Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Chromatine Immunoprecipitation (ChIP) van Histone modificaties van Saccharomyces cerevisiae

doi: 10.3791/57080 Published: December 29, 2017

Summary

Hier beschrijven we een protocol voor het chromatine immunoprecipitation van gemodificeerde histonen uit de ontluikende gist Saccharomyces cerevisiae. Immunoprecipitated DNA wordt vervolgens gebruikt voor kwantitatieve PCR te ondervragen de overvloed en lokalisatie van Histon posttranslationele modificaties in het genoom.

Abstract

Histon posttranslationele modificaties (PTMs), zoals acetylation, methylation en fosforylatie, worden dynamisch geregeld door een aantal enzymen die toevoegen of verwijderen van deze merken in reactie op signalen ontvangen door de cel. Deze PTMS zijn belangrijke bijdragen aan de regulatie van processen zoals gen expressie controle en reparatie van DNA. Immunoprecipitation (chIP) van de chromatine is een instrumentele aanpak voor het ontleden van de overvloed en lokalisatie van vele Histon PTMs in het genoom in reactie op diverse verstoringen naar de cel. Hier is een veelzijdige methode voor het uitvoeren van chIP van post-translationally gemodificeerde histonen uit de ontluikende gist Saccharomyces cerevisiae (S. cerevisiae) beschreven. Deze methode berust op crosslinking van eiwitten en DNA met behulp van formaldehyde behandeling van gist culturen, generatie van gist lysates door parel verslaan, solubilisatie van chromatine fragmenten door micrococcal nuclease en immunoprecipitation van Histon-DNA complexen. DNA die is gekoppeld aan het merk Histon van belang is gezuiverd en onderworpen aan kwantitatieve PCR analyse om te evalueren van de verrijking op meerdere loci gedurende het genoom. Representatieve experimenten sonderen de lokalisatie van de Histon merken H3K4me2 en H4K16ac in wildtype en mutant gist worden besproken om aan te tonen van data-analyse en interpretatie. Deze methode is geschikt voor een verscheidenheid van Histon PTMs en kan worden uitgevoerd met verschillende gemuteerde stammen of in de aanwezigheid van diverse milieu benadrukt, waardoor het een uitstekend hulpmiddel voor het onderzoeken van veranderingen in de dynamiek van de chromatine onder verschillende omstandigheden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De dynamische posttranslationele wijziging (PTM) van histones is een belangrijke regelgevende mechanisme voor vele DNA-templated processen, waaronder transcriptie, replicatie en DNA repair1,2. De mogelijkheid om de overvloed en precieze lokalisatie van gemodificeerde histonen gelijktijdig met deze processen is daarom cruciaal te begrijpen hun verordening onder verschillende omstandigheden in de cel. De ontwikkeling van chromatine immunoprecipitation (chIP) als een methode die grotendeels voortvloeide uit de biochemische studies van de interacties tussen eiwitten en DNA, met name in vitro methoden met behulp van chemische crosslinkers, in combinatie met de noodzaak om de dynamiek van eiwit-DNA interacties in vivo en in specifieke regio's van het genoom3,4,5. De vooruitgang van kwantitatieve PCR (qPCR) en sequencing technologieën heeft ook uitgebreid de mogelijkheid om uit te voeren van de experimenten van de chIP met kwantitatieve vergelijkingen en over het geheel genomen, waardoor het een krachtig hulpmiddel voor het ontleden van DNA-eiwit interactie op meerdere niveaus.

ChIP is momenteel een vereiste methode voor elke onderzoeksgroep kochten chromatine-gemedieerde regulering van het genoom zoals er geen vergelijkbare methoden zijn voor het rechtstreeks ondervragen van de fysieke verbinding tussen een gemodificeerde histone en een specifieke genomic locus in vivo. Hoewel er variaties van deze methode met behulp van de volgende generatie sequencing toewijzen histone modificaties gedurende de genoom6,7 beschikbaar zijn, kunnen deze benaderingen betrekking hebben op verschillende wetenschappelijke vragen en hun omvang, kosten en technische middelen kunnen worden beperkt voor sommige onderzoeksgroepen. Bovendien, gerichte chIP-qPCR is noodzakelijk als aanvulling op deze benaderingen door middel van methoden om beide te optimaliseren het chIP-protocol vóór sequencing en valideren van resultaten van de epigenomic datasets. Massaspectrometrie gebaseerde benaderingen voor de identificatie van de volledige aanvulling van Histon merken die zijn gekoppeld aan de genomic regio's ook hebben ontstaan8,9,10,11, echter deze benaderingen hebben sommige beperkingen met betrekking tot die regio's van het genoom kunnen worden bestudeerd en zij vereisen technische expertise en instrumentatie die niet beschikbaar voor alle onderzoeksgroepen is. ChIP blijft derhalve een fundamentele methode voor het analyseren van de omvang en de verdeling van Histon modificaties onder uiteenlopende omstandigheden voor alle onderzoeksgroepen kochten epigenetica, chromatine en de regeling van genomic functies.

Hier beschrijven we een methode voor chIP met behulp van de ontluikende gist Saccharomyces cerevisiae (S. cerevisiae) om te onderzoeken van de verdeling van Histon PTMs op chromatine model. Deze aanpak is afhankelijk van een aantal kernonderdelen van chIP protocollen ontwikkeld in gist en ook toegepast op uiteenlopende model systemen12,13. Interacties tussen gemodificeerde histonen en DNA in de cel worden bewaard door crosslinking met formaldehyde. Na de lysate bereiding, chromatine fragmenten zijn ontbindend in uniform en middelgrote fragmenten door spijsvertering met micrococcal nuclease. Immunoprecipitation van de gemodificeerde histonen is uitgevoerd met commerciële of lab-gegenereerd antilichamen en eventuele bijbehorende DNA is geïsoleerd en geanalyseerd voor verrijking op bepaalde genomic regio's met behulp van qPCR (Figuur 1). Voor vele histone modificaties volstaat de hoeveelheid DNA die dit protocol verkregen voor het testen van meer dan 25 verschillende genomic loci door qPCR.

Deze chIP methode is zeer veelzijdig voor het toezicht op de verdeling van een enkele Histon wijziging op meerdere gemuteerde stammen of milieuomstandigheden, of voor het testen van meerdere histone modificaties in wildtype cellen bij een aantal genomic loci. Bovendien zijn talrijke onderdelen van het protocol gemakkelijk instelbaar tot opsporing van beide zeer - of nederig-overvloedig Histon merken optimaliseren. Ten slotte, uitvoeren van chIP van gemodificeerde histonen in ontluikende gist biedt de mogelijkheid om belangrijke besturingselementen gebruiken voor antilichamenspecificiteit die grotendeels niet beschikbaar zijn in andere systemen. Namelijk, giststammen kunnen worden gegenereerd die puntmutaties in Histon residuen die zijn gericht tot wijziging draagt, en, in sommige gevallen is er slechts een enkele enzym dat wijziging op een bepaalde Histon residu katalyseert (bv. Histon lysine methyltransferases). Daarom kan de chIP worden uitgevoerd in ofwel de Histon mutant of enzym schrapping stammen te assay de mate waarin niet-specifieke binding van het antilichaam kan worden voorkomen en het genereren van vals-positieve resultaten. Dit besturingselement is bijzonder waardevol voor nieuw ontwikkelde antilichamen, en kan zelfs worden gebruikt om te valideren antilichamenspecificiteit voor geconserveerde histone modificaties voorafgaand aan hun gebruik in andere systemen. Deze aanpak vormt een aanvulling op andere methoden om antilichamenspecificiteit test die onderscheid maken tussen verschillende wijziging Staten (zoals mono-, di- en tri-methylering), met inbegrip van sonderen matrices van gemodificeerde peptiden en uitvoeren van westelijke vlekken van histones of nucleosomes met gedefinieerde wijzigingen. Globaal, chIP in de ontluikende gist is een krachtige methode voor de beoordeling van de dynamiek van Histon PTMs in het genoom en het ontleden van de mechanismen inzake hun verordening.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. pre bind-antistoffen tegen magnetische kralen

  1. Meng het eiwit A/G magnetische kralen goed en breng 20 µL van magnetische kralen per één immunoprecipitation (IP) monster tot een 1,5 mL koker.
    Opmerking: Wanneer pipetteren kralen, wide-boring, lage-retentie tips gebruiken.
  2. Plaats de buis met kralen in een magnetische stand en laat van parels om te verzamelen aan de kant van de buis. Verwijder het supernatant.
  3. Wassen van de parels 3 keer met 1 mL koude Tris-gebufferde zoutoplossing (TBS) (50 mM Tris-HCl pH 7.5, van 150 mM NaCl).
  4. Voeg toe 200 µL van TBS aan kralen en geschikte hoeveelheid van een antilichaam. Draaien op 8 rpm's nachts bij 4 ° C.
    Opmerking: Voor veel Histon PTM antilichamen, 1-3 µg antilichaam per IP volstaat. Titratie experimenten zijn echter aanbevolen om te bepalen van de juiste concentraties. Aanbevolen concentraties voor goed gekarakteriseerd, commerciële Histon PTM antilichamen zijn vaak nauwkeurig en kunnen worden gevonden in gepubliceerde rapporten of Productliteratuur.
  5. Plaatst u de kralen in een magnetische standaard en verwijder de bovendrijvende substantie. Ze wassen met 1 mL eetlepels
  6. Resuspendeer de kralen in 20 µL van TBS per IP-monster plus een extra 5 µL (in geval van pipetting fout) eetlepels
    Opmerking: De kralen kunnen worden opgeslagen op korte termijn bij 4 ° C tot gebruik.

2. gistcellen groeien

  1. 10 mL YPD (20% pepton, gistextract van 10% en 20% dextrose) inoculeren met een één kolonie van de juiste spanning en groeien bij 30 ° C's nachts in een schudden incubator van 220 toeren per minuut.
  2. Meten van de extinctie op 600 nm (OD600) van de cultuur van de gist met een spectrofotometer. Verdun de cultuur op een OD600 = 0,2 in 100 mL YPD in een maatkolf van nieuwe.
  3. De cellen bij 30 ° C in een schudden incubator op 220 rpm groeien totdat ze halverwege log fase (OD600 = 0,6-0,8).

3. in Vivo Crosslinking van eiwitten aan DNA

  1. Wanneer culturen halverwege log fase bereikt, 2,7 mL van 37% formaldehyde rechtstreeks toevoegen aan het medium, voor een eindconcentratie van 1% formaldehyde. De kolf overbrengen in een shaker bij 25 ° C (of kamertemperatuur) en schud het op 50 rpm gedurende 15 minuten.
  2. Voeg 5 mL 2,5 M glycine aan het medium en blijven schudden bij 50 rpm bij kamertemperatuur gedurende 5 minuten om quench de formaldehyde.
  3. Overdracht van de cellen om te centrifugeren flessen en draaien de cellen bij 5800 x g gedurende 5 min bij 4 ° C. Decanteren supernatant.
    1. Spoel de cellen door resuspending hen in 45 mL koude TBS en spoel de suspensie in een conische tube van 50 mL. Draai de buis bij 2800 x g gedurende 3 min bij 4 ° C. Verwijder het supernatant.
    2. Wash die de cellen in 10 mL koude chIP Lysis-buffermengsel (50 mM Tris-HCl pH 7.5, van 150 mM NaCl, 1 mM ethyleendiamminetetra azijnzuuroplossing (NA2EDTA), 1% nonidet octyl phenoxypolyethoxylethanol (NP-40), opgeslagen bij 4 ° C).
    3. Draai de cellen bij 2800 x g gedurende 3 min bij 4 ° C. Verwijder het supernatant.
      Opmerking: Cellen kunnen worden met vloeibare stikstof bevroren en opgeslagen bij-80 ° C, totdat zij worden verwerkt.

4. Maak de gist Lysates

  1. Resuspendeer de cellen in 1 mL koude ChIP Lysis-buffermengsel met 1 mM phenylmethylsulfonyl fluoride (PMSF) en 1:1,000 verdunning van de gist proteaseinhibitor cocktail. Spoel de suspensie tot een 2,0 mL schroefdop koker met 200 µL van glaskralen.
  2. De cellen overbrengen in een kraal gewonnen van toestellen voor hoge snelheid agitatie bij 4 ° C en kraal beat 6 keer voor 30 s elke. Houden van de cellen in de ijskast voor minstens 1 min tussen elke parel gewonnen.
  3. De lysate overbrengen naar een 1,5 mL-buis met behulp van gel laden van tips. Centrifugeer het lysate bij 15.500 x g gedurende 20 min bij 4 ° C.
  4. Verwijder het supernatant en resuspendeer de pellet in 250 µL van MNase spijsvertering Buffer (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2, 21 mM CaCl2, 1% NP-40, opgeslagen bij 4 ° C) door pipetteren zachtjes op en neer.
  5. 2.5 µL van MNase aan de reacties toevoegen. Meng ze zachtjes door het omkeren van 4 - 6 maal en Incubeer het onmiddellijk in een waterbad 37 ° C gedurende 20 minuten.
    Opmerking: Digest voorwaarden moeten worden geoptimaliseerd wanneer een nieuwe voorraad van MNase wordt gebruikt. Zie stap 10 voor het protocol.
  6. Onmiddellijk plaats de buizen op ijs zet de reactie stop en voeg 5 µL van het EDTA 0.5 M voor een eindconcentratie van 10 mM EDTA. Meng ze zachtjes door inversie.
  7. Centrifugeer de reactie bij 15.500 x g gedurende 15 min bij 4 ° C en het supernatant overbrengen in een nieuwe 1,5 mL-buis.
    Opmerking: Oplosbare (verteerd) chromatine worden in het supernatant. De pellet bevat iets onverteerd en onoplosbare cel puin.

5. Immunoprecipitate (IP) bewerkt Histones

  1. Bepaal de eiwitconcentratie van elk MNase-vrijgegeven chromatine breuk met behulp van een analyse van Bradford. Voeg 1 mL Bradford reagens aan elk van de 8 wegwerp cuvettes plus 1 extra cuvette voor elke eiwitSteekproef te beproeven.
    1. Voorbereiden van een stamoplossing van 2 mg/mL bovien serumalbumine (BSA).
    2. Voeg het juiste volume om de volgende concentraties van BSA in 1 mL Bradford reagens: 0 μg/mL, 0,5 μg/mL, 1 μg/mL, 2 μg/mL, 4 μg/mL, 6 μg/mL, 8 μg/mL en 10 μg/mL. 2 μL van de MNase-vrijgegeven chromatine breuk aan de extra cuvettes toevoegen.
    3. Bedek de bovenkant van elke Cuvet met een klein stukje parafilm en omkeren de cuvettes 4 - 6 maal de oplossing goed mengen. Incubeer de cuvettes bij kamertemperatuur gedurende 15 minuten.
    4. Met behulp van een zichtbaar licht spectrofotometer, meet de extinctie op 595 nm voor de standaard curve en experimentele monsters.
      Opmerking: Gebruik de cuvette zonder BSA (0 μg/mL) tot de spectrofotometer alvorens de eerste meting leeg.
    5. Het uitzetten van een standaard curve met behulp van de extinctie-waarden voor de verschillende concentraties van BSA op software die is gekoppeld aan de spectrofotometer of spreadsheet-software. Gebaseerd op de standaard curve en de verdunningsfactor gebruikt (1:500), de absorptie-waarden gebruiken voor het berekenen van de eiwitconcentratie voor elk van de chromatine breuk monsters.
  2. Voor elk IP, wil 50 µg totale eiwitten uit de MNase-vrijgegeven chromatine afvalfractie ChIP Lysis-buffermengsel tot een eindvolume van 1 mL.
    Opmerking: Als het opzetten van meer dan één IP per lysate, maken een master mix van de lysate en ChIP Lysis Buffer en aliquoot 1 mL tot afzonderlijke buizen voor het onderzoektijdvak.
  3. Verwijder 100 µL van de IP-mix te verwerken als de input monster. Het bevriezen van het input monster bij-20 ° C tot stap 7.1.
    Opmerking: Alle resterende chromatine monster kan ook worden bevroren bij-20 ° C en gebruikt voor een latere IP indien gewenst.
  4. Voeg 20 µL van magnetische eiwit A/G kralen vooraf gebonden met antilichaam aan elk IP-monster.
Draaien van het monster bij 8 omwentelingen per minuut gedurende 3 uur (standaard) of overnachting (indien gewenst) bij 4 ° C.

6. wassen IPs en elueer Histone-DNA complexen

  1. Plaats van de buizen in een magnetische standaard en laat kralen verzamelen aan de kant van de buis. Verwijder de bovendrijvende vloeistof met behulp van een precisiepipet. Wassen van de kralen achtereenvolgens met 1 mL van elk van de onderstaande buffers.
    1. Uitvoeren van elk wassen met roterende bij 8 omwentelingen per minuut gedurende 5 minuten bij 4 ° C, plaatsen van kralen in een magnetische stand bovendrijvende vloeistof verwijderen en toevoegen van volgende buffer: 2 x - ChIP Lysis-buffermengsel, 2 x - hoge zout was Buffer (50 mM Tris-HCl pH 7.5, 500 mM NaCl, 1 mM EDTA 1% NP-40, opgeslagen bij 4 ° C), 1 x - LiCl/wasmiddel wassen Buffer (10 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% natrium deoxycholate, opgeslagen bij 4 ° C), 1 x - TE (10 mM Tris-HCl pH 8,0, 1 mM EDTA, opgeslagen bij 4 ° C), en 1 x - TE.
    2. Met de laatste TE wassen, kunt u het kralen overbrengen door een nieuwe buis overbrengen van de meeste van de kralen, dan nog eens 0,5 mL TE wassen van de buis en de overdracht van de resterende kralen met 0,5 mL voor TE.
  2. Voeg 250 µL van versgemaakte ChIP elutie Buffer (1% SDS, 1 mM NaHCO3). Vortex de oplossing kort. Draaien van de monsters bij 8 omwentelingen per minuut gedurende 15 minuten bij kamertemperatuur.
  3. Plaats buis in een magnetische staan en het verzamelen van de kralen. Zorgvuldig het supernatant overbrengen in een nieuwe buis en te voorkomen dat de kralen.
    Opmerking: Het eluaat bevat immunoprecipitated eiwitten en bijbehorende DNA.
  4. Voeg een andere 250 µL van ChIP elutie Buffer aan kralen. Draaien van de monsters bij 8 omwentelingen per minuut gedurende 15 minuten bij kamertemperatuur.
  5. Zorgvuldig overbrengen in het supernatant de buis met de eerste elutie. Indien nodig, een kleiner volume (240 µL) verwijderen voor alle IP-adressen om te voorkomen dat de kralen verstoren.

7. omgekeerde eiwit-DNA Crosslinks

  1. Ontdooi de input monsters en 400 µL van ChIP elutie Buffer toevoegen aan elke input.
  2. Aan zowel de invoer als IP-monsters, Voeg 20 µL van 5 M NaCl, 5 µL van 20 mg/mL glycogeen en 12,5 µL van 20 mg/mL proteïnase K. Mix goed door omkeren of flicking buizen. Incubeer de monsters in een waterbad van 65 ° C's nachts.

8. zuiveren en concentreren van DNA

  1. Voeg toe 10 µL van 10mg/mL RNase A aan de invoer- en IP-monsters. Incubeer de monsters in een waterbad 37 ° C gedurende 30 minuten.
  2. 600 µL van fenol: chlorofrom:isoamyl alcohol (25:24:1 PCI) toevoegen aan de waterige oplossing en meng ze goed. Draaien ze bij 15.500 x g gedurende 5 minuten bij kamertemperatuur.
    1. Verwijder de waterige laag een nieuwe buis. Voeg 600 µL van PCI en meng ze goed. Draai de buis bij 15.500 x g gedurende 5 minuten bij kamertemperatuur. De waterige laag overbrengen in een nieuwe buis.
      Let op: Werk in de zuurkast en passende persoonlijke beschermingsmiddelen dragen bij het werken met PCI. Beschikken over vloeibare en vaste afvalstoffen zoals geïnstrueerdg door institutionele richtsnoeren.
  3. 0.1 x volume 3M natriumacetaat en 1 mL koude 100% ethanol te precipiteren van DNA toevoegen. Omkeren van de buis 4 - 6 maal de oplossing goed mengen. Incubeer bij-20 ° C's nachts.
    1. Draai de buis bij 15.500 x g gedurende 20 min bij 4 ° C. Verwijder voorzichtig het supernatant met een pipet.
    2. Het wassen van de pellet in 1 mL koude 70% ethanol. Draai het bij 15.500 x g gedurende 10 minuten bij 4 ° C. Verwijder voorzichtig het supernatant met een pipet.
    3. Luchtdroog de korrels in de kap gedurende ongeveer 20 minuten (totdat het helemaal droog is). Resuspendeer IP-monsters in 50 µL nuclease-gratis water en resuspendeer input monsters in 100 µL van nuclease-gratis water. Bewaren van de DNA-monsters bij-20 ° C tot het uitvoeren van qPCR.

9. kwantitatieve PCR (qPCR) detecteren verrijkt Genomic regio 's

  1. Maak een qPCR master mix voor elke reeks inleidingen. Één reactie bevat 5 µL van 2 x qPCR-mix, 0,25 µL van 20 µM voorwaartse primer en 0,25 µL van 20 µM omgekeerde primer.
    Opmerking: Goede primer ontwerp en tests voor qPCR experimenten zijn elders beschreven14,15,16.
  2. Het maken van DNA master mixen voor elk DNA-monster. Één reactie bevat 0,5 µL van DNA en 4.0 µL van nuclease-gratis water.
  3. 5.5 µL van de master mix van geschikte primer en 4.5 µL van de juiste master mix van DNA toevoegen aan elk putje op een 384-well qPCR plaat.
    Opmerking: Starten met het toevoegen van 5.5 µL van de primer mix aan elk putje. Draai de plaat bij 200 x g gedurende 1 minuut bij kamertemperatuur alvorens 4.5 µL van het mengsel van DNA toe te voegen.
  4. Houden het zegel aan de plaat en draai bij 200 x g gedurende 1 minuut bij kamertemperatuur.
  5. Uitvoeren van qPCR met behulp van een systeem real-time qPCR met de volgendevoorwaarden: 95 ° C gedurende 3 min; 40 cycli van 95 ° C voor 10 s, 55 ° C gedurende 30 s; smeltende kromme 65 ° C tot 95 ° C met stappen van 0,5 ° C, 5 s.
  6. Voor elk paar primer, berekenen de percentage input van het IP-monster ten opzichte van de 5% input staal dat wordt gebruikt in de qPCR. Gebruik de middelen van de technische triplicates van de PCR de berekeningen uit te voeren.
    Opmerking: Als de aanzienlijke variatie wordt waargenomen in de PCR triplicates, is het het beste om te herhalen van de qPCR met aandacht voor master mix samenstelling, pipetting fouten en kruisbesmetting tussen putten in de 384-well plaat.
    1. Waardecorrecties op Cq voor de invoer voor 100% door af te trekken van het aantal cycli die de verdunningsfactor van de ruwe Cq waarden vertegenwoordigen.
      Opmerking: Vijf procent invoer vertegenwoordigt een verdunningsfactor van 20-fold, die gelijk is aan 4,32 cycli (aanmelden2 20 = 4.32).
    2. Bereken het percentage invoeren als 2 ^ (Cqinput - CqIP) vermenigvuldigd met 100.

10. Bepaal MNase Digest voorwaarden (aanbevolen voorafgaand aan de eerste volledige chIP Experiment)

  1. Stappen 2.1 via 4.4 van het voorgaande protocol. Het protocol voor het genereren van genoeg lysate voor meerdere voorbeelden van MNase spijsvertering van de chromatine-bevattende pellet opschalen. Resuspendeer de pellets in 1,25 mL MNase spijsvertering Buffer bij stap 4.4. De monsters 5 buizen dus dat elk aliquot bevat 250 µL van de geresuspendeerde in MNase spijsvertering Buffer chromatine-pellet.
  2. Toevoegen van 0, 1,5, 2,5 of 5 µL van MNase aan elke buis. Meng ze zachtjes door het omkeren van 4 - 6 maal en onmiddellijk uit te broeden de buizen in een waterbad 37 ° C gedurende 20 minuten.
  3. Stoppen reacties door onmiddellijk het plaatsen van de buizen op ijs en het toevoegen van 5 µL van het EDTA 0.5 M voor een eindconcentratie van 10 mM.
Meng de oplossing voorzichtig door inversie.
  • Centrifugeer de buizen bij 15.500 x g gedurende 15 min bij 4 ° C en het supernatant overbrengen in een nieuwe 1,5 mL-buis.
  • SDS toevoegen aan de definitieve concentratie van 1% (25 µL van de stockoplossing 10%) en NaHCO3 tot en met 0,1 M eindconcentratie (25 µL van 1 M stockoplossing) aan de monsters in de 1,5 mL tubes.
  • Voeg toe 20 µL van 5M NaCl, 5 µL van glycogeen en 12,5 µL van 20mg/mL proteïnase K aan de monsters in de 1,5 mL tubes. Ze bij 65 ° C na een nacht bebroeden.
  • Voeg 10 µL van 10 mg/mL RNaseA. Incubeer bij 37 ° C gedurende 30 minuten.
  • 300 µL van PCI toevoegen aan de waterige oplossing en meng ze goed. Spin bij 15.500 x g gedurende 5 minuten bij kamertemperatuur.
    1. Verwijderen van waterige laag een nieuwe buis. Voeg 300 µL van PCI en meng goed. Spin bij 15.500 x g gedurende 5 minuten bij kamertemperatuur. Waterige laag overbrengen in een nieuwe buis.
  • 0.1 x volume 3 M Natriumacetaat (meestal ~ 30 µL) en 1 mL koude 100% ethanol te precipiteren van DNA toevoegen. Omkeren van de buis 4 - 6 maal goed mengen. Incubeer de buis bij-80 ° C gedurende 1 uur of -20 ° C's nachts.
    1. Draai de buis bij 15.500 x g gedurende 20 min bij 4° C. Verwijder voorzichtig de bovendrijvende vloeistof met een pipet.
    2. Het wassen van de pellets in 1 mL koude 70% ethanol. Spin bij 15.500 x g gedurende 10 minuten bij 4 ° C.
    3. Laat die de pellets drogen in de kap ongeveer 20 min (of totdat het helemaal droog). Resuspendeer de pellets in 30 µL van nuclease-gratis water.
  • Voeg het DNA laden kleurstof en 20 µL draaien op een 2% agarose gel te visualiseren verteerd DNA.
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Een belangrijk onderdeel van dit protocol is het optimaliseren van de concentratie van micrococcal nuclease (MNase) gebruikt om te verteren de chromatine in oplosbare fragmenten, zoals beschreven in stap 10. Dit is essentieel voor het verkrijgen van hoge resolutie gegevens met betrekking tot de verdeling van Histon modificaties aan de genomic regio's van belang. Een MNase titratie moet worden uitgevoerd om te bepalen van de meest geschikte concentratie te bereiken vooral mono-nucleosomes met een kleinere hoeveelheid di-nucleosomes in de oplosbare chromatine-Fractie. Dit kan worden gevisualiseerd door extractie van DNA na vertering van de MNase van de chromatine-bevattende pellet en uitvoeren van agarose gel elektroforese (Figuur 2). In de voorbereiding van de MNase hier gebruikt, 2.5 µL van enzym op 20 eenheden/µL geproduceerd overwegend mono-nucleosomes en daarom dit bedrag werd gebruikt voor de chIP.

    Twee sets van representatieve resultaten worden weergegeven voor deze chIP procedure (Figuur 3). In het eerste voorbeeld wordt een Histon methyl mark geëvalueerd wildtype cellen of cellen ontbreekt de methyltransferase die dit merk katalyseert. Specifiek, werd chIP met een antilichaam tegen H3K4me2, maar ook tegen Histon H3 uitgevoerd als een besturingselement, in wildtype en set1Δ cellen. H3K4me2 voornamelijk lokaliseert net stroomafwaarts van de transcriptie start site eind 5' codering van regio's en, bij gebrek aan Set1, H3K4me2 kunnen niet worden gedetecteerd in cellen17,18,19. De stam van de Δ set1daarom dient als controle om aan te geven van de hoeveelheid achtergrond signaal dat kan worden toegeschreven aan niet-specifieke binding van andere Histon merken of DNA aan het antilichaam. In dit geval, de stam van wildtype toonde duidelijk verrijking voor H3K4me2 aan het einde 5' van de twee genen bekend als de directe doelen van Set1, PMA1 en ERG1120,21, terwijl geen signaal werd waargenomen in set1Δ cellen (figuur 3A). Zoals verwacht, is er geen verrijking van het merk H3K4me2 telomeer (TEL) 07 L. De expressie van het middelste sporevorming gen SPR3 is ook gemeld worden gereguleerd door Set122,23, maar de verrijking van H3K4me2 aan het einde 5' van de SPR3 ORF meest overeen met de waargenomen niveaus komt op TEL07L, in vergelijking met ofwel PMA1 of ERG11. Evaluatie van de lokalisatie van deze methyl-merk geeft aan dat Set1-gemedieerde regulering van SPR3 dreigt te ontstaan door een ander mechanisme dan op PMA1 of ERG11, als eerder waargenomen22.

    In het tweede voorbeeld, is de chIP van geacetyleerd H4K16 komt te staan ten opzichte van Histon H4 in wildtype cellen en cellen ontbreekt de histone deacetylase Sir2, die Hiermee verwijdert u H4K16ac merken. H4K16ac is uitgeput in de hétérochromatique-achtige chromatine dichtbij de telomeer, en verrijkt met euchromatine meer distale uit de telomeer24,25, zoals voor TEL07L en TEL15L (figuur aangetoond 3B). Daarnaast het verlies van Sir2 veroorzaakt een toename H4K16ac op specifieke regio's Telomere en subtelomeric, hoewel geen verandering wordt geconstateerd bij de controle-gene PMA1, waar Sir2 is niet bekend om te lokaliseren. Terwijl deze gegevens een duidelijke stijging in H4K16ac niveaus in sir2Δ cellen tonen, worden de gedetecteerde verandering in H4K16ac, die niet naar verwachting worden zo groot als de verandering in H3K4me2 in wildtype versus set1Δ cellen, verborgen als chIP parameters zijn niet goed geoptimaliseerd. Aanbevelingen voor optimalisatie worden beschreven in de discussie.

    Figure 1
    Figuur 1: Tijdlijn van chIP procedure. Het typisch schema voor het protocol van de chIP wordt weergegeven. Mogelijke variaties zijn aangegeven in de tekst. Klik hier voor een grotere versie van dit cijfer.

    Figure 2
    Figuur 2: Test MNase spijsvertering voor solubilisatie van mono-nucleosomes. Agarose de Elektroforese van het gel van DNA geïsoleerd na vertering van de chromatine pellet met wisselende hoeveelheden van MNase (20 eenheden/µL). DNA van mononucleosomes migreert bij ongeveer 150 bp, uit dinucleosomes op ongeveer 300 bp en DNA van polynucleosomes is te vinden op steeds hoger molecuulgewicht. Klik hier voor een grotere versie van dit cijfer.

    Figure 3
    Figuur 3 : ChIPs van H3K4me2 en H4K16ac in wildtype en mutant giststammen. (A) ChIP met antilichamen tegen H3K4me2 en H3 werd uitgevoerd in wildtype en set1Δ cellen. Percentage input werd berekend voor elk paar primer voor zowel de H3K4me2 als de H3 IPs en de verhouding is opgenomen in een grafiek om aan te geven van de relatieve verrijking van H3K4me2 op de aangegeven loci. De inleidingen voor PMA1, ERG11 en SPR3 genereren waarbij aan het einde 5' van elke ORF, overwegende dat het TEL07L primer paar grenzend aan de telomeer op de linker arm van chromosoom 7. Het gemiddelde van drie biologische replicatieonderzoeken weergegeven en worden de foutbalken vertegenwoordigen de standaardfout van het gemiddelde. (B) ChIP werd uitgevoerd met antistoffen herkennen H4K16ac en H4 in wildtype en sir2Δ cellen en uitgezet als beschreven voor het figuur 3A. Primerparen amplify sequenties grenzend aan de telomeren (TEL07L en TEL15L) en downstream binnen eerder gedefinieerde euchromatique regio's van elke subtelomere (21 kb en 5 kb distale uit de telomeer, respectievelijk).Klik hier voor een grotere versie van dit cijfer.

    Stam nummer Genotype Referentie
    yEG230 MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 23
    yEG223 MATα sir2Δ::NATMX Deze studie
    yEG232 MATa set1Δ::KANMX 23

    Tabel 1: Giststammen gebruikt in deze studie.

    Oligo-nummer Locatie Volgorde
    oEG141 TELVIIL F AGCCCGAGCCTGTACTAAAT
    oEG142 TELVIIL R CAAAAGAAACTTTTCATGGCA
    oEG153 5' PMA1 F TCAGCTCATCAGCCAACTCAAG
    oEG154 5' PMA1 R CGTCGACACCGTGATTAGATTG
    oEG220 TELVIIL + 21KB F AAACAATGGGACCCTTCTGA
    oEG221 TELVIIL + 21KB R AACACCTTGCAAAACACAGG
    oEG280 TELXVL F ATCCTGCAATTGGGCCACTAT
    oEG281 TELXVL R AGCGGAAGGCATATTAACGT
    oEG282 TELXVL + 5KB F AGGCGATGTAATCTCACCAA
    oEG283 TELXVL + 5KB R CATTCACACATCCTGCTACCA
    oEG568 ERG11 F CCTCTTATTCCGTCGGTGAA
    oEG569 ERG11 R TGTGTCTACCACCACCGAAA
    oEG963 SPR3 F TCTGGATTCGCTGAGGAAGT
    oEG964 SPR3 R TTTCAGTTCAGGGCTTTTCG

    Tabel 2: Inleidingen gebruikt in deze studie.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    De hier beschreven procedure zorgt voor de efficiënte herstel van DNA in verband met gewijzigde histonen in gistcellen door immunoprecipitation. Dit wordt gevolgd door de qPCR gebruikend inleidingen die nadere uitwerking van de regio's van belang zijn voor het bepalen van de lokale verrijking of uitputting van specifieke histone modificaties. Ondanks de bijna twintig jaar geleden als een methode ontwikkeld, blijft chIP de bepalende assay voor het onderzoeken van de status van de wijziging van de Histon op verschillende genomic gebieden en onder uiteenlopende omstandigheden. Hoewel chIP gekoppeld aan de volgende generatie sequencing technologieën histone modificaties op een genoom-brede schaal6,7 ondervragen kunnen, kunnen de kosten en de vereiste data-analyse van deze benaderingen hun gebruik in sommige lab instellingen beperken. Bovendien zijn deze epigenomic experimenten vaak gevolgd door chIP gekoppeld aan qPCR voor het valideren van de opmerkingen van de status van de wijziging van de Histon bij sommige genomic loci. Er zijn weinig vergelijkbare methoden waarmee het nut van chIP in fysiek een Histon mark (of andere eiwit) koppelen aan een bepaalde locatie binnen het genoom en het analyseren van de dynamiek van deze interactie in de verschillende milieu- of biologische omstandigheden . Hoewel er recente succes is in het isoleren van de chromatine van gedefinieerde genomic regio's en het identificeren van de lokale Histon merken met behulp van massaspectrometrie8,9,10,11, deze methoden vormen technische uitdagingen en hun nut in verschillende uiteenlopende lab typen kunnen worden beperkt door adequate toegang tot middelen voor massaspectrometrie instrumentatie en data analyse. Het protocol hier beschreven is technisch en economisch toegankelijk voor uiteenlopende lab instellingen, met de primaire mogelijk hindernis wordt toegang tot een qPCR-machine. ChIP blijft de gouden standaard voor het definiëren van genomic lokalisatie van gemodificeerde histonen in gist en andere systemen.

    Dit is een veelzijdige protocol met een aantal stappen dat kan aanpassen aan verschillende experimentele omstandigheden, met inbegrip van tests gelijktijdig meerdere mutanten of milieuomstandigheden worden geoptimaliseerd. Anderzijds voldoende chromatine ontstaat meestal uit een lysate voor het uitvoeren van meerdere IP-adressen met tot ten minste vier verschillende antilichamen. Dit protocol kan ook worden gebruikt voor chIP van niet-Histon chromatine eiwitten die epitope-gelabeld, of waarvoor antilichamen zijn gegenereerd. Als dit protocol worden aangepast voor chIP van niet-Histon eiwitten, parameters, met inbegrip van fixatie tijd, chromatine concentratie in het onderzoektijdvak en antilichaam concentratie zijn vaak essentieel zijn voor het verkrijgen van de verrijking van het gerichte eiwit op achtergrond. Meestal is het nuttig te vergroten van de tijd van de fixatie met formaldehyde naar tussen 45 en 60 min en verhoging van het bedrag van de chromatine gebruikt in het onderzoektijdvak (maximaal 200 µg van totale proteïne).

    Er zijn een aantal mogelijke variabelen die aan de kwaliteit bijdragen en reproduceerbaarheid van Histon wijziging chIP experimenten. Hoewel een suboptimale experiment kan vaak positieve resultaten opleveren bij het vergelijken van de grote verschillen (bijvoorbeeld de niveaus van H3K4me2 in wildtype of set1Δ cellen, zoals weergegeven in figuur 3A), meer subtiele verschillen zijn waarschijnlijk gemaskeerd worden een onjuist uitgevoerd experiment (zoals de verschillende niveaus van H4K16ac in TEL07L in wildtype of sir2Δ cellen, zoals weergegeven in figuur 3B). Experimentele parameters te overwegen omvatten de hoeveelheid gistcellen die worden gebruikt, fixatie tijd, concentratie van de breuk van de chromatine gebruikt in het onderzoektijdvak, fragment grootte van de verteerd DNA-eiwitcomplexen en de kwaliteit van het antilichaam en concentratie. Een beperking van deze aanpak is dat optimalisatie van experimentele parameters is in het algemeen vereist voor elke wijziging van de Histon geteste en de gemuteerde stammen en/of voorwaarden van onderzoek. Kunnen er subtiele verschillen in Histon mark niveaus of lokalisatie onder verschillende omstandigheden, en de mogelijkheid om deze verschillen te detecteren is afhankelijk van de parameters die hierboven beschreven. We bespreken een aantal van de belangrijkste overwegingen voor de ontwikkeling van de meest gevoelige experimentele benaderingen hieronder.

    Zoals beschreven in het protocol, is het aanbevolen om meerdere testconcentraties van MNase om te bepalen van de optimale concentratie vóór het uitvoeren van een volledige chIP-experiment. Ervoor te zorgen dat het DNA binnen het onderzoektijdvak adequaat is gefragmenteerd is de sleutel tot het verkrijgen van hoge resolutie chIP resultaten. Hoewel de grootte van de amplicon van de qPCR-producten klein worden kan (algemeen minder dan 100 bp), als de grootte van het fragment van DNA aanzienlijk groter is, de qPCR ten onrechte verrijking op een specifieke locus kan aangeven wanneer, in werkelijkheid, het merk Histon kan worden gelokaliseerd honderden basepairs weg. Terwijl dit protocol is gebaseerd op MNase te solubilize de chromatine in mono - en di-nucleosomes, gebruiken andere protocollen chIP ook vaak ultrasoonapparaat wilt schuintrekken chromatine6,7. Ultrasoonapparaat is ook een betrouwbare methode voor solubilizing van chromatine fragmenten, hoewel de shear maten zijn meestal minder uniform en het kan moeilijker te bereiken consistente resultaten tussen experimenten. Hoewel ultrasoonapparaat mogelijk chIP van sommige niet-Histon eiwitten de voorkeur verdient, kan het gebruik van MNase om te verteren chromatine in voornamelijk mono-nucleosomes de resolutie van Histon wijziging chIP experimenten verbeteren.

    Een vereiste voor een succesvolle chIP experiment is een antilichaam dat uniek en met hoge affiniteit de Histon wijziging van belang herkent. De belangrijkste beperking van chIP als een methode voor de detectie van Histon wijziging is de afhankelijkheid van een kwalitatief hoogwaardige, gevalideerde antilichaam; zonder dergelijke een reagens meestal resultaten van chIP geen biologisch relevant te zijn. Er zijn een aantal verkrijgbare antilichamen tegen histone modificaties gevonden in ontluikende gist, hoewel de kwaliteit en de geldigheid van de antistoffen is variabel. Inspanningen voor het valideren van deze antilichamen hebben nuttige middelen voor het bepalen van de beste beschikbare antilichaam voor een gegeven experiment26opgeleverd. Het is aanbevolen dat antilichamen gebruikt voor chIP worden gevalideerd met een verscheidenheid aan methoden voor hun specificiteit, onder meer door indringende matrices van gemodificeerde en ongewijzigde Histon peptides, uitvoeren van westelijke vlekken van hele cel extracten en gezuiverde histonen, en in chIP experimenten met de juiste besturingselementen, zoals stammen met een wijzigen enzym verwijderd of het dragen van puntmutaties in het gemodificeerde Histon residu. Voor nieuwe antilichamen die genfunctieonderzoek merken herkent of lab-gegenereerd antilichamen, zijn deze specificiteit experimenten cruciaal voor het bepalen of het antilichaam mogelijk een geldige reagens voor chIP.Naast het valideren van de specificiteit van het antilichaam, is het uitvoeren van een titratie van antilichamen voor de IP-adressen van een wildtype stam en een negatieve controlestam vaak nuttig voor het bepalen van de hoeveelheid antilichamen vereist (ten opzichte van de concentratie van een set chromatine) om te detecteren van nauwkeurige verschillen in verrijking tussen stammen of regio's van het genoom. Bovendien, als bepaalde gegevens met betrekking tot de genomic distributiepatronen van het merk bekend, positieve en negatieve zijn controle primer sets moeten worden opgenomen in alle qPCR-experimenten voor het valideren van elke individuele proef en ter vereenvoudiging van de vergelijkingen tussen experimenten.

    Dit werk wordt over het algemeen een fundamentele methode beschreven voor onderzoekers die geïnteresseerd zijn in het ondervragen van de status van de wijziging van de Histon bij elke genomic regio ontluikende gist. De veelzijdigheid van dit protocol en de toepasbaarheid ervan op uiteenlopende experimentele vragen maakt het een uiterst nuttig hulpmiddel voor het ontleden van chromatine dynamiek op moleculair niveau.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    De auteurs hebben niets te onthullen.

    Acknowledgments

    De auteurs bedank leden van de groene lab voor nuttige discussies. Dit werk werd gedeeltelijk ondersteund door subsidies van de NIH R03AG052018 en R01GM124342 naar E.M.G.

    Materials

    Name Company Catalog Number Comments
    Yeast Extract Research Products International (RPI) Y20025-1000.0
    Peptone Research Products International (RPI) P20250-1000.0
    Dextrose ThermoScientific BP350-1
    Formaldehyde Sigma-Aldrich F8775
    Glycine Fisher Scientific AC12007-0050
    Tris Amresco 0497-5KG
    EDTA Sigma-Aldrich E6758-500G
    NaCl ThermoScientific BP358-10
    4-Nonylphenyl-polyethylene glycol Sigma-Aldrich 74385 Equivalent to NP-40
    MgCl ThermoScientific S25533
    CaCl2 Sigma-Aldrich 20899-25G-F
    LiCl ThermoScientific AC413271000
    Sodium Dodecyl Sulfate Amresco M107-1KG
    Sodium Deoxycholate Sigma-Aldrich 30970-100G
    Sodium Acetate Sigma-Aldrich S2889
    NaHCO3 ThermoScientific S25533
    PMSF Sigma-Aldrich P7626-5G
    Yeast protease inhibitor cocktail VWR 10190-076
    25 Phenol:24 Chloroform:1 Isoamyl Alcohol VWR Life Science 97064-824
    Ethanol Sigma-Aldrich E7023
    Nuclease-Free Water VWR 100720-992
    Micrococcal Nuclease Worthington Biochemical LS004797
    Glycogen ThermoScientific R0561
    Proteinase K Research Products International (RPI) P50220-0.1
    RNase A  Sigma-Aldrich R6513-50MG
     Bradford Assay Reagent ThermoScientific 23238
     BSA Standard 2 mg/mL ThermoScientific 23210
    α H4 EMD Millipore 04-858
    α H4K16ac EMD Millipore ABE532
    α H3 Abcam ab1791
    α H3K4me2 Active Motif 39142
     High Rox qPCR Mix Accuris qMax Green, Low Rox qPCR Mix ACC-PR2000-L-1000
    Protein A/G Magnetic Beads ThermoScientific 88803
    magnetic stand for 1.5mL tubes Fisher Scientific PI-21359
    Acid-Washed Glass Beads Sigma-Aldrich G8772
     Microtube Homogenizer Benchmark D1030
    2.0 mL screw-cap tubes with sealing rings Sigma-Aldrich Z763837-1000EA
    Gel loading tips Fisher Scientific 07-200-288
    Cuvettes Fisher Scientific 50-476-476
    Parafilm Fisher Scientific 13-374-10
    50 mL conical tubes Fisher Scientific 14-432-22
    384-Well PCR Plate Fisher Scientific AB-1384W
     Gyratory Floor Shaker New Brunswick Scientific Model G10
    Spectrophotometer ThermoScientific ND-2000c
     Real-Time PCR Detection System Bio-Rad 1855485

    DOWNLOAD MATERIALS LIST

    References

    1. Jaiswal, D., Turniansky, R., Green, E. M. Choose Your Own Adventure: The Role of Histone Modifications in Yeast Cell Fate. J Mol Biol. 429, (13), 1946-1957 (2017).
    2. Suganuma, T., Workman, J. L. Signals and combinatorial functions of histone modifications. Annu Rev Biochem. 80, 473-499 (2011).
    3. Solomon, M. J., Varshavsky, A. Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures. P Natl Acad Sci USA. 82, (19), 6470-6474 (1985).
    4. Solomon, M. J., Larsen, P. L., Varshavsky, A. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell. 53, (6), 937-947 (1988).
    5. Gilmour, D. S., Lis, J. T. Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes. P Natl Acad Sci USA. 81, (14), 4275-4279 (1984).
    6. Lefrançois, P., et al. Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics. 10, 37 (2009).
    7. Furey, T. S. ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet. 13, (12), 840-852 (2012).
    8. Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic Loci. Cell. 136, (1), 175-186 (2009).
    9. Byrum, S. D., Raman, A., Taverna, S. D., Tackett, A. J. ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep. 2, (1), 198-205 (2012).
    10. Soldi, M., Bremang, M., Bonaldi, T. Biochemical systems approaches for the analysis of histone modification readout. Biochim Biophys Acta. 1839, (8), 657-668 (2014).
    11. Soldi, M., Bonaldi, T. The ChroP approach combines ChIP and mass spectrometry to dissect locus-specific proteomic landscapes of chromatin. J Vis Exp. (86), (2014).
    12. Kuo, M. H., Allis, C. D. In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment. Methods. 19, (3), 425-433 (1999).
    13. Meluh, P. B., Broach, J. R. Immunological analysis of yeast chromatin. Methods Enzymol. 304, 414-430 (1999).
    14. Rozen, S., Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132, 365-386 (2000).
    15. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods. 50, (4), S1-S5 (2010).
    16. Rodríguez, A., Rodríguez, M., Córdoba, J. J., Andrade, M. J. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol. 1275, 31-56 (2015).
    17. Briggs, S. D., et al. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Gene Dev. 15, (24), 3286-3295 (2001).
    18. Bernstein, B. E., et al. Methylation of histone H3 Lys 4 in coding regions of active genes. P Natl Acad Sci USA. 99, (13), 8695-8700 (2002).
    19. Pokholok, D. K., et al. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122, (4), 517-527 (2005).
    20. Krogan, N. J., et al. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell. 11, (3), 721-729 (2003).
    21. South, P. F., Harmeyer, K. M., Serratore, N. D., Briggs, S. D. H3K4 methyltransferase Set1 is involved in maintenance of ergosterol homeostasis and resistance to Brefeldin A. P Natl Acad Sci USA. 110, (11), E1016-E1025 (2013).
    22. Margaritis, T., et al. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3'-end antisense transcription. PLoS Genet. 8, (9), e1002952 (2012).
    23. Jezek, M., et al. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance. Epigenetics. 12, (2), 93-104 (2017).
    24. Suka, N., Luo, K., Grunstein, M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat Genet. 32, (3), 378-383 (2002).
    25. Kimura, A., Umehara, T., Horikoshi, M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 32, (3), 370-377 (2002).
    26. Rothbart, S. B., et al. An Interactive Database for the Assessment of Histone Antibody Specificity. Mol Cell. 59, (3), 502-511 (2015).
    Chromatine Immunoprecipitation (ChIP) van Histone modificaties van <em>Saccharomyces cerevisiae</em>
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).More

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter