Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

히스톤 수정 Saccharomyces cerevisiae 에서 chromatin Immunoprecipitation (칩)

doi: 10.3791/57080 Published: December 29, 2017

Summary

여기, 우리는 신진 효 모 Saccharomyces cerevisiae에서 수정 된 히스톤의 염색 질 immunoprecipitation에 대 한 프로토콜을 설명합니다. Immunoprecipitated DNA가 풍부 하 고 지역화의 게놈을 통해 히스톤 포스트 번역 상 수정 양이 많은 PCR 이후에 사용 됩니다.

Abstract

Acetylation, 메 틸 화, 인 산화, 같은 히스톤 포스트 번역 상 수정 (PTMs), 동적으로 추가 하거나 셀에서 수신 하는 신호에 대 한 응답에서 이러한 마크를 제거 하는 효소에 의해 통제 된다. 이러한 PTMS 유전자 식 제어 등 프로세스의 규정을 주요 참여자 이며 DNA 복구. Chromatin immunoprecipitation (칩) 풍요로 움과 응답 셀에 다양 한 섭으로 게놈에 걸쳐 많은 히스톤 PTMs의 지역화 해 부를 위한 경 음악 접근 되었습니다. 여기, 싹 트는 효 모 Saccharomyces cerevisiae (S. cerevisiae) 에서 post-translationally 수정된 히스톤의 칩을 수행 하기 위한 다양 한 방법을 설명 합니다. 이 방법은 단백질 및 효 모 문화의 포름알데히드 처리를 사용 하 여 DNA의 가교에 의존 구슬 치고, micrococcal nuclease에 의해 chromatin 파편의 가용 화 및 히스톤 DNA의 immunoprecipitation에 의해 효 모 lysates의 세대 단지입니다. DNA의 히스톤 마크와 관련 된 정화는 게놈에 걸쳐 여러 loci에서 그것의 농축을 평가 하기 위해 정량 PCR 분석에 복종 하 고. Wildtype에 돌연변이 효 모 히스톤 부호 H3K4me2와 H4K16ac의 지역화를 조사 하는 대표적인 실험 데이터 분석 및 해석 설명 되어 있습니다. 이 메서드는 다양 한 히스톤 PTMs 적합 하며 다른 돌연변이 체 긴장 또는 그것에 게 다른 조건 하에서 chromatin 역학에서 변경 내용을 조사 하기 위한 훌륭한 도구를 만드는 다양 한 환경 스트레스의 존재를 수행할 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

히스톤의 동적 포스트 번역 상 수정 (PTM) 녹음 방송, 복제, DNA 수리1,2를 포함 하 여 많은 DNA 템플릿 프로세스에 대 한 주요 규제 메커니즘입니다. 풍부 하 고 이러한 프로세스와 부수적인 수정된 히스톤의 정확한 지 방화를 결정 하는 능력은 따라서 셀에 서로 다른 조건 하에서 그들의 규칙을 이해 중요 합니다. Chromatin immunoprecipitation (칩)의 개발을 주로 dna, 단백질의 상호 작용의 생 화 확 적인 연구에서 특히 생체 외에서 방법 화학 crosslinkers를 사용 하 여 비롯 된 방법으로 평가 하는 필요와 결합 된 동적 자연 단백질 DNA 상호 작용에서 vivo에서 그리고 게놈3,,45의 특정 지역에서. 정량 PCR (정량) 및 시퀀싱 기술의 발전 또한 양적 비교와 전체 게놈, DNA 단백질 상호 작용에서 해 부를 위한 강력한 도구를 만드는 걸쳐 칩 실험을 수행 하는 기능을 확장 했다 여러 수준입니다.

현재, 칩은 연구 그룹 게놈의 chromatin 중재 규정에 관심이 필요한 메서드 수정된 히스톤과는 특정 genomic 소재 시 에 사이의 물리적 링크를 직접 심문 없습니다 유사한 방법으로 vivo. 다음 세대 시퀀싱 게놈6,7 통해 히스톤 수정 지도를 사용 하 여이 방법의 변이 사용할 수 있지만 이러한 접근 다른 과학적인 질문 및 그들의 규모, 비용을 해결할 수 있습니다. 그리고 기술 리소스 일부 연구 그룹에 대 한 제한 될 수 있습니다. 또한, 대상된 칩-정량은이 보완 하기 위해 필요한 접근 방법을 모두를 제공 하 여 epigenomic 데이터 집합에서 결과 유효성을 검사 하 고 시퀀싱 전에 칩 프로토콜 최적화. 그러나 질량 분석 기반 접근,8,,910,11, 등장 게놈 지역 연관 표시는 또한 히스톤의 완전 한 보완을 식별이 접근 제한이 몇 가지는 게놈의 지구를 탐색할 수 및 그들이 필요한 전문 기술 및 계측을 모든 연구 그룹을 사용할 수 없습니다. 따라서, 칩 풍부 및 히스톤 수정 epigenetics, chromatin의 게놈 기능 규정에 관심이 모든 연구 단체에 대 한 다양 한 조건에서의 배포를 분석 하는 기초 방법에 남아 있다.

여기, 신진 누 룩을 사용 하 여 칩 모델 Saccharomyces cerevisiae (S. cerevisiae) 히스톤 PTMs chromatin에서의 분포를 조사 하는 방법을 설명 합니다. 이 이렇게 다양 한 칩 프로토콜 누 룩 개발 하 고 다양 한 모델 시스템12,13에 적용의 핵심 구성 요소에 의존 합니다. 수정된 히스톤과 DNA는 셀에서 간의 상호 작용은 포름알데히드와 가교에 의해 유지 됩니다. Lysate 준비 다음 염색 질 조각은 micrococcal nuclease와 소화에 의해 균일 하 게 크기의 조각으로 solubilized는. Immunoprecipitation 수정된 히스톤의 상업적 또는 실험실에서 생성 된 항 체와 함께 수행 되 고 모든 관련된 DNA 분리 및 정량 (그림 1)를 사용 하 여 게놈 지역에서 농축에 대 한 분석. 많은 히스톤 수정에 대 한이 프로토콜에서 얻은 DNA의 양을 정량 하 여 25 개 이상의 다른 게놈 loci를 테스트 하기 위해 충분 하다.

이 칩 방법은 매우 다양 한 여러 개의 돌연변이 체 긴장 또는 환경 조건, 단일 히스톤 수정 배포 모니터링을 위한 또는 wildtype 세포 게놈 loci의 숫자에 여러 개의 히스톤 수정 테스트입니다. 또한, 프로토콜의 수많은 구성 요소 중 높은-또는 미 천 한-풍부한 히스톤 부호의 최적화를 쉽게 조정 가능 하다. 마지막으로, 싹 트는 효 모에 수정 된 히스톤의 칩을 수행 크게 다른 시스템에서 사용할 수 있는 항 체 특이성에 대 한 주요 컨트롤을 사용 하 여 기회를 제공 한다. 즉, 효 모 종자 수 수정에 대 한 타겟으로하는 히스톤 잔류물에서 점 돌연변이 생성 되 고, 어떤 경우에는 특정 히스톤 잔류물에 수정 catalyzes만 단일 효소 (. 히스톤 lysine methyltransferases)입니다. 따라서, 칩 중 히스톤 돌연변이 또는 효소 삭제 긴장 시험의 범위는 비 특정 바인딩 항 체의 발생 그리고 거짓 긍정적인 결과 생성 하에서 수행할 수 있습니다. 이 컨트롤은 새로 개발 된 항 체에 특히 중요 하 고 심지어 다른 시스템에서 사용 하기 전에 보존된 히스톤 수정에 대 한 항 체 특이성을 확인 하는 데 사용할 수 있습니다. 이 이렇게 보완 (예: 모노-디-, 트라이-메 틸), 다른 수정 상태 사이에서 구별 하는 항 체 특이성을 테스트 하려면 다른 방법 수정된 펩 티 드의 배열 조사 등 수행 하는 히스톤의 서쪽 오 점 또는 nucleosomes 정의 수정입니다. 전반적으로, 싹 트는 효 모에 칩 게놈 전체 PTMs 히스톤의 역학을 평가 하 고 그들의 규칙을 경 세 하는 메커니즘을 해 부에 대 한 강력한 방법입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 미리 바인딩합니다 자성 구슬에 항 체

  1. 단백질 A/G 자석 구슬을 잘 혼합 하 고 1.5 mL 튜브에의 한 immunoprecipitation (IP) 샘플 당 자석 구슬 20 µ L를 전송.
    참고: pipetting 구슬, 넓은 구멍, 낮은 고정 팁 사용.
  2. 마그네틱 스탠드에 구슬 가진 튜브를 놓고 구슬 튜브에 수집을 허용 합니다. 제거는 상쾌한.
  3. 워시 3 번 감기 Tris 버퍼 염 분 (TBS) (50 mM Tris HCl pH 7.5, 150 mM NaCl)의 1 mL와 구슬.
  4. 구슬 및 항 체의 적절 한 금액에 TBS의 200 µ L를 추가 합니다. 4 ° c.에 하룻밤 8 rpm에 회전
    참고: 많은 히스톤 PTM 항 체에 대 한 IP 당 항 체의 1-3 µ g은 충분 합니다. 그러나, 적정 실험은 적절 한 농도 결정 하기 위해 권장 됩니다. 잘 특징이, 상업 히스톤 PTM 항 체에 대 한 권장된 농도 정확 하 고 게시 된 보고서 또는 제품 문학에서 찾을 수 있습니다.
  5. 마그네틱 스탠드에 비즈를 놓고는 상쾌한을 제거 합니다. Tbs.의 1 mL와 함께 그들을 씻어합니다
  6. 20 µ L IP 샘플 당 TBS의 플러스는 추가 5 µ L (pipetting 오류)의 경우 tbs.의 구슬 resuspend
    참고: 구슬 저장할 수 있습니다 4 ° C에서 단기 사용까지.

2. 성장 효 모 세포

  1. 적절 한 긴장에의 한 식민지와 YPD (10% 효 모 추출 물, 펩 20% 및 20% 포도 당)의 10 mL를 접종 하 고 하룻밤 220 rpm에서 떨고 인큐베이터에서에서 30 ° C에서 그것을 성장.
  2. 600에서 광학 밀도 측정 nm (OD600) 효 모 문화는 분 광 광도 계를 사용 하 여. OD600 문화를 희석 100 ml YPD 새로운 플라스 크에서 0.2 =.
  3. 중간 로그 단계를 도달할 때까지 220 rpm에서 떨고 인큐베이터에서 30 ° C에서 세포를 성장 (OD600 = 0.6-0.8).

3. 생체 내에서 dna 단백질의 가교

  1. 문화 중순 로그 단계에 도달, 1% 포름알데히드의 최종 농도 대 한 매체에 직접 37% 포름알데히드의 2.7 mL를 추가 합니다. 25 ° C (또는 상 온)에서 통에 플라스 크를 전송 하 고 15 분 동안 50 rpm에서 그것을 흔들어.
  2. 매체에 2.5 M 글리신의 5 mL을 추가 하 고는 포름알데히드를 풀기 위해 5 분 동안 실 온에서 50 rpm에서 떨고 계속.
  3. 병을 원심 회전 4 ° c.에서 5 분에 대 한 5800 x g에서 셀을 셀 전송 상쾌한을 가만히 따르다.
    1. 차가운 TBS의 45 ml에서 그들을 resuspending에 의해 세포를 세척 하 고 현 탁 액 50 mL 원뿔 튜브로 전송. 4 ° c.에 3 분 동안 2800 x g에서 튜브를 회전 제거는 상쾌한.
    2. 세척 감기 10 mL에 세포 세포의 용 해 버퍼 (50 mM Tris HCl pH 7.5, 150 mM NaCl, 1 mM ethylenediaminetetraacetic 산 (EDTA), 1% nonidet octyl phenoxypolyethoxylethanol (NP-40), 4 ° C에서 저장 된) 칩.
    3. 2800 x g 4 ° c.에 3 분에 세포를 스핀 제거는 상쾌한.
      참고: 셀 액체 질소로 냉동 고 추가 처리까지-80 ° C에서 저장 될 수 있습니다.

4. 효 모 Lysates 확인

  1. 1mm phenylmethylsulfonyl 불 (PMSF) 찬 칩 세포의 용 해 버퍼의 1 mL에 효 모 프로 테아 제 억제 물 칵테일의 1:1,000 희석 셀 resuspend 유리 구슬의 200 µ L을 포함 하는 2.0 mL 스크류 캡 튜브에 정지를 전송.
  2. 4 ° C에서 고속 교 반 장치를 치고 구슬 셀 전송 및 구슬 30 6 번 이길 각 s. 각 구슬 구타 사이 적어도 1 분 동안 얼음에 셀을 계속.
  3. 젤 팁을 로드를 사용 하 여 1.5 mL 튜브에는 lysate 전송. 원심 lysate 15500 x g 4 ° c.에 20 분에서
  4. 삭제는 상쾌한 고 펠 릿 MNase 소화 버퍼의 250 µ L에서 resuspend (10 mM Tris HCl pH 7.5, 10 mM NaCl, 3 m m MgCl2, 21 m m CaCl2, 1 %NP-40, 4 ° C에서 저장 된) 부드럽게 위아래로 pipetting으로.
  5. 반응에 MNase의 2.5 µ L를 추가 합니다. 반전 하 여 그들을 부드럽게 혼합 4-6 시간 및 즉시 20 분 동안 37 ° C 물 욕조에 그것을 품 어.
    참고: MNase의 새로운 주식을 사용 하는 경우 다이제스트 조건 최적화 되어야 합니다. 프로토콜에 대 한 10 단계를 참조 하십시오.
  6. 즉시 반응을 중지 10 mM EDTA의 최종 농도 0.5 M EDTA의 5 µ L을 추가 하는 얼음에 튜브를 놓습니다. 반전에 의해 그들을 부드럽게 혼합.
  7. 원심 15500 x g 4 ° C에서 15 분에 반응 하 고 새로운 1.5 mL 튜브에는 상쾌한 전송.
    참고: 수용 성 (소화) chromatin는 상쾌한에 있을 것입니다. 펠 릿에는 아무것도 소화 하 고 불용 성 세포 파편을 포함 되어 있습니다.

5. Immunoprecipitate (IP) 히스톤 수정

  1. Bradford 분석 실험을 사용 하 여 각 MNase 출시 chromatin 분수의 단백질 농도 결정 합니다. 8 일회용 큐 벳 플러스 테스트할 각 단백질 샘플 1 추가 베트의 각 하 Bradford 시의 1 mL를 추가 합니다.
    1. 2 mg/mL 소 혈 청 알 부 민 (BSA)의 재고 솔루션을 준비 합니다.
    2. 브래드 퍼 드 시 약의 1 mL에 BSA의 다음 농도 달성 하기 위해 적절 한 볼륨 추가: 0 μ g/mL, 0.5 μ g/mL, 1 μ g/mL, 2 μ g/mL, 4 μ g/mL, 6 μ g/mL, 8 μ g/mL와 10 μ g/mL. 추가 큐 벳을 MNase 출시 chromatin 분수의 2 μ를 추가 합니다.
    3. Parafilm의 작은 조각으로 각 베트의 상단을 커버 하 고 반전 있는 큐 벳 4-6 회 솔루션을 잘 혼합. 15 분 동안 실 온에서 큐 벳을 품 어.
    4. 595에서 흡 광도 측정 표시 광 분 광 광도 계를 사용 하 여 표준 곡선과 실험 샘플에 대 한 nm.
      참고: 사용 하지 않고 BSA 베트 (0 μ g/mL) 빈 첫 번째 측정 이전 분 광 광도 계.
    5. BSA의 다른 농도 분 광 광도 계와 관련 된 소프트웨어 또는 스프레드시트 소프트웨어에 대 한 흡 광도 값을 사용 하 여 표준 곡선을 플롯. 표준 곡선 및 희석 요소 사용 (1: 500)에 따라 각각 chromatin 분수 샘플의 단백질 농도 계산 하 흡 광도 값을 사용 합니다.
  2. 각 IP에 대 한 1 mL의 최종 볼륨을 도달 칩 세포의 용 해 버퍼 사용 MNase 출시 chromatin 분수에서 총 단백질의 50 µ g을 추가 합니다.
    참고: lysate 당 하나 이상의 IP를 설정 하는 경우 만들은 lysate의 마스터 믹스와 칩, 세포의 용 해 버퍼 및 IP에 대 한 개별 튜브에 aliquot 1 mL.
  3. 입력된 샘플으로 처리할 수 있는 IP 믹스에서 100 µ L을 제거 합니다. 7.1 단계까지-20 ° C에서 입력된 샘플을 동결.
    참고: 모든 나머지 chromatin 샘플 수 있습니다-20 ° C에서 냉동 수 있으며 필요한 경우 후속 IP에 대 한 사용.
  4. 미리 바인딩된 각 IP 샘플에 항 체로 자기 단백질 A/G 구슬의 20 µ L를 추가 합니다.
3 h (표준)에 대 한 8 rpm에서 샘플을 회전 또는 (선호) 하는 경우 4 ° c.에 하룻밤

6. 워시 IPs 및 히스톤 DNA 복합 Elute

  1. 마그네틱 스탠드에 튜브를 놓고 구슬 튜브 측에 수집 하자. 상쾌한 한 피 펫을 사용 하 여 제거 합니다. 씻어 아래 버퍼의 각각의 1 mL와 연속적으로 구슬.
    1. 4 ° C에서 5 분 동안 8 rpm에 회전 하 고, 마그네틱 스탠드에 비즈를 배치 하 고, 상쾌한, 제거 하 고 다음 버퍼를 추가 하 여 각 세척을 수행: 2 x-칩 세포의 용 해 버퍼, 2 x-높은 소금 워시 버퍼 (50 mM Tris HCl pH 7.5, 500 m m NaCl, 1 mM EDTA 1 %NP-40, 4 ° C에 저장), 1 x-LiCl/세제 워시 버퍼 (10 mM Tris HCl pH 8.0, 250mm LiCl, 1 mM EDTA, 1 NP-40%, 1% 나트륨 deoxycholate, 4 ° C에 저장), 1 x-테 (10 mM Tris HCl pH 8.0, 1 mM EDTA, 4 ° C에서 저장 된), 및 1 x-테.
    2. 마지막 테 세척, 구슬 구슬의 대부분 다른 0.5 mL 튜브를 세척 하 고 나머지 구슬 전송 하 테의 전송 테의 0.5 mL를 사용 하 여 새로운 튜브를 전송할.
  2. 갓 만든된 칩 차입 버퍼 (1 %SDS, 1mm NaHCO3)의 250 µ L를 추가 합니다. 짧게 솔루션 소용돌이입니다. 실 온에서 15 분 동안 8 rpm에서 샘플을 회전 합니다.
  3. 마그네틱 스탠드에 튜브를 놓고 구슬 수집 합니다. 신중 하 게 새로운 튜브에는 상쾌한을 전송 하 고 구슬 피하십시오.
    참고:는 eluate immunoprecipitated 단백질 및 관련된 DNA를 포함 한다.
  4. 구슬에 칩 차입 버퍼의 또 다른 250 µ L를 추가 합니다. 실 온에서 15 분 동안 8 rpm에서 샘플을 회전 합니다.
  5. 신중 하 게 포함 하는 첫 번째 차입 튜브는 상쾌한 전송. 필요한 경우, 구슬 방해를 피하기 위해 모든 IPs에 대 한 작은 볼륨 (240 µ L)를 제거 합니다.

7. 역 단백질-DNA Crosslinks

  1. 입력된 샘플을 해 동 하 고 각 입력에 칩 차입 버퍼의 400 µ L를 추가 합니다.
  2. 모두 입력 및 IP 샘플, 반전 또는 튜브를 flicking 여 잘 5 M NaCl, 20 mg/mL glycogen의 5 µ L 및 가수분해 K. 믹스 20 mg/mL의 12.5 µ L의 20 µ L를 추가 합니다. 밤새 65 ° C 물 욕조에 샘플을 품 어.

8. 정화 하 고 DNA를 집중

  1. 입력 및 IP 샘플 10 mg/mL RNase A의 10 µ L를 추가 합니다. 30 분 동안 37 ° C 물 욕조에 샘플을 품 어.
  2. 수성 솔루션을 페 놀: chlorofrom:isoamyl 알코올 (25:24:1 PCI)의 600 µ L을 추가 하 고 그들을 잘 섞는다. 실 온에서 5 분 동안 15500 x g에서 그들을 회전 합니다.
    1. 새로운 튜브에 수성 층을 제거 합니다. PCI의 600 µ L을 추가 하 고 그들을 잘 섞는다. 실 온에서 5 분 동안 15500 x g에서 튜브를 회전 합니다. 새로운 튜브에 수성 층을 전송.
      주의: 증기 두건 및 PCI 작업할 때 적절 한 개인 보호 장비를 착용 합니다. 기관 지침에 의해 지시 하는 대로 액체와 고체 폐기물을 처분.
  3. 0.1 x 볼륨 3 M 나트륨 아세테이트의 DNA를 침전 시키기 위하여 감기 100% 에탄올의 1 mL를 추가 합니다. 반전 튜브 4-6 회 솔루션을 잘 혼합. 하룻밤-20 ° C에서 품 어.
    1. 4 ° c.에 20 분 동안 15500 x g에서 튜브를 회전 조심 스럽게 제거는 피 펫과 상쾌한.
    2. 차가운 70% 에탄올의 1 mL에 펠 릿을 세척. 4 ° c.에서 10 분 동안 15500 x g에서 회전 조심 스럽게 제거는 피 펫과 상쾌한.
    3. 약 20 분 (때까지 완전히 건조) 후드에서 펠 릿 건조 IP 샘플 nuclease 무료 물 50 µ L에서 resuspend 그리고 nuclease 무료 물 100 µ L 입력된 샘플을 resuspend. 정량 Pcr 수행까지-20 ° C에서 DNA 샘플을 저장 합니다.

9. 양이 많은 PCR (정량) 풍부한 게놈 지역 검색

  1. 뇌관의 각 집합에 대 한 정량 마스터 믹스를 확인 합니다. 한 반응 2 x qPCR 믹스의 5 µ L, 20 µ M 앞으로 뇌관의 0.25 µ L 및 20 µ M 역 뇌관의 0.25 µ L를 포함 한다.
    참고: 적절 한 뇌관 디자인 및 정량 실험을 위한 테스트 설명 다른14,,1516.
  2. 각 DNA 샘플에 대 한 DNA 마스터 믹스를 확인 합니다. 한 반응 DNA의 0.5 µ L 및 nuclease 무료 물 4.0 µ L를 포함 한다.
  3. 384 잘 정량 접시에 각 잘을 5.5 µ L의 적절 한 뇌관 마스터 믹스와 적절 한 DNA 마스터 믹스의 4.5 µ L를 추가 합니다.
    참고: 각 음에 뇌관 믹스의 5.5 µ L를 추가 시작 합니다. 4.5 µ L의 DNA 혼합을 추가 하기 전에 실내 온도에 1 분 동안 200 x g에서 접시를 회전 합니다.
  4. 접시와 상 온에서 1 분 동안 200 x g에서 스핀을 인감을 준수 합니다.
  5. 정량 Pcr 실시간 정량 시스템을 사용 하 여 다음 조건 수행: 95 ° C 3 분;에 대 한 10 95 ° C의 40 주기 s, 55 ° C 30에 대 한 s; 녹는 곡선 65 ° C ~ 0.5 ° C 증가, 5와 95 ° C s.
  6. 각 뇌관 쌍 계산는 정량에 사용 하는 5% 입력된 샘플을 기준으로 IP 샘플의 백분율 입력 합니다. 기술 PCR triplicates의 의미를 사용 하 여 계산을 수행 하.
    참고: 경우 상당한 변이에서 관찰 PCR triplicates 마스터 믹스 구성, pipetting 오류 및 384-잘 접시에 우물 사이의 교차 오염에 주의와 정량 Pcr을 반복 하는 것이 좋습니다.
    1. 원시 Cq 값에서 희석 비율을 대표 하는 사이클의 수를 빼서 Cq 100%에 대 한 입력 값을 조정 합니다.
      참고: 5% 입력 20-fold,는 4.32 사이클 (로그2 20 = 4.32)와의 희석 비율을 나타냅니다.
    2. %2로 입력 계산 ^ (Cq입력 -CqIP) 100을 곱한.

10. (권장 하기 전에 첫 번째 전체 칩 실험) MNase 다이제스트 조건 결정

  1. 2.1 이전 프로토콜의 4.4 통해 단계. 충분히 lysate chromatin 포함 된 펠 릿의 MNase 소화의 여러 샘플을 생성 하는 프로토콜을 확장. 4.4 단계에서 MNase 소화 버퍼의 1.25 mL에 산 탄을 resuspend. 5 샘플 튜브는 각 약 수 MNase 소화 버퍼에 resuspended chromatin 펠 릿의 250 µ L를 포함 합니다.
  2. 0, 1.5, 2.5, 5 추가 각 튜브를 MNase의 µ L. 반전 하 여 그들을 부드럽게 혼합 4-6 시간 및 즉시 20 분 동안 37 ° C 물 욕조에 튜브를 품 어.
  3. 즉시 얼음에 튜브를 배치 하 고 10mm 최종 농도 0.5 M EDTA의 5 µ L을 추가 하 여 반응을 중지 합니다.
반전 하 여 솔루션을 부드럽게 혼합.
  • 4 ° C에서 15 분 동안 15500 x g에서 튜브 원심 고 새로운 1.5 mL 튜브에는 상쾌한 전송.
  • 1% 최종 농도 (10% 주식 솔루션의 25 µ L)와 NaHCO3 1.5 mL 튜브에 샘플을 0.1 m M 최종 농도 (1 M 재고 솔루션의 25 µ L)에 SDS을 추가 합니다.
  • 1.5 mL 튜브에 샘플 5 M NaCl, 5 µ L의 glycogen, 그리고 20 mg/mL 가수분해 K의 12.5 µ L의 20 µ L를 추가 합니다. 품 어 그들 65 ° C에서 하룻밤.
  • 10 mg/mL RNaseA의 10 µ L를 추가 합니다. 30 분 동안 37 ° C에서 품 어.
  • 수성 해결책에 PCI의 300 µ L을 추가 하 고 그들을 잘 섞는다. 실 온에서 5 분 동안 15500 x g에서 회전 합니다.
    1. 새로운 튜브에 수성 층을 제거 합니다. PCI의 300 µ L을 추가 하 고 잘 혼합. 실 온에서 5 분 동안 15500 x g에서 회전 합니다. 새로운 튜브에 수성 층을 전송.
  • 0.1 x 볼륨 3 M 나트륨 아세테이트 (보통 ~ 30 µ L)의 DNA를 침전 시키기 위하여 감기 100% 에탄올의 1 mL를 추가 합니다. 반전 튜브 4-6 회를 잘 섞어. 밤새-80 ° C 1 시간 또는-20 ° C에서 튜브를 품 어.
    1. 4 ° c.에 20 분 동안 15500 x g에서 튜브를 회전 조심 스럽게 제거는 피 펫과 상쾌한.
    2. 차가운 70% 에탄올의 1 mL에 펠 릿을 세척. 4 ° c.에서 10 분 동안 15500 x g에서 회전
    3. 펠 릿 후드 약 20 분에서 (또는 때까지 완전히 건조) 건조 보자. Nuclease 무료 물 30 µ L에 산 탄을 resuspend.
  • 염료를 로드 하는 DNA를 추가 하 고 2 %agarose 20 µ L을 실행 시각화 하 젤 소화 DNA.
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    이 프로토콜의 한 핵심 구성 요소는 단계 10에서 설명한 녹는 조각으로는 염색 질을 소화 하는 데 사용 된 micrococcal nuclease (MNase)의 농도 최적화입니다. 이것은 관심의 게놈 영역에서 히스톤 수정 배포에 대 한 고해상도 데이터를 얻기 위해 중요입니다. MNase 적정 수용 성 염색 질 분수에 디 nucleosomes의 작은 금액으로 주로 모노 nucleosomes를 달성 하기 위해 가장 적합 한 농도 결정 하기 위해 수행 되어야 한다. 이 구상 될 수 있다 DNA를 추출 하 여 chromatin 포함 된 펠 릿의 MNase 소화와 수행 agarose 젤 전기 이동 법 (그림 2). 여기에 사용 되는 MNase의 준비에 20 단위 / µ L에서 효소의 2.5 µ L 주로 모노 nucleosomes 생산과 따라서이 금액 칩 사용 되었다.

    두 대표 결과이 칩 프로시저 (그림 3)에 대 한 표시 됩니다. 첫 번째 예제에서 히스톤 메 틸 마크 wildtype 셀 또는 셀이이 마크를 catalyzes methyltransferase 부족에 계산 됩니다. 특히, 칩 wildtype set1Δ 세포에서 컨트롤로 히스톤 h 3에 대 한 뿐만 아니라 H3K4me2에 대 한 항 체와 함께 수행 되었다. H3K4me2는 주로 그냥 하류 localizes 전사의 지역 코딩의 5' 끝에 사이트를 시작 하 고, Set1의 부재, H3K4me2 셀17,,1819에서 검출 될 수 없다. Set1Δ 스트레인은 그러므로 양의 항 체를 다른 히스톤 부호 또는 DNA의 비 특정 바인딩 표시 될 수 있습니다 배경 신호를 표시 하는 컨트롤 역할을 합니다. 이 경우에, wildtype 스트레인 보여준 반면 신호가 set1Δ에서 관찰 되었다 Set1, PMA1ERG1120,21, 직접 목표 것으로 알려져 두 유전자의 5' 끝에 H3K4me2에 대 한 명확한 농축 셀 (그림 3A)입니다. 예상 했던 대로, telomere (TEL) 07 L에H3K4me2 마크의 아무 농축이입니다. 그러나 SPR3 중간 포자 형성 유전자의 표현 또한 보고 되었다 Set122,23에 의해 통제 되기 위하여 SPR3 ORF의 5' 끝에 H3K4me2의 농축은 관찰 단계로 가장 비슷한 TEL07L, PMA1 또는 ERG11에 비해. 이 메 틸 마크의 지역화 평가 SPR3 규 Set1 중재 이전 관찰된22PMA1 또는 ERG11, 보다 다른 메커니즘에 의해 발생할 가능성이 임을 나타냅니다.

    두 번째 예제에서는 acetylated H4K16의 칩 히스톤 H4 wildtype 셀과 셀 히스톤 deacetylase Sir2, 부족에 H4K16ac 마크를 제거 하에 상대적으로 표시 됩니다. H4K16ac는 telomere 가까이 heterochromatic 같은 chromatin에서 고갈 및 TEL07LTEL15L (그림 같이 euchromatin 더 telomere24,25, 원심 농축 3B). 또한, Sir2의 손실의에서 증가 일으키는 특정 telomeric 및 subtelomeric 지역에 H4K16ac 비록 변경 제어 유전자 PMA1, Sir2 지역화에 알려져 있지에 관찰. 이러한 데이터 sir2Δ 세포에서 H4K16ac 수준에 있는 명확한 증가 보여, H4K16ac, set1Δ 세포 대 wildtype에 H3K4me2 변경으로 상당한 될 예정 이다에 감지 된 변화 수 있습니다 드러나지 칩 매개 변수가 제대로 최적화 되어 있습니다. 토론에 최적화에 대 한 권장 사항은 설명 합니다.

    Figure 1
    그림 1: 칩 절차의 타임 라인. 칩 프로토콜에 대 한 일반적인 일정 표시 됩니다. 가능한 변화는 텍스트에 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

    Figure 2
    그림 2: 모노 nucleosomes의 가용 화에 대 한 테스트 MNase 소화. 다양 한 양의 MNase chromatin 펠 릿의 소화 다음 고립 된 DNA의 Agarose 젤 전기 이동 법 (20 단위 / µ L). 약 150에서 mononucleosomes에서 DNA 마이그레이션합니다 혈압, polynucleosomes에서 약 300 bp와 DNA dinucleosomes에서 점점 더 높은 분자 무게에서 발견 된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

    Figure 3
    그림 3 : H3K4me2와 H4K16ac의 칩 wildtype 돌연변이 효 모 종자에. H3K4me2 및 h 3에 대 한 항 체를 사용 하 여 (A) 칩 wildtype set1Δ 세포에서 수행 되었다. 비율 표시 loci에서 H3K4me2의 상대 농축을 나타내는 그래프와 백분율 입력 H3K4me2와 H3 IPs에 대 한 각 뇌관 쌍에 대 한 계산 했다. PMA1, ERG11SPR3 에 대 한 프라이 머 TEL07L 뇌관 쌍은 염색체 7의 왼쪽된 팔에 telomere 반면 amplicons 각 ORF의 5' 끝에 생성 합니다. 3 생물 복제의 의미를 표시 하 고 오차 막대 뜻의 표준 오류를 나타냅니다. (B) 칩 H4K16ac 및 H4 wildtype sir2Δ 세포에서 인식 하는 항 체를 사용 하 여 수행 되었고 그림 3A에 대 한 설명 된 대로 플롯 됩니다. 뇌관 쌍 telomeres (TEL07LTEL15L)에 인접 한 순서를 증폭 하 고 다운스트림 내에서 이전에 정의 된 각 subtelomere의 euchromatic 지구 (21 kb 및 5 kb telomere에서 원심에서 각각).이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

    스트레인 수 유전자 형 참조
    yEG230 MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 23
    yEG223 MATα sir2Δ::NATMX 이 연구
    yEG232 마 타 set1Δ::KANMX 23

    표 1: 효 모 변종이이 연구에 사용 된.

    올리고 수 위치 시퀀스
    oEG141 TELVIIL F AGCCCGAGCCTGTACTAAAT
    oEG142 TELVIIL R CAAAAGAAACTTTTCATGGCA
    oEG153 5' PMA1 F TCAGCTCATCAGCCAACTCAAG
    oEG154 5' PMA1 R CGTCGACACCGTGATTAGATTG
    oEG220 TELVIIL + 21 KB F AAACAATGGGACCCTTCTGA
    oEG221 TELVIIL + R 21 KB AACACCTTGCAAAACACAGG
    oEG280 TELXVL F ATCCTGCAATTGGGCCACTAT
    oEG281 TELXVL R AGCGGAAGGCATATTAACGT
    oEG282 TELXVL + 5 KB F AGGCGATGTAATCTCACCAA
    oEG283 TELXVL + 5 KB R CATTCACACATCCTGCTACCA
    oEG568 ERG11 F CCTCTTATTCCGTCGGTGAA
    oEG569 ERG11 R TGTGTCTACCACCACCGAAA
    oEG963 SPR3 F TCTGGATTCGCTGAGGAAGT
    oEG964 SPR3 R TTTCAGTTCAGGGCTTTTCG

    이 연구에 사용 된 한 표 2: 뇌관

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    여기에 설명 된 절차는 immunoprecipitation에 의해 효 모 세포에 수정 된 히스톤과 관련 된 DNA의 효율적인 복구에 대 한 수 있습니다. 이것은 정량 Pcr 증폭 지역 농축 결정 관심 영역 또는 특정 히스톤 수정의 소모는 뇌관을 사용 하 여 옵니다. 개발 되 고 있는 방법으로 거의 20 년 전에 불구 하 칩 히스톤 수정 상태 다른 게놈 영역에 다양 한 조건 하에서 조사 정의 분석 결과 남아 있습니다. 칩 결합 차세대 시퀀싱 기술 게놈 넓은 규모6,7에 히스톤 수정 심문 수 있습니다, 비록 비용 및 필요한 데이터 분석이 방법의 일부 실험실 설정에 그들의 사용을 제한할 수 있습니다. 또한, 이러한 epigenomic 실험 종종 뒤에 칩 정량의 게놈 일부 loci에서 히스톤 수정 상태 관측 유효성을 검사 하 게 결합 됩니다. 물리적으로 히스톤 표시 (또는 다른 단백질) 게놈 내의 특정 위치에 연결 하 고 다른 환경 또는 생물 학적 조건 하에서이 상호 작용의 역학 분석에서 칩의 유틸리티를 제공 하는 몇 가지 유사한 방법이 있다 . 정의 된 게놈 영역에서 chromatin 격리에 최근 성공 하고있다 고 질량 분석8,,910,11을 사용 하 여 로컬 히스톤 부호를 식별, 이러한 방법을 포즈합니다 기술 과제와 다양 한 실험실 종류에서 그들의 유틸리티 질량 분석 계측 및 데이터 분석 리소스에 대 한 적절 한 액세스에 의해 제한 될 수 있습니다. 여기에 설명 된 프로토콜이입니다 기본 가능한 장애물 정량 Pcr 기계에 대 한 액세스 되 고 기술적으로 그리고 경제적으로 다양 한 실험실 설정에 액세스할. 칩 효 모 및 기타 시스템에서 수정 된 히스톤의 게놈 지역화를 정의 하기 위한 황금 표준 남아 있습니다.

    이것은 동시에 여러 돌연변이 또는 환경 조건 테스트를 포함 하 여 다른 실험 조건에 맞게 최적화 될 수 있는 단계 수와 다양 한 프로토콜 이다. 또는 충분 한 chromatin 하나까지 적어도 4 개의 다른 항 체와 여러 개의 Ip를 수행 lysate에서 일반적으로 생성 됩니다. 이 프로토콜의 비 히스톤 chromatin 단백질에 피토 프 태그, 또는 항 체 생성 된 칩에 대 한 사용할 수 있습니다. 이 프로토콜의 비 히스톤 단백질 칩에 대 한 적응 될 경우 매개 변수 고정 시간을 포함 한 IP에서 chromatin 농도 및 항 체 농도 종종 배경 위에 타겟된 단백질의 농축을 얻기에 중요 한. 가장 일반적으로, 그것은 45의 그리고 60 분 사이 포름알데히드와 고정 시간을 증가 하 고 (최대 총 단백질의 200 µ g) IP에서 사용 하는 chromatin의 양을 증가 시키는 유용 합니다.

    수 질에 기여 하는 잠재 변수 및 히스톤 수정 칩 실험의 재현성이 있다. 종종 최적의 실험은 스 탁 차이 (예를 들어 wildtype 또는 set1Δ 세포, 그림 3A와 같이 H3K4me2의 수준)을 비교 했을 때 긍정적인 결과 얻을 수 있습니다, 하지만 더 많은 미묘한 차이 높습니다에 마스크를 (예: wildtype 또는 sir2Δ 세포, 그림 3B와 같이 TEL07L 에서 H4K16ac의 다른 수준) 잘못 수행된 실험. 실험적인 매개 변수 고려를 사용 하는 효 모 세포, 고정 시간, IP, 소화 DNA 단백질 복합물 항 체 품질 및 농도의 조각 크기에에서 사용 되는 염색 질 분수의 농도의 수량을 포함 합니다. 이 방법의 한 가지 한계는 실험적인 매개 변수 최적화는 일반적으로 테스트 되 고 각 히스톤 수정 및 돌연변이 체 긴장 및 조건 조사 필요. 히스톤 마크 수준 또는 다른 조건 하에서 지역화에 미묘한 차이가 있을 수 있습니다 그리고 이러한 차이 감지 하는 능력은 위에서 설명한 매개 변수에 따라 달라 집니다. 우리는 아래 가장 중요 한 실험적인 접근을 개발 하기 위한 주요 고려 사항 중 일부를 논의.

    프로토콜에 설명 된 대로 전체 칩 실험을 수행 하기 전에 최적의 농도 결정 하는 MNase의 여러 농도 테스트 하는 것이 좋습니다. IP 내에서 DNA 조각 적절 하 게 보장 칩 결과 높은 해상도 얻기에 열쇠 이다. 비록 정량 제품의 amplicon 크기 작은 있을 수 있습니다 (일반적으로 미만 100 bp) DNA의 조각 크기는 실질적으로 더 큰 때, 실제로, 히스톤 마크를 지역화할 수 있습니다에 정량은 틀리게 특정 장소에 농축을 나타낼 수 있습니다 하는 경우, basepairs 거리의 수백입니다. 이 프로토콜을 solubilize는 염색 질으로 모노-및 디-nucleosomes, MNase에 의존 하는 동안 다른 칩 프로토콜도 일반적으로 사용 하 여 쥡니다 chromatin6,7전단. 쥡니다 전단 크기 덜 균일 한 경향이 있고 실험 사이 일관 된 결과 달성 하기 더 어려울 수 있지만 염색 질 조각을 solubilizing 위한 신뢰할 수 있는 방법 이기도 합니다. 쥡니다 일부 비 히스톤 단백질 칩에 대 한 바람직 있을 수 있습니다, 있지만 주로 모노 nucleosomes에 염색 질을 소화 하기 위해 MNase 사용 하 여 히스톤 수정 칩 실험의 해상도 높일 수 있습니다.

    성공적인 칩 실험에 대 한 요구 사항 중 하나는 고유 하 고 높은 선호도의 히스톤 수정 인식 하는 항 체입니다. 히스톤 수정 검출을 위한 방법으로 칩의 주요 한계는 높은-품질, 검증 된 항 체;에 대 한 의존도 이러한 시 약, 없이 칩에서 얻은 결과 생물학으로 관련 될 가능성이 없습니다. 품질 및 항 체의 유효성 변수는 신진 효 모에 있는 히스톤 수정에 대 한 상용 항 체의 여러 가지가 있습니다. 이러한 항 체를 확인 하기 위해 노력이 주어진된 실험26가장 사용할 수 있는 항 체를 확인 하기 위한 유용한 자원을 생산 하 고 있다. 항 체 칩에 사용 되는 그들의 특이성, 수정 하 고 수정 되지 않은 히스톤 펩 티 드의 프로 빙 배열에 의해를 포함 하 여, 전체 셀 추출 물 및 순화 된 히스톤의 서쪽 오 점 수행 방법의 다양성으로 유효성을 검사 하는 것이 좋습니다. 삭제 또는 수정 된 히스톤 잔류물에서 점 돌연변이 들고 수정 효소와 긴장 등 적절 한 컨트롤과 칩 실험. 새롭거나 표시를 인식 하는 새로운 항 체 또는 실험실에서 생성 된 항 체에 대 한 이러한 특이성 실험 항 체 칩에 대 한 유효한 시 있을 수 있습니다 여부를 결정 하는 중요 한 있습니다.항 체의 특이성을 확인, 뿐만 아니라 wildtype 긴장과 부정적인 제어 긴장에서 IP에 대 한 항 체 적정 수행은 종종 항 체 (설정된 chromatin 농도)를 기준으로 필요한 금액을 결정 하는 데 유용 정확한 차이 농축 긴장 또는 게놈의 지역 검색. 또한, 마크의 게놈 분포 패턴에 대 한 일부 데이터는 알려진, 긍정적이 고 부정적인 제어 뇌관 세트는 어떤 개별 실험의 유효성을 검사 하 고 실험 사이 비교를 간단 하 게 모든 정량 실험에 포함 되어야 합니다.

    전반적으로,이 작품에서는 연구자 질의 신진 효 모에 어떤 genomic 지구에서 히스톤 수정 상태에 관심이 기초 방법을 설명 합니다. 이 프로토콜 및 다양 한 실험적인 질문에 그것의 적용의 분자 수준에서 chromatin 역학을 해 부를 위한 매우 유용한 도구 네요.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    저자는 공개 없다.

    Acknowledgments

    저자는 유용한 토론에 대 한 녹색 연구소의 회원을 감사 하 고 싶습니다. 이 작품은 NIH 교부 금 R03AG052018와 E.M.G.에 R01GM124342에 의해 부분적으로 지원

    Materials

    Name Company Catalog Number Comments
    Yeast Extract Research Products International (RPI) Y20025-1000.0
    Peptone Research Products International (RPI) P20250-1000.0
    Dextrose ThermoScientific BP350-1
    Formaldehyde Sigma-Aldrich F8775
    Glycine Fisher Scientific AC12007-0050
    Tris Amresco 0497-5KG
    EDTA Sigma-Aldrich E6758-500G
    NaCl ThermoScientific BP358-10
    4-Nonylphenyl-polyethylene glycol Sigma-Aldrich 74385 Equivalent to NP-40
    MgCl ThermoScientific S25533
    CaCl2 Sigma-Aldrich 20899-25G-F
    LiCl ThermoScientific AC413271000
    Sodium Dodecyl Sulfate Amresco M107-1KG
    Sodium Deoxycholate Sigma-Aldrich 30970-100G
    Sodium Acetate Sigma-Aldrich S2889
    NaHCO3 ThermoScientific S25533
    PMSF Sigma-Aldrich P7626-5G
    Yeast protease inhibitor cocktail VWR 10190-076
    25 Phenol:24 Chloroform:1 Isoamyl Alcohol VWR Life Science 97064-824
    Ethanol Sigma-Aldrich E7023
    Nuclease-Free Water VWR 100720-992
    Micrococcal Nuclease Worthington Biochemical LS004797
    Glycogen ThermoScientific R0561
    Proteinase K Research Products International (RPI) P50220-0.1
    RNase A  Sigma-Aldrich R6513-50MG
     Bradford Assay Reagent ThermoScientific 23238
     BSA Standard 2 mg/mL ThermoScientific 23210
    α H4 EMD Millipore 04-858
    α H4K16ac EMD Millipore ABE532
    α H3 Abcam ab1791
    α H3K4me2 Active Motif 39142
     High Rox qPCR Mix Accuris qMax Green, Low Rox qPCR Mix ACC-PR2000-L-1000
    Protein A/G Magnetic Beads ThermoScientific 88803
    magnetic stand for 1.5mL tubes Fisher Scientific PI-21359
    Acid-Washed Glass Beads Sigma-Aldrich G8772
     Microtube Homogenizer Benchmark D1030
    2.0 mL screw-cap tubes with sealing rings Sigma-Aldrich Z763837-1000EA
    Gel loading tips Fisher Scientific 07-200-288
    Cuvettes Fisher Scientific 50-476-476
    Parafilm Fisher Scientific 13-374-10
    50 mL conical tubes Fisher Scientific 14-432-22
    384-Well PCR Plate Fisher Scientific AB-1384W
     Gyratory Floor Shaker New Brunswick Scientific Model G10
    Spectrophotometer ThermoScientific ND-2000c
     Real-Time PCR Detection System Bio-Rad 1855485

    DOWNLOAD MATERIALS LIST

    References

    1. Jaiswal, D., Turniansky, R., Green, E. M. Choose Your Own Adventure: The Role of Histone Modifications in Yeast Cell Fate. J Mol Biol. 429, (13), 1946-1957 (2017).
    2. Suganuma, T., Workman, J. L. Signals and combinatorial functions of histone modifications. Annu Rev Biochem. 80, 473-499 (2011).
    3. Solomon, M. J., Varshavsky, A. Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures. P Natl Acad Sci USA. 82, (19), 6470-6474 (1985).
    4. Solomon, M. J., Larsen, P. L., Varshavsky, A. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell. 53, (6), 937-947 (1988).
    5. Gilmour, D. S., Lis, J. T. Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes. P Natl Acad Sci USA. 81, (14), 4275-4279 (1984).
    6. Lefrançois, P., et al. Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics. 10, 37 (2009).
    7. Furey, T. S. ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet. 13, (12), 840-852 (2012).
    8. Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic Loci. Cell. 136, (1), 175-186 (2009).
    9. Byrum, S. D., Raman, A., Taverna, S. D., Tackett, A. J. ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep. 2, (1), 198-205 (2012).
    10. Soldi, M., Bremang, M., Bonaldi, T. Biochemical systems approaches for the analysis of histone modification readout. Biochim Biophys Acta. 1839, (8), 657-668 (2014).
    11. Soldi, M., Bonaldi, T. The ChroP approach combines ChIP and mass spectrometry to dissect locus-specific proteomic landscapes of chromatin. J Vis Exp. (86), (2014).
    12. Kuo, M. H., Allis, C. D. In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment. Methods. 19, (3), 425-433 (1999).
    13. Meluh, P. B., Broach, J. R. Immunological analysis of yeast chromatin. Methods Enzymol. 304, 414-430 (1999).
    14. Rozen, S., Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132, 365-386 (2000).
    15. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods. 50, (4), S1-S5 (2010).
    16. Rodríguez, A., Rodríguez, M., Córdoba, J. J., Andrade, M. J. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol. 1275, 31-56 (2015).
    17. Briggs, S. D., et al. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Gene Dev. 15, (24), 3286-3295 (2001).
    18. Bernstein, B. E., et al. Methylation of histone H3 Lys 4 in coding regions of active genes. P Natl Acad Sci USA. 99, (13), 8695-8700 (2002).
    19. Pokholok, D. K., et al. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122, (4), 517-527 (2005).
    20. Krogan, N. J., et al. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell. 11, (3), 721-729 (2003).
    21. South, P. F., Harmeyer, K. M., Serratore, N. D., Briggs, S. D. H3K4 methyltransferase Set1 is involved in maintenance of ergosterol homeostasis and resistance to Brefeldin A. P Natl Acad Sci USA. 110, (11), E1016-E1025 (2013).
    22. Margaritis, T., et al. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3'-end antisense transcription. PLoS Genet. 8, (9), e1002952 (2012).
    23. Jezek, M., et al. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance. Epigenetics. 12, (2), 93-104 (2017).
    24. Suka, N., Luo, K., Grunstein, M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat Genet. 32, (3), 378-383 (2002).
    25. Kimura, A., Umehara, T., Horikoshi, M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 32, (3), 370-377 (2002).
    26. Rothbart, S. B., et al. An Interactive Database for the Assessment of Histone Antibody Specificity. Mol Cell. 59, (3), 502-511 (2015).
    히스톤 수정 <em>Saccharomyces cerevisiae</em> 에서 chromatin Immunoprecipitation (칩)
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).More

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter