческих гель комплект очистки согласно протоколу от производителя.
  3. Выполните в vitro транскрипция с помощью коммерческий продукт, способный транскрипции от промоутера T7 согласно протоколу от производителя.
  4. Очистить двуцепочечной ДНК с помощью РНК очистка kit по данным производителя протокол и хранить при температуре-80 ° C.
  5. Оценить эффективность Шамс нокдаун, используя следующие шаги (1.5.1-1.5.5).
    1. Счетчик клеток, вручную с помощью Горяева и плита 5 x 105 S2 клеток в каждой скважине 6 хорошо пластины в 1 мл/хорошо Шнейдера среднего дополнена 10% плода Bovine сыворотки (ФБС) и 100 ед/мл пенициллин-стрептомицином.
    2. Добавить 7.5 мкг EGFP- или Шамс двуцепочечной ДНК в каждой скважине и Инкубируйте на 25 ° C в течение 24 ч.
    3. Урожай управления (EGFP двуцепочечной ДНК лечение) и Шамс двуцепочечной ДНК лечение S2 клетки, нежный закупорить следуют грануляции вниз центрифугированием на 1000 x g 5 мин при 25 ° C и процесс для изоляции РНК с помощью РНК добыча комплект согласно Протокол от производителя.
    4. Количественного определения РНК с помощью спектрофотометра и процесс 100 нг РНК для 1-шаг qRT ПЦР с использованием коммерческих ПЦР реактивы и грунт/датчики и следующие ПЦР теплового профиля: денатурация (95 ° C, 15 s) и отжиг/расширение (60 ° C, 1 мин).
      Примечание: Смотрите Таблицу материалов для получения информации о грунт/зонд наборы и инструмент, используемый для экспериментов qRT ПЦР -Шамс и управления в этих исследованиях.
    5. Вычислите с помощью 2ΔΔCT метод16уровни mRNA относительной Шамс .

2. Оценка связывание рецептора Notch и транс-лигандами

  1. Подготовка приема сигнала клетки (S2 выражая рецептора Notch).
    1. Подсчет количества ячеек, вручную с помощью Горяева и Клемная 5 x 105 S2 и стабильной S2-Notch клеток в каждой скважине 6-ну пластины в 1 мл/хорошо Шнейдера среднего дополнена 10% FBS и 100 ед/мл пенициллин-стрептомицином.
      Примечание: Для S2-Notch клеток, которые доступны из центра ресурсов геномики дрозофилы (НАУЧНЫМ), добавьте 200 Нм метотрексата в средствах массовой информации. Чтобы подготовить метотрексат раствор 0,5 мм, сначала Подготовьте 20 мм метотрексат раствор в 250 мкл 1 M NaOH. Далее Разбавьте это решение до 0,5 мм в 1 М фосфатный буфер и хранить при температуре от-20 ° C. В клетках S2-паз экспрессия белка Notch находится под контролем промотора металлотионеина дрозофила в векторе ПЛТ .
    2. Добавить 7.5 мкг двуцепочечной ДНК в каждой скважине и Инкубируйте на 25 ° C в течение 24 ч.
    3. Добавление 0,7 мм4 CuSO побудить выражение Notch и инкубировать при 25 ° C в течение 3 дней.
      Примечание: CuSO4 используется для вызывают экспрессию белков контролируется металлотионеина промоутер.
  2. Подготовьте отправки сигнала клетки (клетки S2 выражая Дельта или Серрате лигандами).
    1. Подсчет количества ячеек, вручную с помощью Горяева и пластины ~ 5 x 106 стабильной S2-Дельта или S2-зазубреннымиTom клеток в каждой скважине 6-ну плиты в 1 мл/хорошо Шнейдера среды дополняется 10% FBS и 100 ед/мл пенициллин-стрептомицином.
      Примечание: Добавьте 200 Нм метотрексата для S2-Дельта клетки и 100 мкг/мл hygromycin для S2-зазубреннымитомом клетки в средствах массовой информации. Выражение Delta и зубчатымиTom— помидор меткой, функциональная версия зубчатыми12— под дрозофилы металлотионеина промоутер в векторе ПЛТ .
    2. Добавление 0,7 мм4 CuSO побудить выражение лигандов и инкубировать при 25 ° C в течение 3 ч.
  3. Выполните агрегирование между сигнал отправки и приема сигнала клетки.
    1. Урожай двуцепочечной ДНК лечение S2 (управления) и S2-Notch клетки нежный закупорить и пластины 2,5 x 105 клеток/хорошо в пластине 24-Ну после ручного подсчета Горяева.
    2. Добавить 5 x 105 стабильной S2-Дельта или S2-зазубреннымитомом клетки в общем объеме 200 мкл Шнейдера среды (дополнено с 10% FBS и 100 ед/мл пенициллин-стрептомицином).
      Примечание: Все клетки S2, обработка (включая покрытие, индукция и dsRNA лечение) было сделано под биобезопасности кабинета.
    3. Место пластину на орбитальный шейкер на 150 об/мин (942.48 rad/мин).
    4. После 1 мин смешать содержимое каждой скважины и вывезти 20 мкл для подсчета количества агрегатов.
      1. Одновременно принимать образ представителя под Перевернутый составной микроскоп с использованием 10 крат (PLL цель 10/0,25).
      2. Вручную количество агрегатов (> 6 ячеек) с использованием Горяева.
    5. Место пластину в шейкере.
    6. Повторите захвата изображений и подсчета после 5 минут и 15 минут агрегации.
  4. Выполняют количественной оценки транс-привязки.
    1. Рассчитайте количество агрегатов на мл между S2 клетки и клетки, S2-Дельта или S2-зазубреннымиTom как фон элемента управления.
    2. Рассчитать количество агрегатов на мл между S2-паз и S2-Дельта или S2-зазубреннымитомом клетки (масштабы транс-привязка).

3.Оценка ингибирование Binding между Notch и транс-лигандов СНГ-лигандами

  1. Подготовка клетки приема сигнала.
    1. Клемная 5 x 105 S2 клеток в каждой скважине 6-ну пластины в 1 мл/хорошо Шнейдера среднего дополнена 10% FBS и 100 ед/мл пенициллин-стрептомицином.
    2. Добавить 7.5 мкг двуцепочечной ДНК в каждой скважине и Инкубируйте на 25 ° C в течение 24 ч.
    3. Совместно transfect двуцепочечной ДНК лечение клетки с pBluescript и ПМТ паз11 (НАУЧНЫМ) самостоятельно или с pMT-Notch и ПМТ Дельта-11 (НАУЧНЫМ) или Зазубренными ПЛТдля всего17 Концентрация ДНК 2 мкг/скважины с использованием коммерческих трансфекции реагент согласно протоколу от производителя.
      Примечание: pBluescript используется как элемент управления. Совместно transfected клеток будет называться S2-паз & Deltaпереходных или S2-паз & далее зазубреннымипереходных клеток.
    4. Инкубируйте временно transfected клеток S2 при 25 ° C в течение 24 ч.
    5. Добавление 0,7 мм4 CuSO побудить выражение Notch и лигандами и инкубировать при 25 ° C в течение 3 дней.
  2. Подготовьте отправки сигнала клетки, как описано в 2.2.
  3. Выполните агрегирование между сигнал отправки и приема сигнала клетки, как описано в разделе 2.3.
  4. Количественно ингибирование транс-привязка по СНГ-лигандами.
    1. Рассчитайте количество агрегатов на мл между S2 клетки и клетки, S2-Дельта или зазубренными S2 как фон элемента управления.
    2. Количественно оценить масштабы ингибирование СНГ-лигандов следующим образом.
      1. Определите A как количество агрегатов между S2-Notchпереходных и S2-Дельта клетки.
      2. Определить B как количество агрегатов между ячейками S2 временно совместно transfected с Notch и Дельта (S2-паз & Deltaпереходных) и S2-Дельта клетки.
      3. Рассчитать относительный агрегации C = (B x 100) /A
      4. Рассчитать величину торможения по СНГ- лиганда (Дельта или Серрате) 100- C.
        Примечание: в качестве примера, если относительная агрегации 45%, то СНГ-лигандов считаются подавляют транс-привязки на 55%.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Наши замечания в естественных условиях предложил увеличить потерю результатов Шамс гена xylosyltransferase в прирост Notch сигнализации Дельта опосредованной транс-активация паз не затрагивая СНГ-ингибирование Паз на лигандов8. Чтобы проверить это понятие, были исполнены в пробирке клеток статистических анализов. Во-первых Шамс выражение в клетках S2 был сбит с помощью Шамс двуцепочечной ДНК. EGFP двуцепочечной ДНК был использован как элемент управления. Эффективность нокдаун (KD) был рассмотрен ПЦР в реальном времени и было показано, превышать 80%8. Затем, связывание рецептора Notch с транс-Дельта по Шамс KD рассматривался с помощью статистических анализов. Агрегирование между S2-Notch и S2-Дельта клетки был рассмотрен в различные моменты времени после их смешивания. Агрегирование между простой S2 клетки и клетки, S2-Дельта была сделана как фон элемента управления. Рисунок 3 показывает график, указывающий количество агрегатов формируется в различных время очков (1, 5, 15 и 30 мин) после смешивания. Резкое увеличение было отмечено в количество агрегатов между 1 и 5 минут после этого, количество агрегатов, продолжает увеличиваться до 30 мин и более медленными темпами. Таким образом совокупный формирования было imaged в 1, 5 и 15 мин и количество агрегатов была количественно после 5 минут перемешивания.

На рисунке 4A показывает представитель изображения клетки статистических анализов между стабильным S2-Notch и S2-Дельта клетки для оценки последствий Шамс KD на связывание рецептора Notch и транс-Дельта. Изображения показывают агрегирование на три времени точек (1, 5 и 15 мин). Для фона элемента управления равнина S2 клетки (лечение с Шамс dsRNA) были смешаны с S2-Дельта клеток. EGFP двуцепочечной ДНК лечение S2-Notch клетки образуется агрегатов с S2-Дельта клеток, что увеличение числа с течением времени. Напротив Шамс двуцепочечной ДНК лечение S2-Notch клетки быстрее образуется агрегатов и агрегатов были больше и больше чем контрольными (рис. 4B). Это свидетельствует, что снижение уровня Шамс повышает транс-связывание паз с Delta8.

Для изучения ли Шамс регулирует тормозящий эффект СНГ-лигандов на привязку между Notch и транс-Дельта, мы впервые установили что Сопредседатель выражение Notch и Дельта в приема сигнала клеток может привести к снижению агрегации клеток посредничестве Notch и транс-Дельта. Рисунок 5A показывает график, указывающий количество агрегатов, образуются между S2-Дельта и S2-паз & Deltaпереходных клеток с различным количеством СНГ-Дельта. Transfecting равное количество конструкций Notch - и Дельта выражение в S2 клетки резко уменьшается количество агрегатов, образуются между эти клетки и клетки, S2-Дельта. Кроме того, уменьшается количество СНГ-Дельта приводит к увеличению числа агрегатов, указывая, что в диапазоне паз /СНГ-Дельта коэффициенты, используемые в этих анализов, СНГ-Дельта может ингибировать привязку между Notch и транс-Дельта в зависимости от дозировки. После S2-паз &переходные клетки Дельта Экспресс Notch и Дельта, они могут образовывать агрегаты homotypic независимо от клеток S2-Дельта. Для изучения если формирование homotypic агрегатов среди S2-паз & Deltaпереходные клетки может быть смешанным фактором в СНГ-ингибирование показано на рисунке 5А, мы смешивать эти клетки с S2 клеток и количественно агрегатов. Рисунок 5B показывает количество агрегатов, образовавшихся после смешивания S2 клетки с S2-паз & Deltaпереходных клеток выразить различные паз /СНГ-соотношения Дельта. Было отмечено весьма небольшое количество homotypic агрегатов по сравнению с гетеротипичной агрегатов, как показано на рисунке 5А . Мы заключаем, что эти анализы агрегации точно измерить эффект СНГ-Дельта на привязку между Notch и транс-Дельта.

Далее мы исследовали эффект Шамс KD на тормозной способности СНГ-Дельта. Этот конец, агрегации между S2-Дельта и S2-паз & Deltaпереходных клеток был рассмотрен. Рисунок 6A показывает представитель изображения комплексирования между S2-Дельта клетки и S2-Notchпереходные (управления) или S2-паз & Deltaпереходных клеток. S2-Дельта и EGFP двуцепочечной ДНК лечение S2-Notchпереходные клетки образуется агрегатов, которые увеличивают число со временем, подобный к агрегации между S2-Дельта и стабильной S2-Notch клеток (рис. 4). Примечательно, смешивая S2-Дельта и S2-паз & Deltaпереходные клетки совместно transfected с равное количество плазмидов Notch - и Дельта выражение образуется меньше агрегатов EGFP KD и Шамс KD, предполагая, что уменьшение уровень Шамс не влияет на способность стран СНГ-Дельта блокировать паз /транс-Дельта привязки. Чтобы лучше оценить последствия Шамс KD на деятельности СНГ-Дельта, величина торможения по СНГ-Дельта была измерена путем расчета относительной агрегации процент за насечку круга /СНГ-Дельта коэффициенты, как описано в разделе 3.4.2. Количественная оценка относительной агрегации показал сопоставимых Торможение агрегации после лечения dsRNA EGFP и Шамс (Рисунок 6B). Вместе, эти наблюдения сильно предполагают, что потеря xylosylation способствует транс-привязка не затрагивая СНГ-ингибирование8и обеспечивают молекулярный механизм для крыла вен потери фенотип наблюдается в Шамс мутантов.

Figure 1
Рисунок 1: Схематическое представление Assay клетки агрегации для транс-привязки. Диаграмма, показывающая индукции рецептор (S2-паз) и лигандом (S2-Дельта или зазубренными S2) выражая S2 клетки от 0,7 мм CuSO4. Индукции клетки обеих S2 следуют смешивания, которая стремится сделать агрегатов. Эти агрегаты (> 6 клеток) образы и количественно.Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Схематическое изображение Assay клетки агрегации для оценки СНГ-ингибирование. S2 клетки были временно transfected с pMT-Notch (S2-Nпереходных), pMT-Notch и ПМТ Дельта (S2-паз & Deltaпереходных), или ПМТ паз и ПМТ зазубренными (S2-паз & Зубчатымипереходных). После индукции 0,7 мм CuSO4 и смешивания с S2-Дельта клетки, агрегаты (> 6 клеток) количественно. Ингибирование СНГ-лигандов измеряется в терминах процент относительной агрегации в присутствии и отсутствии каждого СНГ-лиганд. Эффекты СНГ-лигандов на привязку между Notch и транс-зубчатыми может определяться путем смешивания временно transfected клеток с зазубренными S2томом клетки (не показан). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: агрегации между S2-паз и S2 или S2-Дельта клетки в различные моменты времени. График показывает количество агрегатов на мл в точках (1, 5, 15 и 30 мин) разное время между указанных типов клеток. Планки погрешностей указывают Среднеквадратичная ошибка среднего значения (SEM) три реплицирует. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: Клетки агрегации посредничестве Notch и транс-Дельта. (A) изображения показывают агрегации в разное время очков (1, 5 и 15 мин). Агрегирование между Шамс двуцепочечной ДНК лечение простой S2 клетки и клетки, S2-Дельта была сделана как фон элемента управления. Шамс- dsRNA лечение S2-Notch клетки показывают увеличение числа и размера агрегатов по сравнению с EGFP двуцепочечной ДНК лечение (управления) S2-Notch клетки после смешивания с S2-Дельта клеток. Шкалы бар = 100 µm. Количественная оценка (B) количество клеток агрегатов больше чем 6 клеток после 5 минут агрегации. Планки погрешностей указывают SEM. * P < 0,01 (односторонним дисперсионный анализ (ANOVA)). Были проведены три реплицирует с тремя независимыми повторяется. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: СНГ-Дельта подавляет ячеек совокупные формирования опосредовано Notch и транс-Дельта в зависимости от дозировки. (A) граф показывает агрегации (с точки зрения количества агрегатов/мл) между S2-Дельта клетки и клетки S2 временно transfected с различных соотношениях векторы выражения для Notch и СНГ-Дельта (1:0, 1:1, 1:0. 5, 1:0.2 и 1:0. 1). Планки погрешностей указывают SEM. * P < 0,01 (односторонним ANOVA). Были проведены три реплицирует с тремя независимыми повторяется. Обратите внимание, что снижение уровня СНГ-Дельта приводит к увеличению в агрегате, вероятно из-за снижения СНГ-ингибирование. (B) график, показывающий homotypic агрегации (с точки зрения количества агрегатов / мл) в клетках S2 временно transfected с различных соотношениях Notch и Дельта (1:0, 1:1, 1:0. 5, 1:0.2 и 1:0. 1) и смешанные с простой S2 клеток. Планки погрешностей указывают SEM. количество агрегатов гораздо меньше, чем количество гетеротипичной агрегатов, образуются между S2-Дельта и S2-паз & Deltaпереходных клеток. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: Нокдаун Шамс не влияет на ингибиторная активность СНГ-Дельта. Показано на рисунке (A) являются представителя изображения эффект Шамс KD на СНГ-Дельта-опосредованной Торможение агрегации клеток при посредничестве паз /транс-Дельта привязки. Изображения показывают агрегации в разное время очков (1, 5 и 15 мин). Агрегирование между Шамс двуцепочечной ДНК лечение простой S2 клетки и клетки, S2-Дельта была сделана как фон элемента управления. Похож на стабильно transfected S2-Notch клетки, Шамс KD увеличилось количество агрегатов между S2-Дельта и S2-Notchпереходных клеток по сравнению с контролем (EGFP двуцепочечной ДНК лечение). Совместное выражение СНГ-Дельта с насечкой в соотношении 1:1 привели к сопоставимых снижение количество агрегатов управления (EGFP двуцепочечной ДНК лечение) также как и Шамс лечение двуцепочечной ДНК клетки. Шкалы бар = 100 µm. (B) график показывает относительную агрегации между S2-Дельта клетки и клетки S2 временно совместно transfected с указанные пропорции (1:0, 1:1, 1:0. 5, 1:0.2 и 1:0. 1) Notch и СНГ-Дельта. EGFP и Шамс dsRNA лечения показывают сопоставимых снижение агрегации на каждый паз /СНГ-Дельта соотношение. Данные, представленные здесь, представитель трех независимых экспериментов. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Канонические Notch сигнализации зависит от взаимодействия между рецептора Notch и его лигандов5. Хотя большинство исследований на пути Notch прежде всего рассмотреть связывание Notch и лигандами в соседних клетках (транс), паз и же элементная лиганды взаимодействуют и эти так называемые СНГ-взаимодействия может играть роль ингибирующее в паз сигнализации3,4. Соответственно чтобы расшифровать механизмы, лежащие в основе воздействия модификатора на канонической паз сигнализации, уместно часто для изучения обоих типов взаимодействий Notch лиганда (транс и СНГ). Однако во многих контекстах во время развития животных, участие обеих этих взаимодействий и их обратной связи регулирование затрудняет в vivo исследований1,6. В настоящем протоколе мы предоставляем подробную методологию для агрегирования в пробирке клеток анализов для оценки связывания рецептора Notch с транс- лигандов и его ингибирование СНГ- с использованием дрозофилы S2 клетки лиганды. Мы представили использования этой методологии для оценки эффекта генетического модификатор Notch сигналов (7,xylosyltransferase Шамс8) на рецептор лиганд привязки.

Во-первых, агрегации анализы были проведены между стабильным S2-Дельта и EGFP или Шамс двуцепочечной ДНК лечение стабильной S2-Notch клетки для изучения влияния Шамс KD на транс-привязки. Агрегация клеток S2-Дельта Шамс двуцепочечной ДНК лечение простой S2 клеток было принято как фон элемента управления. Шамс KD повышение агрегации между S2-паз и S2-Дельта клетки, по сравнению с контролем. Это важно для выполнения фона экспериментального контроля агрегатов между простой S2 клетки и клетки, лиганд нося S2 параллельно с транс-привязка экспериментов. Хотя дрозофилы S2 клетки не выражают эндогенного рецептора Notch и Дельта лигандом11, выражение низких уровней Серрате сообщается в S2 клетки13. Учитывая это простой S2 клетки были использованы в анализов агрегации клеток как фон элемента управления; Эти клетки не показывают каких-либо агрегации (Рисунок 5B). Агрегаты, учитываются вручную с помощью Горяева. Для обеспечения согласованности статистической количественной оценки, 10-20 мкл популяцию смешанных клеток можно накапаны из по крайней мере три разных областей в колодец для подсчета. Эти анализы требуют здоровые клетки растущего S2. Учитывая полу адэрентных характер S2 клетки, нежный, закупорить во время сбора клеток и постоянной тряски в ходе агрегирования assay имеют важное значение.

Ранее мы и другие использовали устоявшихся, растворимые лиганд рецептор привязки анализов для количественной оценки рецептор лиганд привязки в транс17,18,19, 20. Поскольку статистических анализов полуколичественного, растворимые лигандом привязки анализов проводились также изучить влияние Шамс KD на паз лиганд транс-привязки. Наблюдаемые результаты были аналогичные тенденции с результатами, полученными от статистических анализов8. Это свидетельствует о верных оценки привязки паз с транс-лигандов с помощью анализов агрегации клеток. Хотя совокупные формирование индикация рецептор лиганд привязки, он может быть сложной, если поверхности выражение рецептора Notch или его лигандов подвержена данной модификаторы. Это подчеркивает ограничение анализов агрегации клеток, как невозможно отличить, если изменения в совокупных образование из-за измененных рецептор лиганд привязки или поверхности экспрессию. Таким образом параллельно статистических анализов, эффекты каждого модификатора на поверхности выражение Notch и лигандами должен испытываться в клетках S2. В контексте нашего исследования поверхностные уровни Notch и Дельта не были затронуты в Шамс двуцепочечной ДНК лечение S2 клетки8.

Для изучения ингибирование транс-привязка с добавлением СНГ-лигандов, агрегации анализы были проведены между S2-Дельта клетки и EGFP или Шамс двуцепочечной ДНК лечение S2-паз & Deltaпереходных клеток . Количество агрегатов, образуются между эти клетки сравнивали с количество агрегатов, образуются между S2-Дельта клетки и S2-Notchпереходные клетки. Относительное сокращение числа агрегатов рассчитывается и используется в качестве показателя для величина торможения по СНГ-Дельта. Управления эксперименты показали, что СНГ-лигандов Показать надежные и дозировка зависимой ингибирование выемки /транс-Дельта привязки над довольно широкий диапазон паз для СНГ-лиганда показателей (1:1-1:0. 1) (Рисунок 5A)8 . Соотношение 1:1 привели к сильной степени СНГ-ингибирование и снижение относительного уровня СНГ-Дельта ослаблена СНГ-ингибирование. Соответственно была выполнена KD эксперименты над этот диапазон коэффициентов. Следует отметить количество рецептора Notch и общее количество transfected ДНК был неизменным в всех экспериментов. Это будет гарантировать, что совокупные формирования прежде всего пострадавших от деятельности СНГ-лигандов и не изменила уровней экспрессии Notch клетками.

Ранее было показано, что совместное выражение Notch и СНГ-лигандов в клетках S2 могут привести к образованию агрегатов homotypic14. Для изучения ли аналогичные homotypic агрегатов среди S2-паз & Deltaпереходных или S2-паз & зубчатымипереходные клетки могут подорвать наши интерпретации статистической количественной в СНГ-лиганд исследования, агрегирование пробирного управления была проведена между S2-паз & Deltaпереходных и простой S2 клетки. Количество ячеек S2, которые используются в этих экспериментах было то же самое, как S2-Дельта клетки, используемые в СНГ-Дельта экспериментов. Некоторые homotypic агрегации было отмечено, однако количественная оценка показала, что результирующая агрегатов способствует низкая часть всего агрегатов, по сравнению с гетеротипичной агрегатов между S2-паз & Deltaпереходных и S2-Дельта клеток () Рисунок 5B).Мы заключаем, что изменений наблюдается в количество агрегатов в СНГ-лиганд анализов обусловлено главным образом тормозящий эффект СНГ-лигандов на привязку между Notch и транс-Дельта.

В целом, статистических анализов, представлены в настоящем Протоколе обеспечивают простой и простой методологии для полуколичественного оценки транс- и СНГ-взаимодействия и его лигандами рецептора Notch. Эти анализы могут использоваться для изучения влияния генетических или фармакологических модификаторы пути паз на Notch лиганд привязки в пробирке и поэтому может помочь прояснить механизмы, лежащие в основе в естественных условиях воздействия этих модификаторов на паз сигналов.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы имеют никакого конфликта интересов.

Acknowledgments

Авторы признают поддержки от NIH/NIGMS (R01GM084135 HJN) и Фонд Мидзутани Glycoscience (Грант #110071 HJN) и благодарны том V. ли для обсуждения и предложения на анализы и Spyros Artavanis-Tsakonas, Хьюго Беллен, Роберт Флеминг, Кен Ирвин и центр ресурсов дрозофилы геномики (НАУЧНЫМ) для плазмидов и клеточных линий.

Materials

Name Company Catalog Number Comments
BioWhittaker Schneider’s Drosophila medium, Modified Lonza 04-351Q
HyClone Penicillin-Streptomycin 100X solution GE Healthcare lifescience  SV30010
CELLSTAR 6 well plate Greiner Bio-One 657 160
CELLSTAR 24 well plate Greiner Bio-One 662160
VWR mini shaker Marshell Sceintific 12520-956
Hemocytometer Fisher Sceintific  267110
FuGENE HD Transfection Reagent Promega E2311
MEGAscrip T7 Transcription Kit Ambion AM1334
Quick-RNA MiniPrep (RNA purification Kit) Zymo Research R1054
VistaVision Inverted microscope VWR
9MP USB2.0 Microscope Digital Camera + Advanced Software AmScope MU-900 Image acquisition using ToupView software
PureLink Quick Gel Extraction Kit Invitrogen K210012
Fetal Bovine Serum GenDepot F0600-050
Methotrexate Sigma-Aldrich A6770-10
Hygromycin B Invitrogen HY068-L6
Copper sulphate Macron Fine Chemicals 4448-02
S2 cells Invitrogen R69007
S2-SerrateTom cells Gift from R. Fleming (Fleming et al, Development, 2013)
S2-Delta cells DGRC 152
S2-Notch cells DGRC 154
pMT-Delta vector DGRC 1021 Gift from S. Artavanis-Tsakonas
pMT-Serrate vector Gift from Ken Irvine (Okajima et al, JBC, 2003)
pMT-Notch vector DGRC 1022 Gift from S. Artavanis-Tsakonas
pAc5.1-EGFP Gift from Hugo Bellen
TaqMan RNA-to-Ct 1-Step Kit Applied Biosystem 1611091
TaqMan Gene Expression Assay for CG9996 (Shams) Applied Biosystem Dm02144576_g1  with FAM-MGB dye
TaqMan Gene Expression Assay for CG7939 (RpL32) Applied Biosystem Dm02151827_g1 with FAM-MGB dye
Applied Biosystems 7900HT Fast Real-Time PCR system Applied Biosystem 4351405 96-well Block module

DOWNLOAD MATERIALS LIST

References

  1. de Celis, J. F., Bray, S., Garcia-Bellido, A. Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing. Development. 124, (10), 1919-1928 (1997).
  2. Fortini, M. E. Notch signaling: the core pathway and its posttranslational regulation. Dev Cell. 16, (5), 633-647 (2009).
  3. del Alamo, D., Rouault, H., Schweisguth, F. Mechanism and significance of cis-inhibition in Notch signalling. Curr Biol. 21, (1), R40-R47 (2011).
  4. Sprinzak, D., et al. Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature. 465, (7294), 86-90 (2010).
  5. Kopan, R., Ilagan, M. X. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell. 137, (2), 216-233 (2009).
  6. Huppert, S. S., Jacobsen, T. L., Muskavitch, M. A. Feedback regulation is central to Delta-Notch signalling required for Drosophila wing vein morphogenesis. Development. 124, (17), 3283-3291 (1997).
  7. Lee, T. V., et al. Negative regulation of notch signaling by xylose. PLoS Genet. 9, (6), e1003547 (2013).
  8. Lee, T. V., Pandey, A., Jafar-Nejad, H. Xylosylation of the Notch receptor preserves the balance between its activation by trans-Delta and inhibition by cis-ligands in Drosophila. PLoS Genet. 13, (4), e1006723 (2017).
  9. Jacobsen, T. L., Brennan, K., Arias, A. M., Muskavitch, M. A. Cis-interactions between Delta and Notch modulate neurogenic signalling in Drosophila. Development. 125, (22), 4531-4540 (1998).
  10. Schneider, I. Cell lines derived from late embryonic stages of Drosophila melanogaster. J Embryol Exp Morphol. 27, (2), 353-365 (1972).
  11. Fehon, R. G., et al. Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell. 61, (3), 523-534 (1990).
  12. Fleming, R. J., et al. An extracellular region of Serrate is essential for ligand-induced cis-inhibition of Notch signaling. Development. 140, (9), 2039-2049 (2013).
  13. Saj, A., et al. A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network. Dev Cell. 18, (5), 862-876 (2010).
  14. Fiuza, U. M., Klein, T., Martinez Arias, A., Hayward, P. Mechanisms of ligand-mediated inhibition in Notch signaling activity in Drosophila. Dev Dyn. 239, (3), 798-805 (2010).
  15. Ahimou, F., Mok, L. P., Bardot, B., Wesley, C. The adhesion force of Notch with Delta and the rate of Notch signaling. J Cell Biol. 167, (6), 1217-1229 (2004).
  16. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  17. Okajima, T., Xu, A., Irvine, K. D. Modulation of notch-ligand binding by protein O-fucosyltransferase 1 and fringe. J Biol Chem. 278, (43), 42340-42345 (2003).
  18. Acar, M., et al. Rumi is a CAP10 domain glycosyltransferase that modifies Notch and is required for Notch signaling. Cell. 132, (2), 247-258 (2008).
  19. Bruckner, K., Perez, L., Clausen, H., Cohen, S. Glycosyltransferase activity of Fringe modulates Notch-Delta interactions. Nature. 406, (6794), 411-415 (2000).
  20. Yamamoto, S., et al. A mutation in EGF repeat-8 of Notch discriminates between Serrate/Jagged and Delta family ligands. Science. 338, (6111), 1229-1232 (2012).
Сотовый агрегации анализов для оценки привязки <em>дрозофилы</em> паз с <em>транс</em>-лигандов и его ингибирование <em>СНГ</em>-лигандами
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pandey, A., Jafar-Nejad, H. Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands. J. Vis. Exp. (131), e56919, doi:10.3791/56919 (2018).More

Pandey, A., Jafar-Nejad, H. Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands. J. Vis. Exp. (131), e56919, doi:10.3791/56919 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter