Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Immunoprécipitation de la chromatine (ChIP) des Modifications d’Histone de Saccharomyces cerevisiae

doi: 10.3791/57080 Published: December 29, 2017

Summary

Nous décrivons ici un protocole pour l’immunoprécipitation de la chromatine des histones modifiées de la levure Saccharomyces cerevisiae. ADN immunoprécipitée est ensuite utilisé pour la PCR quantitative pour interroger l’abondance et la localisation des modifications post-traductionnelles des histones dans tout le génome.

Abstract

Dynamiquement, modifications post-traductionnelles des histones (MEA), tels que l’acétylation, méthylation et phosphorylation, sont régies par une série d’enzymes permettant d’ajouter ou de supprimer ces marques en réponse aux signaux reçus par la cellule. Ces SPTM est les principaux contributeurs à la régulation des processus tels que le contrôle d’expression de gène et de réparation de l’ADN. Immunoprécipitation de la chromatine (chIP) a été une approche instrumentale pour disséquer l’abondance et la localisation de nombreux SPTM histone dans tout le génome en réponse aux perturbations diverses à la cellule. Ici, on décrit une méthode polyvalente permettant d’effectuer la puce des histones modifiées post-traductionnellement de la levure Saccharomyces cerevisiae (S. cerevisiae) . Cette méthode s’appuie sur la réticulation des protéines et l’ADN à l’aide de traitement de formaldéhyde des cultures de levures, génération de lysats de levure par perle battant, la solubilisation des fragments de chromatine par nucléase micrococcique et immunoprécipitation d’ADN-histones complexes. ADN, associée à la marque d’histone d’intérêt est purifié et soumis à l’analyse PCR quantitative pour évaluer son enrichissement à plusieurs loci dans tout le génome. Des expériences représentatives sonder la localisation des marques histone H3K4me2 et H4K16ac dans le type sauvage et levure mutante sont discutés pour démontrer l’interprétation et l’analyse des données. Cette méthode convient à une variété de l’histone SPTM et peut être effectuée avec différentes souches mutantes ou en présence de diverses contraintes environnementales, ce qui en fait un excellent outil pour l’étude des changements dans la dynamique de la chromatine dans des conditions différentes.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La modification post-traductionnelle dynamique (PTM) des histones est un mécanisme réglementaire clé pour de nombreux processus basé sur un modèle ADN, y compris la transcription, de réplication et de réparation de l’ADN1,2. La capacité de déterminer l’abondance et la localisation précise des histones modifiées concomitantes avec ces processus est donc essentielle pour comprendre leur régulation dans des conditions différentes dans la cellule. Le développement de l’immunoprécipitation de la chromatine (chIP) comme une méthode largement découlé des études biochimiques des interactions des protéines avec de l’ADN, notamment en vitro méthodes à l’aide d’agents réticulants chimiques, conjuguée à la nécessité d’évaluer la nature dynamique des interactions protéine-ADN in vivo et à des régions spécifiques du génome3,4,5. L’avancement des technologies de séquençage et de PCR quantitative (qPCR) a également développé la capacité d’effectuer des expériences de puce avec des comparaisons quantitatives et à travers des génomes entiers, ce qui en fait un outil puissant pour disséquer les interactions ADN-protéines à plusieurs niveaux.

Actuellement, la puce est une méthode obligatoire pour tout groupe de recherche intéressé par la chromatine-régulation du génome qu’il ne sont a pas de méthodes comparables pour interroger directement le lien physique entre une histone modifié et un locus génomique spécifique dans vivo. Bien qu’il existent des variantes de cette méthode à l’aide de séquençage de la génération suivant pour mapper les modifications d’histone dans tout le génome6,7 , ces approches peuvent aborder différentes questions scientifiques et leur échelle, les coûts et ressources techniques peuvent être limitée pour certains groupes de recherche. En outre, puce-qPCR ciblée est nécessaire pour compléter ces approches en fournissant des méthodes à la fois optimiser le protocole puce avant de séquençage et de valider les résultats de l’épigénomique datasets. Approches fondées sur la spectrométrie de masse pour déterminer l’effectif complet de l’histone marques associées aux régions génomiques ont également émergé8,9,10,11, cependant, ces approches ont certaines limites concernant les régions du génome peuvent être sondées et dont ils ont besoin de compétences techniques et l’instrumentation qui ne seront pas disponible pour tous les groupes de recherche. Par conséquent, la puce reste une méthode fondamentale pour analyser l’abondance et la distribution des modifications d’histone dans des conditions diverses pour tous les groupes de recherche intéressés de l’épigénétique, la chromatine et la régulation des fonctions génomiques.

Nous décrivons ici une méthode pour modèle de puce à l’aide de la levure de bière Saccharomyces cerevisiae (S. cerevisiae) pour étudier la distribution des histones SPTM à la chromatine. Cette approche s’appuie sur un certain nombre d’éléments de base des protocoles de puce développée chez la levure et également appliquées au modèle divers systèmes12,13. Interactions entre les histones modifiées et de l’ADN dans la cellule sont conservées par réticulation avec le formaldéhyde. Après préparation de lysate, fragments de la chromatine sont solubilisées en fragments de taille uniforme par digestion avec la nucléase micrococcique. Immunoprécipitation des histones modifiées est réalisée avec des anticorps soit commerciales soit généré par lab et tout associé à l’ADN est isolé et analysé pour enrichissement à certaines régions génomiques à l’aide de qPCR (Figure 1). De nombreuses modifications d’histone, la quantité d’ADN obtenu à partir de ce protocole est suffisante pour les essais de plus de 25 différents locus génomiques par qPCR.

Cette méthode de puce est très polyvalente pour surveiller la distribution d’une modification des histones unique en plusieurs souches mutantes ou les conditions environnementales, ou pour les tests multiples modifications d’histone dans les cellules de type sauvage à un certain nombre de locus génomiques. En outre, de nombreuses composantes du protocole sont facilement réglables pour optimiser la détection des deux marques histone fortement ou faiblement-abondantes. Enfin, effectuer la puce des histones modifiées dans la levure de bière offre la possibilité d’utiliser des contrôles clés pour la spécificité de l’anticorps qui sont en grande partie non disponible dans d’autres systèmes. À savoir, souches de levure peuvent être générés qui portent des mutations ponctuelles dans les résidus d’histones qui sont visés par la modification, et, dans certains cas, il n’y a seulement une seule enzyme qui catalyse la modification sur un résidu d’histone particulière (par exemple. lysine histone méthyltransférases). Par conséquent, puce peut être effectuée soit l’histone mutant ou enzyme suppression souches d’analyser la mesure dans laquelle liaison non spécifique de l’anticorps peut être survenus et générant des résultats faussement positifs. Ce contrôle est particulièrement utile pour les anticorps nouvellement développé et peut même être utilisé pour valider la spécificité de l’anticorps pour des modifications d’histone conservée avant des utiliser dans d’autres systèmes. Cette approche vient compléter d’autres méthodes pour tester la spécificité des anticorps qui permettent de distinguer entre les États de modification différents (tels que les mono-, di - et tri-méthylation), y compris les tableaux de peptides modifiés de palpage et effectuer des transferts western des histones ou nucléosomes avec modifications déterminées. Dans l’ensemble, la puce dans la levure de bière est une méthode puissante pour évaluer la dynamique de l’histone SPTM dans tout le génome et disséquer les mécanismes régissant leur règlement.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. lier les anticorps à billes magnétiques

  1. Bien mélanger les billes magnétiques de protéine A/G et transférer 20 µL de billes magnétiques par une immunoprécipitation (IP) échantillon dans un tube de 1,5 mL.
    Remarque : Lors du pipetage perles, utilisez large calibre, faible rétention conseils.
  2. Placer le tube avec des perles dans un support magnétique et permettent des perles recueillir sur le côté du tube. Retirez le surnageant.
  3. Laver les billes 3 fois avec 1 mL de froid-tampon Tris salin (SCT) (50 mM Tris-HCl pH 7.5, 150 millimètres de NaCl).
  4. Ajouter 200 µL du SCT de perles et de la quantité appropriée d’anticorps. Tourner à 8 tr/min pendant une nuit à 4 ° C.
    Remarque : Pour de nombreux anticorps PTM anti-histone, 1-3 µg d’anticorps par IP est suffisante. Toutefois, les expériences de titrage sont recommandés afin de déterminer les concentrations appropriées. Les concentrations recommandées pour les anticorps PTM histone bien caractérisés et commercial sont souvent précises et se trouvent dans les rapports publiés ou de la documentation sur le produit.
  5. Placez les perles sur un support magnétique et éliminer le surnageant. Lavez-les avec 1 mL du SCT.
  6. Remettre en suspension les perles dans 20 µL du SCT par exemple IP plus un supplémentaire 5 µL (en cas d’erreur de pipettage) du SCT.
    Remarque : Les perles peuvent être stockés à court terme à 4 ° C jusqu'à l’utilisation.

2. la croissance de cellules de levure

  1. Ensemencer 10 mL de la DPJ (extrait de levure 10 %, 20 % de peptone et 20 % de dextrose) avec une seule colonie de la souche appropriée et développez-le à 30 ° C durant la nuit dans un incubateur à agitation à 220 tr/mn.
  2. Mesurer la densité optique à 600 nm (OD600) de la culture de levure à l’aide d’un spectrophotomètre. Diluer la culture à une OD600 = 0,2 dans 100 mL de la DPJ dans un ballon jaugé de nouveau.
  3. Cultiver les cellules à 30 ° C dans un incubateur à agitation à 220 tr/min jusqu'à ce qu’ils atteignent la phase logarithmique (OD600 = 0,6-0,8).

3. in Vivo la réticulation des protéines de l’ADN

  1. Quand les cultures atteignent la phase logarithmique, ajouter 2,7 mL de 37 % de formaldéhyde directement sur le support, pour une concentration finale de 1 % de formaldéhyde. Transférer la fiole dans un shaker à 25 ° C (ou à température ambiante) et agiter à 50 tr/min pendant 15 min.
  2. Ajouter 5 mL de glycine de 2,5 M au milieu et continuer à trembler à 50 tr/min à température ambiante pendant 5 min étancher le formaldéhyde.
  3. Transférer les cellules pour centrifuger les bouteilles et faire tourner les cellules à 5800 x g pendant 5 min à 4 ° C. Décanter le liquide surnageant.
    1. Laver les cellules par leur resuspendant dans 45 mL de SCT froid et transférer la suspension dans un tube conique de 50 mL. Tourner le tube à 2800 x g pendant 3 min à 4 ° C. Retirez le surnageant.
    2. Laver que les cellules dans 10 mL de froid puce tampon de lyse (50 mM Tris-HCl pH 7,5, 150 mM NaCl, l’acide éthylènediaminetétraacétique (EDTA), de 1 mM 1 % nonidet octyl phenoxypolyethoxylethanol (NP-40), conservé à 4 ° C).
    3. Faire tourner les cellules à 2800 x g pendant 3 min à 4 ° C. Retirez le surnageant.
      Remarque : Les cellules peuvent être gelés à l’azote liquide et stockées à-80 ° C jusqu'à ce que la poursuite de la procédure.

4. faire des lysats de levure

  1. Remettre en suspension les cellules dans 1 mL de tampon de lyse puce froid avec le fluorure phénylméthylsulfonyle (PMSF) de 1 mM et une dilution de 1 : 1 000 de l’inhibiteur de protéase de levure cocktail. Transférer la suspension dans un tube à bouchon à vis 2,0 mL contenant 200 µL de perles de verre.
  2. Les cellules de transfert à un cordon battant l’appareil pour une agitation à haute vitesse à 4 ° C et Perle a battu 6 fois pour 30 s de chaque. Garder les cellules sur la glace pendant au moins 1 min entre chaque perle battant.
  3. Transférer le lysat dans un tube de 1,5 mL à l’aide de gel conseils de chargement. Centrifuger le lysat à 15 500 x g pendant 20 min à 4 ° C.
  4. Jeter le surnageant et Resuspendre le culot dans 250 µL de tampon de Digestion MNase (10 millimètres Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2, 21 mM CaCl2, 1 % NP-40, stockés à 4 ° C) par pipetage doucement verticalement.
  5. Ajouter 2,5 µL de MNase dans les réactions. Mélanger doucement en retournant le 4 - 6 fois et immédiatement il incuber dans un bain-marie à 37 ° C pendant 20 min.
    Remarque : Les conditions de recueil doivent être optimisées quand un nouveau stock de MNase est utilisé. Voir l’étape 10 pour le protocole.
  6. Placer immédiatement les tubes sur la glace pour arrêter la réaction et ajouter 5 µL de EDTA 0,5 M pour une concentration finale de 10 mM EDTA. Mélangez-les délicatement par inversion.
  7. Centrifuger la réaction à 15 500 g pendant 15 min à 4 ° C et transférer le surnageant dans un nouveau tube de 1,5 mL.
    NOTE : Chromatine (digérée) Soluble sera dans le surnageant. Le granule contient des débris cellulaires rien non digérés et insoluble.

5. immunoprécipitation (IP) modification des Histones

  1. Déterminer la concentration de la protéine de chaque fraction de chromatine MNase-réalisé à l’aide d’une analyse de Bradford. Ajouter 1 mL de réactif de Bradford à chacun des 8 cuvettes jetables plus 1 cuve supplémentaire pour chaque échantillon de protéine à tester.
    1. Préparer une solution de 2 mg/mL d’albumine sérique bovine (BSA).
    2. Ajouter le volume approprié pour atteindre les concentrations suivantes de BSA dans 1 mL de réactif de Bradford : 0 µg/mL, 0,5 μg/mL, 1 μg/mL, 2 µg/mL, 4 μg/mL, 6 μg/mL, 8 μg/mL et 10 μg/mL. Ajouter 2 μL de la fraction de la chromatine MNase-réalisé dans les cuvettes supplémentaires.
    3. Couvrez le dessus de chaque cuve avec un petit morceau de parafilm et inverser les cuvettes de 4 à 6 fois pour bien mélanger la solution. Incuber les cuves à température ambiante pendant 15 min.
    4. À l’aide d’un spectrophotomètre de lumière visible, mesurer l’absorbance à 595 nm pour la courbe d’étalonnage et les échantillons expérimentaux.
      Remarque : Utilisez la cuvette sans BSA (0 μg/mL) à blanc le spectrophotomètre avant de prendre la première mesure.
    5. Tracer une courbe d’étalonnage en utilisant les valeurs d’absorbance pour les différentes concentrations de BSA sur les logiciels associés avec le spectrophotomètre ou tableur. Basé sur la courbe d’étalonnage et le facteur de dilution utilisée (1/500), utiliser les valeurs d’absorbance pour calculer la concentration de protéine pour chacun des échantillons de fraction la chromatine.
  2. Pour chaque adresse IP, ajoutez 50 µg de protéines totales de la fraction de la chromatine MNase-réalisé à tampon de lyse ChIP pour atteindre un volume final de 1 mL.
    Remarque : Si la mise en place plus d’une IP par lysat, faire un mélange maître du lysat et ChIP tampon de lyse et aliquote de 1 mL à tubes individuels pour la période d’enquête.
  3. Retirer 100 µL du mélange IP à traiter que l’échantillon d’entrée. Congeler l’échantillon d’entrée à-20 ° C jusqu'à l’étape 7.1.
    Remarque : N’importe quel échantillon restant de la chromatine aussi peut être congelé à-20 ° C et utilisée pour une adresse IP suivante si vous le souhaitez.
  4. Ajouter 20 µL de billes magnétiques de A/G de protéine préalablement lié avec anticorps à chaque échantillon IP.
Faire tourner l’échantillon à 8 tr/min pendant 3 h (standard) ou jusqu’au lendemain (si vous préférez) à 4 ° C.

6. Lavez les IPs et éluer Complexes ADN-histones

  1. Placer les tubes dans un support magnétique et laisser les perles à percevoir sur les bords du tube. Retirez le surnageant à l’aide d’une pipette. Laver les billes successivement avec 1 mL de chacune des tampons ci-dessous.
    1. Effectuer chaque lavage en tournant à 8 tr/min pendant 5 min à 4 ° C, placer les perles sur un support magnétique, éliminer le surnageant et l’ajout de tampon suivant : x 2 - tampon de lyse puce, 2 x - haut sel lavage tampon (50 mM Tris-HCl pH 7.5, 500 mM NaCl, EDTA 1 mM 1 % NP-40, stockés à 4 ° C), 1 x - tampon de lavage LiCl/détergent (10 mM Tris-HCl pH 8,0, LiCl, EDTA, 1 % NP-40, désoxycholate de sodium à 1 %, de 1 mM à 250 mM stocké à 4 ° C), 1 x - TE (10 mM Tris-HCl pH 8,0, 1 mM EDTA, conservé à 4 ° C) et 1 x - TE.
    2. Avec dernier lavage TE, transférer des perles dans un nouveau tube à l’aide de 0,5 mL de TE à transférer la plupart des perles, puis une autre 0,5 mL de TE laver le tube et transférer des perles restantes.
  2. Ajouter 250 µL de tampon d’élution fraîchement puce (1 % SDS, 1 mM NaHCO3). Vortex la solution brièvement. Faire pivoter les échantillons à 8 tr/min pendant 15 min à température ambiante.
  3. Placer le tube sur un support magnétique et collecter les perles. Avec précaution, transférer le surnageant dans un nouveau tube et éviter les perles.
    Remarque : L’éluat contient immunoprécipitée protéines et l’ADN associée.
  4. Ajouter un autre 250 µL de tampon d’élution puce à perles. Faire pivoter les échantillons à 8 tr/min pendant 15 min à température ambiante.
  5. Transvaser avec soin le surnageant dans le tube contenant l’élution en premier. Le cas échéant, retirer un plus petit volume (240 µL) pour toutes les adresses IP pour ne pas perturber les perles.

7. inverser les liaisons protéine-ADN

  1. Décongeler les échantillons d’entrée et ajouter 400 µL de tampon d’élution de puce à chaque entrée.
  2. Pour les entrées et les échantillons de la propriété intellectuelle, ajouter 20 µL de 5 M de NaCl, 5 µL de glycogène de 20 mg/mL et 12,5 µL de 20 mg/mL mélange de protéinase K. bien en inversant ou en effleurant les tubes. Incuber les échantillons dans un bain d’eau de 65 ° C pendant la nuit.

8. purifier et de se concentrer d’ADN

  1. Ajouter 10 µL de 10mg/mL RNase A à l’entrée et les échantillons de la propriété intellectuelle. Incuber les échantillons dans un bain-marie à 37 ° C pendant 30 min.
  2. Ajouter 600 µL d’alcool phénol : chlorofrom:isoamyl (25:24:1 PCI) dans la solution aqueuse et mélangez-les bien. Les tourner à 15 500 g pendant 5 min à température ambiante.
    1. Retirer la couche aqueuse dans un nouveau tube. Ajouter 600 µL de PCI et mélangez-les bien. Tourner le tube à 15 500 g pendant 5 min à température ambiante. Transférer la phase aqueuse dans un nouveau tube.
      ATTENTION : Travailler sous la hotte et porter un équipement de protection individuelle approprié lorsque vous travaillez avec PCI. Éliminer les déchets liquides et solides tel qu’indiqué par les lignes directrices.
  3. Ajouter 0,1 x volume d’acétate de sodium 3M et 1 mL d’éthanol froid de 100 % à précipiter l’ADN. Inverser le tube de 4 à 6 fois pour bien mélanger la solution. Incuber à-20 ° C jusqu’au lendemain.
    1. Tourner le tube à 15 500 x g pendant 20 min à 4 ° C. Retirer délicatement le surnageant avec une pipette.
    2. Laver le culot dans 1 mL d’éthanol à 70 % froid. Le tourner à 15 500 g pendant 10 min à 4 ° C. Retirer délicatement le surnageant avec une pipette.
    3. Sécher à l’air des granulés dans la hotte pendant environ 20 min (jusqu'à ce que complètement sec). Remettre en suspension dans 50 µL d’eau exempte de nucléase échantillons IP et remettre en suspension les échantillons d’entrée dans 100 µL d’eau exempte de nucléase. Conserver les échantillons d’ADN à-20 ° C jusqu'à l’exécution de qPCR.

9. quantitative PCR (qPCR) pour détecter les régions génomiques enrichi

  1. Faire un mélange maître de qPCR pour chaque série d’amorces. Une réaction contient 5 µL du mélange de x qPCR 2, 0,25 µL d’apprêt avant de 20 µM et 0,25 µL d’apprêt inverse de 20 µM.
    NOTE : Amorces appropriés et les essais pour qPCR expériences sont décrites ailleurs14,15,16.
  2. Faire des mélanges maîtres ADN pour chaque échantillon d’ADN. Une réaction contient 0,5 µL d’ADN et 4,0 µL d’eau exempte de nucléase.
  3. Ajouter 5,5 µL du mélange maître apprêt approprié et 4,5 µL du mélange maître ADN approprié à chaque puits sur une plaque 384 puits qPCR.
    Remarque : Démarrer avec l’ajout de 5,5 µL du mélange amorces dans chaque puits. Faites tourner la plaque à 200 x g pendant 1 min à température ambiante avant d’ajouter 4,5 µL du mélange ADN.
  4. Respecter le joint de la plaque et un essorage à 200 x g pendant 1 min à température ambiante.
  5. Effectuer qPCR utilisant un système de qPCR en temps réel avec les conditions suivantes : 95 ° C pendant 3 min ; 40 cycles de 95 ° C pendant 10 s, 55 ° C pendant 30 s ; courbe de fusion 65 ° C et 95 ° C avec des intervalles de 0,5 ° C, 5 s.
  6. Pour chaque paire d’amorces, calculer l’entrée pour cent de l’échantillon de la propriété intellectuelle par rapport à l’échantillon d’entrée de 5 % utilisé dans le qPCR. Utiliser les moyens de la géométrie PCR technique pour effectuer les calculs.
    Remarque : Si une variation importante est observée dans la géométrie de la PCR, il est préférable de répéter le qPCR avec attention à la composition du mélange maître, pipetage erreurs et contamination croisée entre les puits de la plaque 384 puits.
    1. Ajustez les valeurs de Cq pour l’entrée à 100 % en soustrayant le nombre de cycles, ce qui représente le facteur de dilution des valeurs brutes de Cq.
      Remarque : L’entrée de cinq pour cent représente un facteur de dilution d’un facteur 20, ce qui équivaut à 4,32 cycles (log2 20 = 4,32).
    2. Calculer le pourcentage d’entrée comme 2 ^ (Cqentrée - CqIP) multiplié par 100.

10. Déterminez MNase Digest Conditions (recommandé avant complète la première puce Experiment)

  1. Suivez les étapes 2.1 à 4.4 du protocole précédent. Intensifier le protocole pour générer assez de lysat pour plusieurs échantillons de MNase digestion de la pastille contenant la chromatine. À l’étape 4.4, Resuspendre les pellets dans 1,25 mL de tampon de Digestion MNase. Aliquote les échantillons à 5 tubes de sorte que chaque contient 250 µL de l’extrait concentré de chromatine resuspendu dans un tampon MNase Digestion.
  2. Ajouter 0, 1.5, 2.5 ou 5 µL de MNase dans chaque tube. Mélanger doucement en retournant le 4 - 6 fois et immédiatement faire incuber les tubes dans un bain-marie à 37 ° C pendant 20 min.
  3. Arrêter les réactions en immédiatement placer les tubes sur la glace et ajouter 5 µL de EDTA 0,5 M pour une concentration finale de 10 mM.
Mélanger doucement la solution par inversion.
  • Centrifuger les tubes à 15 500 g pendant 15 min à 4 ° C et transférer le surnageant dans un nouveau tube de 1,5 mL.
  • Ajouter SDS à concentration finale de 1 % (25 µL de solution 10 %) et de NaHCO3 à concentration finale de 0,1 M (25 µL de la solution mère de 1 M) pour les échantillons dans les tubes de 1,5 mL.
  • Ajouter 20 µL de NaCl 5M, 5 µL de glycogène et 12,5 µL de protéinase K de la 20mg/mL dans les échantillons dans les tubes de 1,5 mL. Les incuber à 65 ° C pendant la nuit.
  • Ajouter 10 µL de RNaseA 10 mg/mL. Incuber à 37 ° C pendant 30 min.
  • Ajouter 300 µL de PCI dans la solution aqueuse et mélangez-les bien. Tourner à 15 500 g pendant 5 min à température ambiante.
    1. Enlever la couche aqueuse dans un nouveau tube. Ajouter 300 µL de PCI et bien mélanger. Tourner à 15 500 g pendant 5 min à température ambiante. Transférer la phase aqueuse dans un nouveau tube.
  • Ajouter 0,1 x volume d’acétate de sodium 3M (généralement ~ 30 µL) et 1 mL d’éthanol froid de 100 % à précipiter l’ADN. Inverser le tube de 4 à 6 fois pour bien mélanger. Incuber les tubes à-80 ° C pendant 1 h ou -20 ° C jusqu’au lendemain.
    1. Tourner le tube à 15 500 x g pendant 20 min à 4° C. Retirer délicatement le surnageant avec une pipette.
    2. Laver les boulettes dans 1 mL d’éthanol à 70 % froid. Tourner à 15 500 g pendant 10 min à 4 ° C.
    3. Laissez que les pellets sécher à l’air dans la hotte environ 20 min (ou jusqu'à ce que complètement sec). Remettre en suspension les pellets dans 30 µL d’eau exempte de nucléase.
  • Ajouter le colorant de chargement de l’ADN et exécuter 20 µL sur un gel d’agarose 2 % gel pour visualiser les ADN digéré.
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Un élément clé de ce protocole est l’optimisation de la concentration de la nucléase micrococcique (MNase) utilisée pour digérer la chromatine en fragments solubles, tel qu’indiqué à l’étape 10. Cela est essentiel pour obtenir des données de haute résolution concernant la répartition des modifications d’histone à régions génomiques d’intérêt. Un titrage MNase devrait être effectuée pour déterminer la concentration plus appropriée pour atteindre principalement mono-nucléosomes avec une petite quantité de di-nucléosomes dans la fraction soluble de la chromatine. Cela peut être visualisée en extrayant l’ADN après la digestion MNase du culot contenant de la chromatine et exécution d’agarose gel électrophorèse (Figure 2). Dans la préparation de MNase utilisé ici, 2,5 µL d’enzyme à 20 unités/µL produites essentiellement mono-nucléosomes, et par conséquent, ce montant a été utilisé pour la puce.

    Deux ensembles de résultats représentatifs sont présentés pour cette procédure de puce (Figure 3). Dans le premier exemple, une marque de méthyle d’histone est évaluée dans les cellules de type sauvage ou cellules dépourvues de la méthyltransférase qui catalyse cette marque. Plus précisément, puce a été réalisée avec un anticorps contre H3K4me2, ainsi que contre l’histone H3 comme témoin, dans les cellules Δ de type sauvage et set1. H3K4me2 se localise principalement juste en aval de la transcription, démarrer le site à l’extrémité 5' des régions codantes et, en l’absence de Set1, H3K4me2 ne peuvent être détectés dans les cellules17,18,19. La souche Δ de set1sert donc un contrôle pour indiquer la quantité de signal de fond qui peut être attribuée à la liaison non spécifique d’autres marques de l’histone ou d’ADN à l’anticorps. Dans ce cas, la souche de type sauvage a montré clair d’enrichissement des H3K4me2 à l’extrémité 5' des deux gènes connus pour être des cibles directes de Set1, PMA1 et ERG1120,21, alors qu’aucun signal n’a été observée chez Δ set1 cellules (Figure 3 a). Comme prévu, il n’y a aucun enrichissement de la marque H3K4me2 à télomère (TEL) 07 L. L’expression du gène milieu de sporulation SPR3 a également été signalée à assujettir à Set122,23, cependant, l’enrichissement des H3K4me2 à l’extrémité 5' de la SPR3 ORF est plus similaire aux niveaux observés à TEL07L, par rapport à soit PMA1 ou ERG11. Évaluer la localisation de cette marque de méthyle indique que Set1-régulation du SPR3 est susceptible de se produire par un mécanisme différent de celui à PMA1 ou ERG11, comme précédemment observé22.

    Dans le deuxième exemple, puce de H4K16 acétylé est montré par rapport à l’histone H4 dans les cellules de type sauvage et cellules dépourvues de l’histone désacétylase Sir2, qui supprime les marques de H4K16ac. H4K16ac est épuisé dans la chromatine hétérochromatique ressemblant à proximité du télomère et enrichi dans l’euchromatine plus distal du télomère24,25, comme le démontre pour TEL07L et TEL15L (Figure 3 b). en outre, la perte de Sir2 provoque une augmentation de H4K16ac dans les régions télomériques et subtélomériques spécifiques, même si aucun changement n’est observé au gène contrôle PMA1, où Sir2 ne connaît pas à localiser. Même si ces données montrent une nette augmentation des niveaux de H4K16ac dans les cellules Δ sir2, le changement détecté dans H4K16ac, qui ne devrait pas être aussi importante que le changement de H3K4me2 en type sauvage par rapport aux cellules Δ set1, peut être masqué si puce sont pas correctement optimisé. Recommandations pour l’optimisation sont décrites dans la Discussion.

    Figure 1
    Figure 1 : Chronologie de procédure puce. L’horaire typique pour le protocole de la puce est montré. Les variations possibles sont indiquées dans le texte. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

    Figure 2
    Figure 2 : Test MNase digestion de solubilisation des mono-nucléosomes. Gel d’agarose de l’ADN isolé après la digestion de la pastille de la chromatine avec des quantités variables de MNase (20 unités/µL). L’ADN de mononucléosomes migre à environ 150 bp, de dinucléosomes, à environ 300 bp et l’ADN de polynucleosomes se trouve chez des poids moléculaires plus élevés. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

    Figure 3
    Figure 3 : Copeaux de H3K4me2 et H4K16ac dans le type sauvage et les souches de levures mutantes. ChIP (A) à l’aide d’anticorps anti-H3K4me2 et H3 a été réalisée dans les cellules Δ de type sauvage et set1. Entrée de pourcentage a été calculée pour chaque paire d’amorces pour le H3K4me2 et le H3 IPs et le ratio est représenté graphiquement pour indiquer l’enrichissement relatif des H3K4me2 aux loci indiquée. Les amorces pour PMA1, ERG11 et SPR3 génèrent des amplicons à l’extrémité 5' de chaque ORF, alors que la paire d’amorces TEL07L jouxte le télomère sur le bras gauche du Chromosome 7. La moyenne des trois répétitions biologiques est montrée et les barres d’erreur représentent erreur type de la moyenne. (B) ChIP a été effectué avec des anticorps reconnaissant H4K16ac et H4 dans les cellules Δ de type sauvage et sir2et tracée comme décrit à la Figure 3 a. Paires d’amorces amplifient les séquences adjacentes aux télomères (TEL07L et TEL15L) et en aval dans précédemment défini des régions euchromatiques de chaque subtélomère (21KO et 5KO distale du télomère, respectivement).S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

    Numéro de la souche Génotype Référence
    yEG230 MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 23
    yEG223 MATα sir2Δ::NATMX Cette étude
    yEG232 MATa set1Δ::KANMX 23

    Tableau 1 : Les souches de levure utilisées dans cette étude.

    Numéro de l’oligo Emplacement Séquence
    oEG141 TELVIIL F AGCCCGAGCCTGTACTAAAT
    oEG142 TELVIIL R CAAAAGAAACTTTTCATGGCA
    oEG153 5' F PMA1 TCAGCTCATCAGCCAACTCAAG
    oEG154 5' R PMA1 CGTCGACACCGTGATTAGATTG
    oEG220 TELVIIL + F 21 KO AAACAATGGGACCCTTCTGA
    oEG221 TELVIIL + R 21 KO AACACCTTGCAAAACACAGG
    oEG280 TELXVL F ATCCTGCAATTGGGCCACTAT
    oEG281 TELXVL R AGCGGAAGGCATATTAACGT
    oEG282 TELXVL + F 5 KO AGGCGATGTAATCTCACCAA
    oEG283 TELXVL + R 5 KO CATTCACACATCCTGCTACCA
    oEG568 ERG11 F CCTCTTATTCCGTCGGTGAA
    oEG569 ERG11 R TGTGTCTACCACCACCGAAA
    oEG963 SPR3 F TCTGGATTCGCTGAGGAAGT
    oEG964 SPR3 R TTTCAGTTCAGGGCTTTTCG

    Tableau 2 : Amorces utilisées dans cette étude.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    La procédure décrite ici permet la récupération efficace des ADN associé à des histones modifiées dans les cellules de levure par immunoprécipitation. Elle est suivie de qPCR en utilisant des amorces qui amplifient des régions d’intérêt pour déterminer un enrichissement local ou l’appauvrissement des modifications des histones spécifiques. En dépit d’être mis au point il y a près de 20 ans, puce reste le test décisif pour enquêter sur le statut de modification des histones à différentes régions génomiques et dans des conditions diverses. Bien que la puce couplée à la prochaine génération de technologies de séquençage peuvent interroger des modifications d’histone sur un génome-large échelle6,7, les coûts et l’analyse de données requises de ces approches peuvent limiter leur utilisation dans certains paramètres de laboratoire. En outre, ces expériences épigénomique sont souvent suivis de puce couplé à qPCR pour valider les observations du statut de modification des histones à certains locus génomiques. Il y a quelques méthodes comparables qui fournissent l’utilité de la puce de physiquement reliant une marque d’histone (ou d’autres protéines) à un emplacement spécifique dans le génome et d’analyser la dynamique de cette interaction dans différentes conditions écologiques ou biologiques . Bien qu’il y a eu des succès récents à isoler la chromatine des régions génomiques définies et identifier les marques de l’histone local à l’aide de la spectrométrie de masse8,9,10,11, ces méthodes posent défis techniques et leur utilité dans l’ensemble de types divers lab peuvent être limitées par un accès adéquat aux ressources de la spectrométrie de masse instrumentation et données d’analyse. Le protocole décrit ici est techniquement et économiquement accessible aux paramètres de laboratoire diverse, avec le principal obstacle possible étant l’accès à une machine de qPCR. Puce demeure l’étalon-or pour définir la localisation génomique des histones modifiées chez les levures et autres systèmes.

    Il s’agit d’un protocole polyvalent avec un certain nombre de mesures qui peuvent être optimisés en fonction des conditions expérimentales différentes, y compris les tests simultanément plusieurs mutants ou les conditions environnementales. Alternativement, chromatine suffisante est généralement issue d’un lysat d’effectuer plusieurs adresses IP avec jusqu'à au moins quatre types d’anticorps. Ce protocole peut également servir pour la puce des protéines non histones chromatine qui sont marqués épitope ou pour lesquels des anticorps ont été générés. Si ce protocole doit être adapté pour la puce des protéines non histones, paramètres incluant le temps de fixation, concentration de la chromatine pendant la période d’enquête et de la concentration en anticorps sont souvent essentiels à l’obtention de l’enrichissement de la protéine ciblée sur le fond. Le plus souvent, il est utile d’augmenter le temps de fixation avec du formaldéhyde pour entre 45 et 60 min et que le montant de la chromatine, utilisée pendant la période d’enquête (jusqu'à 200 µg de protéines totales).

    Il y a un certain nombre de variables potentielles qui contribuent à la qualité et la reproductibilité des expériences de puce de modification histone. Bien qu’une expérience optimale peut souvent donner des résultats positifs lors de la comparaison des différences stark (par exemple, les niveaux de H3K4me2 dans les cellules de type sauvage ou set1Δ, comme illustré à la Figure 3 a), des différences plus subtiles sont susceptibles d’être masqués dans un expérience mal réalisée (par exemple, les différents niveaux de H4K16ac à TEL07L dans les cellules Δ de type sauvage ou sir2, comme illustré à la Figure 3 b). Les paramètres expérimentaux à considérer comprennent la quantité de cellules de levure utilisées, le temps de fixation, concentration de la fraction de la chromatine dans la période d’enquête, taille des fragments des complexes ADN-protéines digérées et la qualité de l’anticorps et la concentration. Une des limites de cette approche sont que l’optimisation des paramètres expérimentaux est généralement requise pour chaque modification d’histone mis à l’essai et les conditions sous enquête et/ou de souches mutantes. Il peut y avoir des différences subtiles dans les histones marque de niveaux ou de localisation dans des conditions différentes, et la capacité à détecter ces différences est liée sur les paramètres décrits ci-dessus. Nous discutons de certaines considérations clées pour développer des approches expérimentales les plus sensibles ci-dessous.

    Comme décrit dans le protocole, il est recommandé de tester plusieurs concentrations de MNase pour déterminer la concentration optimale avant d’effectuer une expérience pleine de puce. Veiller à ce que l’ADN au sein de la propriété intellectuelle est fragmenté adéquatement est essentielle à l’obtention de résultats de puce haute résolution. Même si la taille de l’amplicon des produits qPCR peut être réduite (généralement moins de 100 bp), si la taille du fragment d’ADN est bien plus gros, le qPCR peut indiquer faussement l’enrichissement à un lieu spécifique quand, en réalité, la marque d’histone peut être localisée centaines de basepairs de suite. Alors que ce protocole repose sur MNase de solubiliser la chromatine en mono - et di-nucléosomes, autres protocoles puce utilisent aussi couramment sonication pour cisailler la chromatine6,7. La sonication est également une méthode fiable pour la solubilisation des fragments de la chromatine, bien que la taille de cisaillement ont tendance à être moins uniforme et il peut être plus difficile à obtenir des résultats cohérents entre les expériences. Bien que la sonication peut être préférable pour la puce de certaines protéines non histones, l’utilisationdes MNase pour digérer la chromatine dans principalement mono-nucléosomes peuvent améliorer la netteté des expériences de puce de modification histone.

    Une condition requise pour une expérience réussie de puce est un anticorps qui unique et avec une haute affinité reconnaît la modification des histones d’intérêt. La principale limite de puce comme une méthode pour la détection de modification des histones est sa dépendance sur un anticorps de haute qualité, validé ; sans un tel réactif, les résultats obtenus à partir de puce ne sont pas susceptibles d’être pertinents sur le plan biologique. Il y a un certain nombre d’anticorps disponibles sur le marché contre les modifications d’histones dans la levure de bière, bien que la qualité et la validité des anticorps est variable. Efforts pour valider ces anticorps ont produit des ressources utiles pour déterminer le meilleur anticorps disponibles pour une expérience donnée26. Il est recommandé que les anticorps utilisés pour puce sont validées avec une diversité de méthodes pour leur spécificité, notamment par des tableaux de palpage de peptides histones modifiées et non modifiées, effectuant des transferts western d’extraits de cellules entières et des histones purifiées et en expériences de puce avec des contrôles appropriés, tels que les souches avec une enzyme de modification supprimé ou transportant des mutations ponctuelles dans les résidus d’histones modifiées. Pour les nouveaux anticorps qui reconnaissent les marques indéterminés ou anticorps générés par laboratoire, ces expériences de spécificité sont jugés essentiels pour déterminer si l’anticorps peut être un réactif valide pour la puce.En plus de la validation de la spécificité de l’anticorps, effectuer un titrage d’anticorps pour l’adresse IP d’une souche de type sauvage et une souche de contrôle négatif est souvent utile pour déterminer la quantité d’anticorps nécessaire (par rapport à une concentration de chromatine set) à détecter les différences exactes en enrichissement entre souches ou des régions du génome. En outre, si certaines données concernant les patrons de distribution génomique de la marque sont connus, positifs et négatifs paires d’amorces de contrôle doivent être incluses dans toutes les expériences de qPCR pour valider toute expérience individuelle et de simplifier les comparaisons entre les expériences.

    Dans l’ensemble, cet ouvrage décrit une méthode fondamentale pour les chercheurs intéressés à interroger le statut de modification des histones à n’importe quelle région génomique dans la levure de bière. La polyvalence du présent protocole et son applicabilité aux diverses questions expérimentales rend un outil extrêmement utile pour disséquer la dynamique de la chromatine au niveau moléculaire.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Les auteurs n’ont rien à divulguer.

    Acknowledgments

    Les auteurs tiennent à remercier les membres du laboratoire vert pour discussions utiles. Ce travail a été soutenu en partie par des subventions NIH R03AG052018 et R01GM124342 à E.M.G.

    Materials

    Name Company Catalog Number Comments
    Yeast Extract Research Products International (RPI) Y20025-1000.0
    Peptone Research Products International (RPI) P20250-1000.0
    Dextrose ThermoScientific BP350-1
    Formaldehyde Sigma-Aldrich F8775
    Glycine Fisher Scientific AC12007-0050
    Tris Amresco 0497-5KG
    EDTA Sigma-Aldrich E6758-500G
    NaCl ThermoScientific BP358-10
    4-Nonylphenyl-polyethylene glycol Sigma-Aldrich 74385 Equivalent to NP-40
    MgCl ThermoScientific S25533
    CaCl2 Sigma-Aldrich 20899-25G-F
    LiCl ThermoScientific AC413271000
    Sodium Dodecyl Sulfate Amresco M107-1KG
    Sodium Deoxycholate Sigma-Aldrich 30970-100G
    Sodium Acetate Sigma-Aldrich S2889
    NaHCO3 ThermoScientific S25533
    PMSF Sigma-Aldrich P7626-5G
    Yeast protease inhibitor cocktail VWR 10190-076
    25 Phenol:24 Chloroform:1 Isoamyl Alcohol VWR Life Science 97064-824
    Ethanol Sigma-Aldrich E7023
    Nuclease-Free Water VWR 100720-992
    Micrococcal Nuclease Worthington Biochemical LS004797
    Glycogen ThermoScientific R0561
    Proteinase K Research Products International (RPI) P50220-0.1
    RNase A  Sigma-Aldrich R6513-50MG
     Bradford Assay Reagent ThermoScientific 23238
     BSA Standard 2 mg/mL ThermoScientific 23210
    α H4 EMD Millipore 04-858
    α H4K16ac EMD Millipore ABE532
    α H3 Abcam ab1791
    α H3K4me2 Active Motif 39142
     High Rox qPCR Mix Accuris qMax Green, Low Rox qPCR Mix ACC-PR2000-L-1000
    Protein A/G Magnetic Beads ThermoScientific 88803
    magnetic stand for 1.5mL tubes Fisher Scientific PI-21359
    Acid-Washed Glass Beads Sigma-Aldrich G8772
     Microtube Homogenizer Benchmark D1030
    2.0 mL screw-cap tubes with sealing rings Sigma-Aldrich Z763837-1000EA
    Gel loading tips Fisher Scientific 07-200-288
    Cuvettes Fisher Scientific 50-476-476
    Parafilm Fisher Scientific 13-374-10
    50 mL conical tubes Fisher Scientific 14-432-22
    384-Well PCR Plate Fisher Scientific AB-1384W
     Gyratory Floor Shaker New Brunswick Scientific Model G10
    Spectrophotometer ThermoScientific ND-2000c
     Real-Time PCR Detection System Bio-Rad 1855485

    DOWNLOAD MATERIALS LIST

    References

    1. Jaiswal, D., Turniansky, R., Green, E. M. Choose Your Own Adventure: The Role of Histone Modifications in Yeast Cell Fate. J Mol Biol. 429, (13), 1946-1957 (2017).
    2. Suganuma, T., Workman, J. L. Signals and combinatorial functions of histone modifications. Annu Rev Biochem. 80, 473-499 (2011).
    3. Solomon, M. J., Varshavsky, A. Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures. P Natl Acad Sci USA. 82, (19), 6470-6474 (1985).
    4. Solomon, M. J., Larsen, P. L., Varshavsky, A. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell. 53, (6), 937-947 (1988).
    5. Gilmour, D. S., Lis, J. T. Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes. P Natl Acad Sci USA. 81, (14), 4275-4279 (1984).
    6. Lefrançois, P., et al. Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics. 10, 37 (2009).
    7. Furey, T. S. ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet. 13, (12), 840-852 (2012).
    8. Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic Loci. Cell. 136, (1), 175-186 (2009).
    9. Byrum, S. D., Raman, A., Taverna, S. D., Tackett, A. J. ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep. 2, (1), 198-205 (2012).
    10. Soldi, M., Bremang, M., Bonaldi, T. Biochemical systems approaches for the analysis of histone modification readout. Biochim Biophys Acta. 1839, (8), 657-668 (2014).
    11. Soldi, M., Bonaldi, T. The ChroP approach combines ChIP and mass spectrometry to dissect locus-specific proteomic landscapes of chromatin. J Vis Exp. (86), (2014).
    12. Kuo, M. H., Allis, C. D. In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment. Methods. 19, (3), 425-433 (1999).
    13. Meluh, P. B., Broach, J. R. Immunological analysis of yeast chromatin. Methods Enzymol. 304, 414-430 (1999).
    14. Rozen, S., Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132, 365-386 (2000).
    15. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods. 50, (4), S1-S5 (2010).
    16. Rodríguez, A., Rodríguez, M., Córdoba, J. J., Andrade, M. J. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol. 1275, 31-56 (2015).
    17. Briggs, S. D., et al. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Gene Dev. 15, (24), 3286-3295 (2001).
    18. Bernstein, B. E., et al. Methylation of histone H3 Lys 4 in coding regions of active genes. P Natl Acad Sci USA. 99, (13), 8695-8700 (2002).
    19. Pokholok, D. K., et al. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122, (4), 517-527 (2005).
    20. Krogan, N. J., et al. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell. 11, (3), 721-729 (2003).
    21. South, P. F., Harmeyer, K. M., Serratore, N. D., Briggs, S. D. H3K4 methyltransferase Set1 is involved in maintenance of ergosterol homeostasis and resistance to Brefeldin A. P Natl Acad Sci USA. 110, (11), E1016-E1025 (2013).
    22. Margaritis, T., et al. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3'-end antisense transcription. PLoS Genet. 8, (9), e1002952 (2012).
    23. Jezek, M., et al. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance. Epigenetics. 12, (2), 93-104 (2017).
    24. Suka, N., Luo, K., Grunstein, M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat Genet. 32, (3), 378-383 (2002).
    25. Kimura, A., Umehara, T., Horikoshi, M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 32, (3), 370-377 (2002).
    26. Rothbart, S. B., et al. An Interactive Database for the Assessment of Histone Antibody Specificity. Mol Cell. 59, (3), 502-511 (2015).
    Immunoprécipitation de la chromatine (ChIP) des Modifications d’Histone de <em>Saccharomyces cerevisiae</em>
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).More

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter