Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Påvisning af en CDH1 sjældne udskrift Variant i frisk frosset gastrisk kræft væv af Chip-baserede digitale PCR

doi: 10.3791/57066 Published: February 5, 2018

Summary

Manuskriptet beskrives en chip-baserede digitale PCR assay til påvisning af en sjælden CDH1 udskrift variant (CDH1a) i frisk frosset normal og tumor væv fra patienter med mavekræft.

Abstract

CDH1a, en ikke-kanoniske udskrift af CDH1 -genet er blevet fundet skal udtrykkes i nogle gastrisk kræft (GC) cellelinjer, der henviser til, at det er fraværende i normal mavens slimhinde. For nylig har opdaget vi CDH1a udskrift variant i frisk frosset tumor væv fra patienter med GC. Udtryk for denne variant i vævsprøver blev undersøgt af den chip-baserede digitale PCR (dPCR) tilgang præsenteres her. dPCR giver mulighed for en nøjagtig, robust og meget følsomme måling af nukleinsyrer og er i stigende grad udnyttet for mange programmer i forskellige felter. dPCR er i stand til at opdage sjældne mål; Desuden tilbyder dPCR muligheden for absolut og præcis kvantificering af nukleinsyrer uden behov for kalibratorer og standard kurver. Faktisk beriger den reaktion partitionering målet fra baggrunden, som forbedrer forstærkning effektivitet og tolerance over for hæmmere. Disse egenskaber gør dPCR en optimal værktøj til påvisning af CDH1a sjældne udskrift.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CDH1 genet koder for E-cadherin, en vigtig faktor i opretholdelsen af den normale gastrisk epitel gennem regulering af celle vedhæftning, overlevelse, spredning og migration1. Tab af E-cadherin protein som følge af skadelige kønscelleoverførsel eller somatiske forandringer af CDH1 har været forbundet med udviklingen af GC2,3. Ikke-kanoniske udskrifter som følge af intron 2 af genet har også været en hypotese for at spille en rolle i gastrisk carcinogenese4,5. Især en sådan udskrift, CDH1a, har vist sig at være udtrykt i GC cellelinjer men er fraværende fra den normale mave4. Vi har for nylig opdaget CDH1a i GC vævsprøver fra GC patienter, som bruger chip-baserede dPCR5. dPCR blev brugt til at vurdere, for første gang, tilstedeværelsen af CDH1a gen udskrift i tarm GC og normale væv.

Guld standard metoden til at bestemme genekspression er Real-Time kvantitativ PCR (qPCR). Men de resulterende data kan undertiden være variabel og af dårlig kvalitet, især når de mål i stikprøven er lavt. Denne variation kan være forårsaget af forurenende stoffer, som hæmmer polymerase aktivitet og primer udglødning, fører til ikke-specifikke forstærkning og konkurrencedygtig side reaktioner6.

Selv om de grundlæggende biokemiske principper for dPCR svarende til qPCR, dPCR viser nogle fordele, giver mulighed for meget præcise målinger af genomisk DNA (gDNA) / supplerende DNA (cDNA) molekyler. DPCR er faktisk en end-point reaktion, der bygger på en kalibreret opdeling af en prøve i tusindvis af brønde, således at hver godt indeholder nul eller et enkelt mål molekyle. Forstærkning derefter forekommer kun i de brønde, der indeholder en kopi af målet og angives med et fluorescerende signal. Det absolutte antal målmolekyler i den oprindelige prøve kan derefter beregnes ved at bestemme forholdet mellem positive til samlede partitioner ved hjælp af binomial Poisson statistik7.

Derudover dPCR teknik eliminerer behovet for at køre en standardkurve og dermed forbundet bias og variabilitet, giver mulighed for en direkte kvantificering af mål8,9; Det producerer mere nøjagtige og reproducerbare resultater uafhængigt af forurenende stoffer og effektivitet på grund af sin høje tolerance til hæmmere10; Det er mere følsom og specifik end qPCR, og er dermed en pålidelig metode til påvisning af en sjælden mål. Endelig partitionering af prøven i flere reaktioner reducerer konkurrence med baggrunden molekyler og forbedrer målet påvisningsgrænsen, muliggjort forstærkning og lette påvisning af enkelt molekyler af gDNA/cDNA6 . Påvisning og kvantificering af nukleinsyrer ved chip-baserede dPCR har anvendt i stigende grad for at kopiere nummeret variation, kvantificering af DNA fragmenter og mutation analyserer11,12,13, gives den præcision og lav materiale input kravet om metoden. Derudover har dPCR for nylig blevet integreret i analysen af begge MicroRNA14 og gen udskrifter5,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Protokollen følger retningslinjerne i IRST menneskelige forskning etiske komité.

Bemærk: Denne procedure er specielt designet til påvisning af et lavt antal af cDNA molekyler i humane frisk frosset væv. Afsnittene væv er skåret på tøris, mens stadig frosset, fra tidligere validerede patient-afledte gastrisk tumor eller normal vævsprøver.

1. RNA isolering og oprensning

  1. RNA udvinding
    Bemærk: RNA isolering er udført under kølerhjelmen ved hjælp af et bestemt produkt (Se Tabel af materialer). Men en række isolation kits er kommercielt tilgængelige.
    1. Homogeniseres 50-100 mg af fint skåret frisk frosset vævsprøve i 1,5 mL rør med 1 mL af RNA isolering reagens og vortex energisk for 15 s. Incubate rør ved-80 ° C natten over.
    2. Inkuber rør indeholdende prøve ved stuetemperatur til 5 min og mix af vortexing for 15 s.
    3. Hold røret på is, tilføje 200 µL chloroform, og vortexes kraftigt i 15 s.
    4. Inkuber rør ved stuetemperatur til 60 s og centrifugeres ved 12.000 x g i 15 min. ved 4 ° C.
    5. Overføre den vandige fase i en 1,5 mL tube og tilføje 20 µg af glykogen.
      Bemærk: Det er vigtigt at omhyggeligt undgå at overføre interphase eller organiske lag for at mindske forurening.
    6. Tilsættes 500 µL af isopropanol, invertere rør for at blande, og der inkuberes i isbad i 10 min.
    7. Der centrifugeres tube på 12.000 x g i 15 min. ved 4 ° C for udfældningen RNA.
      Bemærk: RNA vil være til stede i en gel-lignende pellet på siden og bunden af røret, ofte usynlige efter centrifugering.
    8. Fjern supernatanten uden at forstyrre bundfaldet og vaske det med 1 mL af 75% ethanol af pipettering.
    9. Centrifugeres tube på 7.500 x g i 5 min. ved 4 ° C og Fjern supernatanten uden at forstyrre pelleten.
    10. Lad pellet tørre indtil bundfaldet bliver gennemsigtig og opløse den i 50 µL af RNase-fri vand.
    11. Fryse prøver på-80 ° C mindst natten før kvantificering.
  2. Genomisk DNA eliminering og RNA oprensning
    Bemærk: En DNase fordøjelsen skridt, efterfulgt af en kolonne-baserede RNA oprensning, anbefales til analyser af lav-overflod mål for at fordøje kontaminerende DNA.
    1. Opløse den frysetørrede DNase jeg (1.500 Kunitz enheder) i 550 µL af RNase-fri vand ved hjælp af en sprøjte, blandes forsigtigt ved invertering af hætteglasset, og opdele den rekonstituerede stamopløsning i delprøver.
    2. På en 1,5 mL tube overføre den beregnede volumen af prøven med 15 µg af RNA, 10 µL af DNase fordøjelsen buffer fra kit (angivet i Tabel af materialer), 2,5 µL af DNase stamopløsning og RNase-fri vand til 100 µL. Incubate ved stuetemperatur i 10 min.
    3. Tilføje 350 µL af væv lysisbuffer (fra kit, se Tabel af materialer) og blandes ved pipettering.
    4. Tilføje 250 µL af 100% ethanol og mix af pipettering.
    5. Overføre den hele mængde (700 µL) ind i en ny spin kolonnen og centrifugeres ved 12.000 x g i 15 s.
    6. Overføre filtret ind i en ny indsamling rør, tilsættes 500 µL 80% ethanol til kolonnen og centrifugeres ved 12.000 x g i 2 min.
    7. Åbn låget af spin kolonnen og centrifugeres ved 12.000 x g i 5 min. med en ny indsamling rør tørre filter; derefter overføre filteret til en 1,5 mL tube.
    8. Tilføje 14 µL af RNase-fri vand direkte til filter kolonnen og centrifugeres ved 12.000 x g i 1 min.
    9. Holde prøver på is og gå videre til kvantificering ved hjælp af 2 µL af prøven på en bænk-top Spektrofotometer eller gemme RNA ved-80 ° C indtil brug.

2. cDNA syntese

  1. Sted 1.000 ng af RNA, 4 µL af master mix, 1 µL af reverse transkriptase og RNase-fri vand til en endelige mængden af 20 µL i sterile PCR rør. Bland forsigtigt og spin-ned.
  2. Inkuber mastermix i en termisk cycler, gælder følgende betingelser: 5 min ved 25 ° C, 30 min på 42 ° C, 5 min ved 85 ° C.
  3. Centrifugeres rør kort og gå videre til dPCR analyse eller opbevares ved-20 ° C indtil det skal bruges.

3. digital PCR reaktion sat op

  1. dPCR reaktion mix og prøve forberedelse
    1. Optø den master mix og analysen ved stuetemperatur i mindst 20 min.
    2. Fortynd cDNA prøver til en koncentration af 300 ng i 6 µL vand.
    3. Forsigtigt vortex master mix og forberede en endelige mængden af 11,4 µL mix i sterile rør med 8,7 µL af master mix, 0.87 µL af CDH1a brugerdefinerede designet assay primer og 1,83 µL nukleasen-gratis vand.
      Bemærk: For CDH1a brugerdefinerede designet assay primer detaljer se Tabel af materialer.
    4. Overføre 11,4 µL af den forberedte blanding til fortyndede cDNA prøven, blandes forsigtigt og kort der centrifugeres.
      Bemærk: Diskenheder omfatter 20% overskud til at kompensere for volumen tab fra pipettering. Forberede blandingen til alle prøver og en ingen template control (NTC).
  2. Chip forberedelse
    Bemærk: Optimale resultater indlæse chips så hurtigt som muligt.
    1. Tilslut chip loader og vente, indtil indikatorlyset bliver grønt.
    2. Fjern hætten af fordybelse væske sprøjten ved forsigtigt trække sig tilbage i stemplet 1-2 mm og slippe den for at lette dette trin, og erstatte det med en spids.
    3. Tage en ny chip og notere koden skrevet på låget til at forbinde det med prøven.
    4. Hold låget omhyggeligt ved sin side, skræl væk den beskyttende film, og læg låg med den klistrede ansigt op i den rigtige retning.
    5. Omhyggeligt afhente en chip, pas på ikke for at røre den indre del, og indlæse det på chip reden i den korrekte position ved at trykke ned løftestang til at åbne klemmen.
    6. Indlæse en ny lastning klinge på læsseren og skubbe det forsigtigt til at sikre, at det er fast på plads.
    7. Overføre 14,5 µL af dPCR-mastermix på lastning klinge uden luftbobler eller afleder vingen, efter hvilket tryk den sorte læsning-knappen for at distribuere volumen på chip.
    8. Bruge fordybelse væske sprøjten til at overføre om 20 dråber chip overfladen, pas på ikke for at berøre overfladen med spidsen.
      Bemærk: Det er vigtigt at dække hele overfladen uden at spilde væske over kanterne.
    9. Rotere loader arm for at låget kommer i kontakt med chippen og tryk ned til 15 s.
    10. Tryk på knappen låg at frigive chippen og vende tilbage arm til sin holdning.
    11. Hold den samlet chip i en 45° vinkel og omhyggeligt undvære fordybelse væske i sprøjten gennem fyld port, rotere chip lidt at sørge for der er ingen luftbobler, og fjern eventuelle overskydende væske med en steril tørre.
    12. Forsegle chip tilfælde af forsigtigt peeling væk etiket på toppen af chip låg og tryk over fyld port for mindst 5 s.
    13. Gemme chippen i mørke indtil klar til at indlæse i den termiske cycler.
      Bemærk: Tilberedte chips bør anvendes inden for 2 h.
  3. dPCR reaktion
    1. Åbn låget og installere netværkskort til begge blokke, selv når en enkelt blok er brugt.
    2. Placer chips på prøve blokere i den korrekte position.
      Bemærk: Fyld port skal være rettet mod forsiden af den termiske cycler i en ophøjet position at tillade nogen luftbobler til at flyde til toppen uden at forstyrre vinduet af chippen. Brug tomme chips til at skabe balance mellem de to blokke.
    3. Lægge den thermal afrivningsblok på prøve blok til helt dække chipsene.
    4. Luk låget og starte PCR køre, gælder følgende betingelser: hold ved 96 ° C i 10 min. 45 cyklusser af 60 ° C i 2 min. og 98 ° C til 30 s; hold på 60 ° C i 2 min. hold ved 4 ° C. Slukke den termiske cycler og tø chips ved stuetemperatur i mindst 10 min.
      Bemærk: Chip analyse skal udføres inden for én time.
  4. Chip analyse
    1. Åbn låget af instrumentet og fjerne termisk puder, derefter fjerne chips fra adapterne.
      Bemærk: Gemme chips i en mørk, ren placering indtil analyse.
    2. Ren chip overfladen med isopropanol og en steril tørre.
      Bemærk: Inspicere hver chip for utætheder eller potentielle problemer.
    3. Indsæt USB i detektor system til at gemme dataene.
    4. Åbne chipsbakken detektor system, indlæse chip opad i den korrekte position og luk skuffen.
    5. Vente 30 s til forarbejdning, derefter fjerne chippen og indsætte næste.
    6. Vent til analysen skal udfyldes for alle de forarbejdede chips og derefter indsætte USB til en computer for at overføre filer.
      Bemærk: Den samlede tid for analyse er omkring 2 til 3 min./chip.

4. data analyse og fortolkning

  1. Tilslut til cloud-baseret softwareplatform, der kræves til at udføre alle de efterfølgende analyser.
  2. Oprette et projekt og importere alle datafiler af chips af interesse.
  3. Angiv navnet på prøve; Vælg farvestof og analysen anvendte i fanen "Definere Chips".
  4. Afgøre, om chippen er acceptabel ved at visualisere det i fanen "Anmeldelse Data", kontrollere hvordan grundigt prøven blev læsset på chippen og hvor mange datapunkter er evaluable.
    Bemærk: Afviser chips med mindre end 13.000 evaluable datapunkter.
  5. Videre til scatter plot på den valgte chip i højre side af skærmen. Anvend en taerskel paa 6.000 for fluorescein amidite (FAM) reporter farvestof signaler (y-aksen) til alle chips.
    Bemærk: Tærskelværdi kan variere på grundlag af assays anvendes.
  6. Fjern eventuelle tvivlsomme positive signaler at undgå falske positive resultater ved at vælge den relative plet på scatter plot ved hjælp af Lassoværktøjet og trykke på "ubestemt". Alle resterende positiv steder indikere tilstedeværelsen af cDNA eksemplarer af den sjældne target analyseret.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ved hjælp af den procedure, der præsenteres her, tjekket vi for udtryk for den sjældne udskrift variant CDH1a i gastrisk frisk frosset væv. Analyse af dPCR blev udført på 21-parret normal og kræft vævsprøver og i 11 ekstra tumor prøver. CDH1a var påvises i 15 ud af 32 (47%) tumorer, der henviser til, at ingen normal vævsprøver viste tilstedeværelsen af denne sjældne udskrift5. I vores analyse, blev chips med mindre end 13.000 datapunkter afvist, da var chips med uensartet lastning. Figur 1 viser en chip Se for både evaluable (figur 1A) og ikke-evaluable (figur 1B, C) prøver. Sidstnævnte tilfælde skal chippen kasseres på grund af tilstedeværelsen af flere bobler (figur 1B), en enkelt stor boble (figur 1 c), eller som følge af et utilstrækkeligt antal datapunkter tærskel (figur 1B). Disse prøver skal køres igen for at opnå fortolkelige resultater. Med hensyn til scatter plot leveres af software (figur 2), forestiller det normalt signaler fra FAM reporter farvestof (y-aksen) mod signaler fra VIC (producentens proprietære) reporter farvestof (x-akse). Datamærkerne præsenteret på scatter plot er farvekodede, og her er vi kun visualiseret FAM reporter farvestof signaler i blå (figur 2A), der angiver de brønde, hvor målet blev forstærket. Disse signaler er placeret tættere på y-aksen og længere væk fra oprindelsen af plottet. Den anden farve set på plottet er gul og er vejledende af brønde, hvor ingen forstærkning opstod. En pålidelig tærskel for de positive signaler, som var fastsat og anvendes til alle chips at forhindre ring skævhed. Her, var den valgte grænse 6.000 baseret på en række signaler observeret for de forskellige chips i disse eksperimenter. CDH1a cDNA kopier (blå signaler) blev fundet i et antal tumor prøver, viser en klar forskel i amplitude fra negative signaler (figur 2A). Omvendt, ingen signaler over den valgte grænse blev fundet i prøver negative for CDH1a udskrift, dvs, alle normale vævsprøver og nogle tumor prøver (figur 2B). På samme måde, ingen positive signaler blev opdaget i NTC, vand blev tilføjet i stedet for cDNA, dermed tjener som en negativ kontrol for dPCR reaktion (figur 2 c).

Et fint chip analyse skal anvendes til filter lav kvalitet datapunkter og fjerne risikoen for tvetydige resultater. Dette blev gjort ved at få vist chip for at fastslå den nøjagtige placering af den tilsvarende positivt signal: Hvis det blå signal er placeret på de meget grænser af chip (figur 3A) eller omkring bobler (figur 1B), signalet er afskediget fra analysen . For at yderligere for at forhindre risikoen for falske positiver, signaler over 6.000 til FAM-kanal og på den yderste højrefløj af plottet blev anset for sikkert konkurrencehandling og blev dermed filtreret ud, selvom de var lokaliseret inden for chippen (figur 3B). På denne måde, som en prøve betragtes for udtryk for den sjældne udskrift, CDH1a, selv om det viser en enkelt forstærkning signal, så længe dette signal er i overensstemmelse med de ovennævnte betingelser.

Figure 1
Figur 1 . Repræsentative evaluable og ikke-evaluable chips. De blå prikker er brønde som CDH1a referatet blev forstærket; de gule prikker er brønde i der opstod ingen forstærkning; de hvide prikker er tom brønde. Datapunkter tærskel er angivet under hver chip. (A) en evaluable chip med blå signaler inden for chip's grænser er lokaliseret. (B) en ikke-evaluable chip med mindre end 13.000 datapunkter tærskel. (C) en ikke-evaluable chip med en stor boble. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 . Repræsentative digital PCR scatter arealer CDH1a udtryk. Parceller skildrer signaler fra FAM reporter farvestof (y-aksen) mod signaler fra VIC reporter farvestof (x-akse). De blå prikker er CDH1a positive udtryk signaler, mens de gule prikker er "Ingen forstærkning" signaler. (A) CDH1a-positiv prøve. (B) CDH1a-negativ prøve. (C) ingen template control (NTC) viser nul CDH1a udtryk. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 . Repræsentative bøde-chip analyse af digitale PCR scatter parceller. Til venstre er visningen chip med signaler af interesse zoomet i i en sort firkantet, mens den højre er den tilsvarende scatter plot. (A) en blå signal lokaliseret på den korrekte fraktion af plottet, men på kanten af chippen. (B) tre blå signaler fremhævet i grå lokaliseret på den yderste højrefløj af plottet, men inden for chippen. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

dPCR blev oprindeligt udviklet for DNA molekylære målinger10,11,12,13 og i gang denne teknologi blev tilpasset til kvantificering af MicroRNA og RNA udskrifter5, 14,15. I denne protokol har vi udvidet listen over programmer til at omfatte påvisning af sjældne udskrifter fremstillet af frisk frosset vævsprøver. Til dette formål vi udnyttede en forholdsvis høj mængden af cDNA (300 ng). Selv om dette beløb ikke er det maksimale, der kan bruges i dPCR, var det tilstrækkeligt til at oprette standardiserede betingelser at sammenligne alle vores prøver. Ved at indstille fluorescens signal tærskel på 6.000 og pasning placeringen af positiv forstærkning signaler på både chip og scatter plot, opdaget vi med held denne sjældne mål i gastrisk tumor vævsprøver.

Af dPCR, vi kunne ikke helt kvantificere CDH1a, på grund af et meget lavt beløb af målet, men vi kunne pålideligt vurdere tilstedeværelsen/fravær af denne sjældne udskrift. Faktisk, den kvantitative karakter af denne teknik er begrænset af det oprindelige antal mål i de analyserede prøver7. Af relevans forbliver teknikken, selv for at være temmelig dyre og tid intensiv. Altså, når analysen af mange prøver og/eller flere mål er påkrævet, alternative teknikker skal betragtes7,8.

Når det er sagt, giver dPCR uden tvivl den ultimative platform for følsomme måling og kvantificering af nukleinsyrer, da det forbedrer præcision og reproducerbarhed hvad angår qPCR7,8. Desuden, det kunne betragtes som den eneste metode til at analysere genekspression af lav-rigelige nukleinsyrer, nær grænsen for qPCR følsomhed6.

Protokol her beskrevet kan tilpasses RNA'er fra alle væv, gør det muligt for påvisning af sjældne mål, som vores undersøgelse. Derudover udvides analysen på absolut kvantificering af udskrifter. I sådanne tilfælde, skal antallet af kopier/µL rapporteret af instrumentet til en given prøve blot ganges med indlæst reaktion volumen og divideret med det oprindelige beløb af cDNA. For at overvinde variabilitet fremstillet af reverse-transskription, gen-specifikke kalibratorer skal medtages, når muligt6. Ser på fremtiden, rummer dPCR store muligheder i at blive guldstandarden platform, ikke kun for sjældne sekvens opdagelse, men også sjældne mutation påvisning og præcis kopi nummer kvantificering7. Dette er især relevant i genetiske mosaicisme, såvel som i kræftforskning, hvor tumor heterogenitet kan påvirke en patients kliniske resultater og respons på behandlingen.

Fra et praktisk synspunkt, når du konfigurerer dPCR protokol der er flere kritiske trin, der skal fremhæves. Først og fremmest mastermix indeholdende den passende mængde af cDNA baseret på udtryk målniveauet forventes, skal overføres med stor omhu i lastning klinge for ikke at skabe luftbobler, som kunne forstyrre prøve homogenitet. Derudover skal bladet selv først være placeret korrekt; ellers kan det resultere i en ujævn prøve distribution. Desuden bør tilstrækkelig belægning med fordybelse flydende og korrekt forsegling af låget altid udføres. Vedrørende chip behandling og analyse er det vigtigt at være opmærksom på muligheden for akkumulere kondens på chip; i et sådant scenario, chip igen tørres med isopropanol og re-analyseres. Desuden, som dPCR er baseret på statistikker, Poisson, et minimum antal evaluable data peger (> 10.000) skal være til stede på chippen, ellers prøven skal køres igen. Endelig, for lav mål kopi påvisning eksperimenter, en kritisk konfunderende faktor kunne være signal-støj-forholdet, men en pålidelig tærskel positionering kan hjælpe med at identificere ægte positive signaler.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne rapport ingen interessekonflikter for dette arbejde.

Acknowledgments

Forfatterne vil gerne takke Gráinne Tierney for redaktionelle bistand.

Materials

Name Company Catalog Number Comments
TRIazol Reagent Thermo Fisher Scientific 15596018
Glycogen 20 mg/ml ROCHE 10901393001
RNeasy MinElute Cleanup kit QIAGEN 74204
iScript cDNA Synthesis kit BioRad 1708891
QuantStudio 3D Digital PCR Master Mix v2 Thermo Fisher Scientific A26358
CDH1a IDT custom designed assay Integrated DNA Technologies (IDT) NA F) GCTGCAGTTTCACTTTTAGTG
(R) ACTTTGAATCGGGTGTCGAG
(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/
[dPCR optimized assay concentrations: 900 nM (F),        900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2 Thermo Fisher Scientific A26316
Heraeus Biofuge Fresco Thermo  Scientific 75002402
Thermocycler (Labcycler) Sensoquest 011-103
GeneAmp PCR System 9700 Thermo Fisher Scientific N805-0200
Dual Flat Block Sample Module Thermo Fisher Scientific 4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 Thermo Fisher Scientific 4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler Thermo Fisher Scientific 4485513
QuantStudio 3D Digital PCR Chip Loader Thermo Fisher Scientific 4482592
QuantStudio 3D Digital PCR Instrument with power cord Thermo Fisher Scientific 4489084

DOWNLOAD MATERIALS LIST

References

  1. van Roy, F., Berx, G. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci. 65, (23), 3756-3788 (2008).
  2. Carneiro, P., et al. E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions. FEBS Lett. 586, (18), 2981-2989 (2012).
  3. Corso, G., et al. Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer. J Clin Oncol. 31, (7), 868-875 (2013).
  4. Pinheiro, H., et al. Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis. Hum Mol Genet. 21, (19), 4253-4269 (2012).
  5. Abou Khouzam, R., et al. Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer. Oncotarget. 8, (12), 18811-18820 (2017).
  6. Taylor, S. C., Laperriere, G., Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Sci Rep. 7, (1), (2017).
  7. Basu, A. S. Digital Assays Part I: Partitioning statistics and digital PCR. SLAS Technol. 22, (4), 369-386 (2017).
  8. Huggett, J. F., Whale, A. Digital PCR as a novel technology and its potential implications for molecular diagnostics. Clin Chem. 59, (12), 1691-1693 (2013).
  9. Alikian, M., et al. RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia. Clin Chem. 63, (2), 525-531 (2017).
  10. Hoshino, T., Inagaki, F. Molecular quantification of environmental DNA using microfluidics and digital PCR. Syst Appl Microbiol. 35, (6), 390-395 (2012).
  11. Salvi, S., et al. Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer. Oncotarget. 7, (25), 37839-37845 (2016).
  12. Tessitore, M. V., et al. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs. J.Transl.Med. 15, (1), (2017).
  13. Sho, S., et al. Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens. PLoS One. 12, (1), e0170897 (2017).
  14. Conte, D., et al. Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR. BMC Genomics. 16, 849 (2015).
  15. Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. Evaluation of digital PCR for absolute RNA quantification. PLoS One. 8, (9), e75296 (2013).
Påvisning af en <em>CDH1</em> sjældne udskrift Variant i frisk frosset gastrisk kræft væv af Chip-baserede digitale PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).More

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter