Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Imunoprecipitação da cromatina (ChIP) de modificações do Histone de Saccharomyces cerevisiae

doi: 10.3791/57080 Published: December 29, 2017

Summary

Aqui, descrevemos um protocolo para a imunoprecipitação da cromatina de histonas modificadas de brotamento levedura Saccharomyces cerevisiae. Immunoprecipitated DNA é usado posteriormente para PCR quantitativo para interrogar a abundância e a localização de modificações borne-translational do histone durante todo o genoma.

Abstract

Modificações do histone pós-traducional (PTMs), tais como a acetilação, metilação e fosforilação, dinamicamente são reguladas por uma série de enzimas que adicionar ou remover estas marcas em resposta a sinais recebidos pela célula. Estes PTMS são principais contribuintes para a regulamentação dos processos, tais como controle de expressão de gene e reparo do DNA. Imunoprecipitação da cromatina (chIP) tem sido uma abordagem instrumental para dissecar a abundância e a localização de muitos PTMs de histona por todo o genoma em resposta a diversas perturbações para a célula. Aqui, um método versátil para a realização de microplaqueta das histonas post-translationally modificadas de brotamento levedura Saccharomyces cerevisiae (S. cerevisiae) é descrito. Este método baseia-se na reticulação de proteínas e DNA usando formol tratamento de culturas de leveduras, geração de levedura lisados por grânulo batendo, solubilização de fragmentos de cromatina por nuclease micrococcal e imunoprecipitação de histona-DNA complexos. DNA associado com a marca do histone de interesse é purificado e submetido a análise PCR quantitativo para avaliar seu enriquecimento em múltiplos loci durante todo o genoma. Experiências representativas sondando a localização das marcas de histona H3K4me2 e H4K16ac em sua e levedura mutante são discutidas para demonstrar a interpretação e análise de dados. Este método é adequado para uma variedade de histona PTMs e pode ser realizado com diferentes cepas mutantes ou na presença de diversos estresses ambientais, tornando-se uma excelente ferramenta para investigar as alterações na dinâmica da cromatina em condições diferentes.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A modificação pós-traducional dinâmica (PTM) de histonas é um mecanismo regulatório essencial para muitos processos de DNA-modelo, incluindo a transcrição, replicação e reparo de DNA1,2. A capacidade de determinar a abundância e a localização exacta das histonas modificadas concomitantes com esses processos, portanto, é fundamental para compreender seu regulamento sob condições diferentes na célula. O desenvolvimento da imunoprecipitação da cromatina (chIP) como um método largamente resultado de estudos bioquímicos das interações de proteínas com DNA, particularmente em vitro métodos usando química crosslinkers, juntamente com a necessidade de avaliar o natureza dinâmica do proteína-ADN interações em vivo e em regiões específicas do genoma,4,3,5. O avanço das tecnologias de sequenciamento e PCR quantitativo (qPCR) também ampliou a capacidade de realizar experimentos de microplaqueta com comparações quantitativas e através de genomas toda, tornando-se uma poderosa ferramenta para dissecar interações DNA-proteína no vários níveis.

Atualmente, o chIP é um método necessário para qualquer grupo de pesquisa interessado em regulamento mediada por cromatina do genoma como existem sem métodos comparáveis para interrogar diretamente a ligação física entre uma histona modificada e um locus específico de genômico em vivo. Apesar de variações deste método usando a próxima geração de sequenciamento para mapear modificações do histone em todo o genoma de6,7 estão disponíveis, essas abordagens podem abordar diferentes questões científicas e sua escala, o custo e recursos técnicos podem ser um fator limitante para alguns grupos de pesquisa. Além disso, a microplaqueta-qPCR alvo é necessário complementar estas abordagens, fornecendo métodos para ambos otimizar o protocolo chIP antes de sequenciamento e validar resultados de conjuntos de dados epigenomic. Espectrometria de massa com base em abordagens para identificar o conjunto completo de histona marcas associadas com regiões genômicas tem também emergiu8,9,10,11, no entanto, estas abordagens têm algumas limitações sobre quais regiões do genoma podem ser sondadas e exigem perícia técnica e instrumentação que não estará disponível para todos os grupos de pesquisa. Portanto, o chIP permanece um método fundamental para analisar a abundância e distribuição de modificações do histone sob diversas condições para todos os grupos de pesquisa interessados em epigenética, da cromatina e a regulação de funções genômicas.

Aqui, descrevemos um método para o modelo de chIP usando o fermento budding Saccharomyces cerevisiae (S. cerevisiae) para investigar a distribuição de PTMs de histonas na cromatina. Esta abordagem se baseia em um número de componentes principais da microplaqueta protocolos desenvolvidos no fermento e também aplicado ao modelo diversos sistemas12,13. Interações entre modificados histonas e DNA na célula são preservadas por reticulação com formaldeído. Após preparação lisada, fragmentos de cromatina são solubilizados em fragmentos de tamanho uniformemente por digestão com nuclease micrococcal. Imunoprecipitação das histonas modificadas é realizada com anticorpos comerciais ou gerados pelo laboratório e qualquer associado DNA é isolado e analisado para enriquecimento em determinadas regiões genômicas usando qPCR (Figura 1). Para muitas modificações do histone, a quantidade de DNA obtido a partir deste protocolo é suficiente para o ensaio de mais de 25 diferentes loci genômicos por qPCR.

Este método de microplaqueta é altamente versátil para monitorar a distribuição de uma modificação do histone único em vários cepas mutantes ou condições ambientais, ou para testar várias modificações do histone em sua células em um número de loci genômicos. Além disso, vários componentes do protocolo são facilmente ajustáveis para otimizar a deteção de qualquer marcas altamente ou humilde-abundante de histona. Finalmente, realizando a microplaqueta das histonas modificadas em leveduras brotamento fornece a oportunidade de usar controles chaves para a especificidade do anticorpo que não estão amplamente disponíveis em outros sistemas. Ou seja, cepas de leveduras podem ser geradas que carregam mutações pontuais em resíduos de histona que são direcionados para a modificação, e, em alguns casos, há apenas uma única enzima que cataliza modificação em um resíduo de histona particular (ex. lisina de histona metiltransferases). Portanto, microplaqueta pode ser executada em qualquer as histona mutante ou enzima exclusão cepas a ensaiar a medida em que a ligação não-específica do anticorpo pode ser ocorrendo e gerando resultados falso-positivos. Este controle é particularmente valioso para anticorpos recém-desenvolvidos e pode mesmo ser usado para validar a especificidade do anticorpo para modificações do histone conservado antes da sua utilização em outros sistemas. Essa abordagem complementa outros métodos para testar a especificidade do anticorpo que distinguem entre Estados-Membros diferentes de modificação (tais como mono-, di - e tri-metilação), incluindo matrizes de peptídeos modificados de sondagem e realizando borrões ocidentais das histonas ou nucleossomas com modificações definidas. Globalmente, o chIP em leveduras brotamento é um poderoso método para avaliar a dinâmica da histona PTMs durante todo o genoma e dissecando os mecanismos que regem a sua regulação.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. pré-vincular o anticorpo para grânulos magnéticos

  1. Misture os grânulos magnético A/G de proteína bem e transfira a 20 µ l de grânulos magnéticos por uma imunoprecipitação (IP) de amostra para um tubo de 1,5 mL.
    Nota: Quando pipetagem grânulos, use todo o furo, baixa retenção de dicas.
  2. Coloque o tubo com grânulos em um carrinho magnético e permitir grânulos recolher no lado do tubo. Remova o sobrenadante.
  3. Lave os grânulos 3 vezes com 1 mL de frio salino Tris (TBS) (pH 7,5, 150 mM NaCl de 50 mM Tris-HCl).
  4. Adicione 200 µ l de TBS de grânulos e a quantidade adequada de anticorpos. Girar a 8 rpm durante a noite a 4 ° C.
    Nota: Para muitos anticorpos anti histona PTM, 1-3 µ g de anticorpo por IP é suficiente. No entanto, experimentos de titulação são recomendados para determinar concentrações adequadas. Concentrações recomendadas para anticorpos de histona bem caracterizadas, comercial PTM frequentemente são precisas e podem ser encontradas em relatórios publicados ou literatura do produto.
  5. Coloque as contas em um carrinho magnético e remover o sobrenadante. Lave-os com 1 mL de TBS.
  6. Resuspenda as contas em 20 µ l de TBS por exemplo IP mais um adicional 5 µ l (em caso de erro de pipetagem) de TBS.
    Nota: Os grânulos podem ser armazenados a curto prazo a 4 ° C até o uso.

2. crescer células de levedura

  1. Inocular 10 mL de YPD (extrato de levedura de 10%, 20% de peptona e 20% dextrose) com uma única colônia da estirpe apropriada e cultivá-lo a 30 ° C durante a noite em uma incubadora agitando a 220 rpm.
  2. Medir a densidade óptica em 600 nm (OD600) de cultura de levedura, utilizando um espectrofotômetro. Diluir a cultura para uma OD600 = 0,2 em 100 mL YPD num balão de novo.
  3. Crescem as células a 30 ° C, uma incubadora de agitação a 220 rpm até atingirem a fase de log de mid (OD600 = 0,6-0,8).

3. in Vivo de reticulação de proteínas para o DNA

  1. Quando culturas alcançam a fase log de mid, adicione 2,7 mL de formol 37% diretamente para o meio, para uma concentração final de 1% de formaldeído. Transferir o balão para um agitador a 25 ° C (ou temperatura) e sacode a 50 rpm por 15 min.
  2. Adicionar 5 mL de glicina de 2,5 M para o médio e continuar apertando a 50 rpm em temperatura ambiente por 5 min saciar o formaldeído.
  3. Transferir as células para centrifugar garrafas e girar as células a 5800 x g por 5 min a 4 ° C. Decante o sobrenadante.
    1. Lavar as células por resuspending-los em 45 mL de TBS frio e transferir a suspensão em um tubo cónico de 50 mL. Girar o tubo a 2800 x g, durante 3 min a 4 ° C. Remova o sobrenadante.
    2. Lavagem que das células em 10 mL de frio chIP do lysis (50 mM Tris-HCl pH 7,5, 150 mM NaCl, ácido de 1 mM ácido etilenodiaminotetracético (EDTA), 1% nonidet octil phenoxypolyethoxylethanol (NP-40), armazenado a 4 ° C).
    3. Girar as células a 2800 x g, durante 3 min a 4 ° C. Remova o sobrenadante.
      Nota: As células podem ser congeladas com nitrogênio líquido e armazenadas a-80 ° C até o processamento adicional.

4. faça Lysates do fermento

  1. Ressuspender as células em 1 mL de tampão de Lise ChIP frio com fluoreto de phenylmethylsulfonyl de 1 mM (PMSF) e diluição de 1:1,000 do inibidor de protease de levedura cocktail. Transfira a suspensão para um tubo de tampa de rosca de 2,0 mL contendo 200 µ l de esferas de vidro.
  2. Transferir as células para um grânulo batendo o aparelho para a agitação de alta velocidade a 4 ° C e grânulo venceu 6 vezes por 30 s cada. Manter as células no gelo pelo menos 1 min entre cada grânulo batendo.
  3. Transfira o lisado para um tubo de 1,5 mL usando gel dicas de carregamento. Centrifugue o lisado a 15.500 x g por 20 min a 4 ° C.
  4. Desprezar o sobrenadante e ressuspender o precipitado em 250 µ l de tampão de digestão MNase (pH 10 mM Tris-HCl 7,5, 10 mM de NaCl, 3 mM MgCl2, 21 mM CaCl2, 1% NP-40, armazenadas a 4 ° C) suavemente pipetando acima e para baixo.
  5. Adicione 2,5 µ l de MNase para as reações. Misturá-los gentilmente por inversão 4 - 6 vezes e imediatamente ele incubar em banho-maria 37 ° C por 20 min.
    Nota: Condições de digerir devem ser otimizadas quando um novo estoque de MNase é usado. Consulte a etapa 10 para o protocolo.
  6. Imediatamente, coloque os tubos no gelo para parar a reação e adicionar 5 µ l de EDTA 0,5 M para uma concentração final de 10 mM de EDTA. Misturá-los gentilmente por inversão.
  7. Centrifugue a reação a 15.500 x g, durante 15 min a 4 ° C e transferir o sobrenadante para um novo tubo de 1,5 mL.
    Nota: Solúvel (digerida) cromatina será no sobrenadante. O sedimento contém restos de celular qualquer coisa não digerido e insolúvel.

5. Immunoprecipitate (IP) modificado histonas

  1. Determine a concentração de proteína de cada fração de cromatina MNase-liberado usando um ensaio de Bradford. Adicione 1 mL do reagente de Bradford para cada um dos 8 cubetas descartáveis mais 1 cuvete adicional para cada amostra de proteína a ser testado.
    1. Prepare uma solução stock de 2 mg/mL albumina de soro bovino (BSA).
    2. Adicionar o volume apropriado para atingir as seguintes concentrações de BSA em 1 mL de reagente de Bradford: 0 μg/mL, 0,5 μg/mL, 1 μg/mL, 2 μg/mL, 4 μg/mL, 6 μg/mL, 8 μg/mL e 10 μg/mL. Adicione 2 μL da fração cromatina MNase-liberado para as cubetas adicionais.
    3. Cubra a parte superior de cada cubeta com um pequeno pedaço de parafilm e inverter as cubetas de 4 - 6 vezes para misturar a solução bem. Incube as cubetas em temperatura ambiente por 15 min.
    4. Usando um Espectrofotômetro de luz visível, medir a absorvância a 595 nm para a curva de calibração e amostras experimentais.
      Nota: Utilize a cubeta sem BSA (0 μg/mL) para em branco o espectrofotômetro antes de tomar a primeira medição.
    5. Traça uma curva padrão usando os valores de absorvância para as diferentes concentrações de BSA na associado com o espectrofotômetro ou software de planilha eletrônica. Com base na curva padrão e o factor de diluição utilizada (1: 500), use os valores de absorvância para calcular a concentração de proteína para cada uma das amostras de fração de cromatina.
  2. Para cada IP, adicione 50 µ g de proteína total da fracção MNase-lançado cromatina de tampão de Lise ChIP para atingir um volume final de 1 mL.
    Nota: Se configurar mais de um IP por lisado, faça uma mistura de mestre do lisado e ChIP do lysis e alíquotas de 1ml para tubos individuais para o IP.
  3. Retire a mistura do IP para processar como o exemplo de entrada 100 µ l. Congele a-20 ° C, o exemplo de entrada até o passo 7.1.
    Nota: Qualquer amostra restante de cromatina também pode ser congelada a-20 ° C e usada para um IP subsequente, se desejado.
  4. Adicione 20 µ l de magnéticos grânulos de A/G de proteína pre-vinculado com anticorpo para cada amostra IP.
Girar a amostra a 8 rpm para 3h (padrão) ou durante a noite (se preferir), a 4 ° C.

6. Lave a IPs e eluir complexos histona-DNA

  1. Coloque os tubos em um carrinho magnético e deixa grânulos recolher na lateral do tubo. Remova o sobrenadante com uma pipeta. Lave os grânulos sucessivamente com 1 mL de cada um dos buffers abaixo.
    1. Realizar cada lavagem girando a 8 rpm por 5 min a 4 ° C, colocando grânulos em um carrinho magnético, remover o sobrenadante e adicionar próximo buffer: 2x - ChIP do lysis, 2x - alta sal tampão de lavagem (50 mM Tris-HCl pH 7,5, 500 mM de NaCl, 1 mM EDTA 1% NP-40, armazenadas a 4 ° C), 1 x - LiCl/detergente de tampão de lavagem (10 mM Tris-HCl pH 8.0, 250mm LiCl, 1 mM EDTA, 1% NP-40, Deoxycholate do sódio de 1%, armazenada a 4 ° C), 1 x - TE (10 mM Tris-HCl pH 8,0, 1 mM EDTA, armazenada a 4 ° C) e 1 x - TE.
    2. Com última lavagem TE, transferi contas para um novo tubo usando 0,5 mL de TE transferir a maioria dos grânulos, depois outro 0,5 mL de TE lavar o tubo e transferir o restante de grânulos.
  2. Adicione 250 µ l de tampão de eluição ChIP feito recentemente (1% SDS, NaHCO3de 1 mM). Vórtice a solução brevemente. Gire as amostras a 8 rpm durante 15 minutos à temperatura ambiente.
  3. Coloque o tubo em um suporte magnético e coletar os grânulos. Cuidadosamente, transferir o sobrenadante para um tubo novo e evitar os grânulos.
    Nota: O eluído contém proteínas de immunoprecipitated e DNA associado.
  4. Adicione outro 250 μL de tampão de eluição de ChIP de grânulos. Gire as amostras a 8 rpm durante 15 minutos à temperatura ambiente.
  5. Transferi com cuidado o sobrenadante no tubo que contém a primeira eluição. Se necessário, remova um volume menor (240 µ l) para todos os IPs evitar perturbar os grânulos.

7. inverta as referências cruzadas proteína-ADN

  1. Descongelar as amostras de entrada e adicionar 400 µ l de tampão de eluição de ChIP a cada entrada.
  2. A entrada e amostras IP, adicione 20 µ l de NaCl 5m, 5 µ l de glicogênio de 20 mg/mL e 12,5 µ l de Proteinase K. Mix de 20 mg/mL bem invertendo ou sacudir os tubos. Incube as amostras em um banho de água de 65 ° C durante a noite.

8. purificar e concentrar-se DNA

  1. Adicione 10 µ l de RNase A 10mg/mL para a entrada e amostras IP. Incube as amostras em banho-maria 37 ° C por 30 min.
  2. Adicione 600 µ l de álcool fenol: chlorofrom:isoamyl (25:24:1 PCI) para a solução aquosa e misturá-los bem. Girá-los a 15.500 x g durante 5 min à temperatura ambiente.
    1. Retire a camada aquosa para um novo tubo. Adicione 600 µ l de PCI e misturá-los bem. Gire o tubo a 15.500 x g durante 5 min à temperatura ambiente. Transferi a fase aquosa para um tubo novo.
      Cuidado: Trabalho na coifa e usar equipamento de protecção adequado quando se trabalha com PCI. Descarte de resíduos líquidos e sólidos como instruído pelas diretrizes institucionais.
  3. Adicione 0,1 x volume de acetato de sódio 3M e 1 mL de álcool etílico frio de 100% para precipitar o DNA. Inverter o tubo 4 - 6 vezes para misturar a solução bem. Incube a-20 º C durante a noite.
    1. Girar o tubo a 15.500 x g por 20 min a 4 ° C. Remova cuidadosamente o sobrenadante com uma pipeta.
    2. Lave o pellet em 1 mL de álcool etílico frio de 70%. Gire a 15.500 x g durante 10 minutos a 4 ° C. Remova cuidadosamente o sobrenadante com uma pipeta.
    3. Secar ao ar livre as pelotas de capuz por aproximadamente 20 min (até completamente seco). Resuspenda as amostras IP em 50 µ l de água livre de nuclease e Resuspenda entradas amostras em 100 µ l de água livre de nuclease. Armazene as amostras a-20 º C até realizando qPCR.

9. quantitativo PCR (qPCR) para detectar regiões enriquecido Genomic

  1. Faça uma mistura de mestre de qPCR para cada conjunto de primers. Uma reação contém 0,25 µ l de primer reverso de 20 µM, 0,25 µ l de primer para a frente de 20 µM e 5 µ l do mix de x qPCR 2.
    Nota: Projeto apropriado da primeira demão e testes para qPCR experimentos são descrevem em outros lugares14,15,16.
  2. Fazer mixagens mestre de DNA para cada amostra de DNA. Uma reação contém 0,5 µ l de DNA e 4,0 µ l de água livre de nuclease.
  3. Adicione 5,5 µ l do mix mestre primário apropriado e 4,5 µ l do mix mestre DNA apropriado a cada poço em um prato de qPCR 384-bem.
    Nota: Começar com a adição de 5,5 µ l da mistura da primeira demão a cada poço. Gire a placa a 200 x g por 1 min à temperatura ambiente antes de adicionar 4,5 µ l da mistura do DNA.
  4. Aderir o selo para o prato e girar a 200 x g por 1 min à temperatura ambiente.
  5. Executar qPCR utilizando um sistema de qPCR em tempo real com as seguintes condições: 95 ° C por 3 min; 40 ciclos de 95 ° C por 10 s, 55 ° C por 30 s; curva de fusão 65 ° C e 95 ° C, com incrementos de 0,5 ° C, 5 s.
  6. Para cada par de primer, calcule a porcentagem de entrada da amostra em relação a amostra de 5% entrada usada no qPCR IP. Use a técnica do PCR triplica os meios para executar os cálculos.
    Nota: Se uma variação substancial é observada em triplica o PCR, recomenda-se repetir o qPCR com atenção a composição da mistura de mestre, erros de pipetagem e contaminação cruzada entre os poços da placa de 384-bem.
    1. Ajuste os valores de Cq para a entrada de 100% subtraindo-se o número de ciclos que representa o fator de diluição de valores brutos de Cq.
      Nota: A entrada de cinco por cento representa um factor de diluição de 20 vezes, que é igual a 4,32 ciclos (log2 20 = 4,32).
    2. Calcular a porcentagem de entrada como 2 ^ (Cq deentrada - CqIP) multiplicado por 100.

10. determine MNase Digest condições (recomendado antes da microplaqueta completa primeiro experimento)

  1. Siga os passos 2.1 através de 4.4 do protocolo anterior. Aumenta o protocolo para gerar suficiente lisado para amostras múltiplas de digestão MNase da pelota contendo cromatina. No passo 4.4, resuspenda as pelotas em 1,25 mL de tampão de digestão de MNase. Alíquota as amostras para 5 tubos de modo que cada contém 250 µ l da pelota de cromatina resuspended no Buffer de digestão MNase.
  2. Adicionar 0, 1.5, 2.5 ou 5 µ l de MNase para cada tubo. Misturá-los gentilmente por inversão 4 - 6 vezes e imediatamente incubar os tubos num banho de água de 37 ° C por 20 min.
  3. Pare de reações imediatamente, colocação de tubos no gelo e adicionando 5 µ l de EDTA 0,5 M para uma concentração final de 10 mM.
Misture a solução suavemente por inversão.
  • Centrifugar os tubos a 15.500 x g, durante 15 min a 4 ° C e transferir o sobrenadante para um novo tubo de 1,5 mL.
  • Adicione o SDS a concentração final de 1% (25 µ l de solução a 10% das ações) e NaHCO3 a concentração final de 0,1 M (25 µ l de solução 1 M) para as amostras em tubos de 1,5 mL.
  • Adicione 20 µ l de NaCl 5m, 5 µ l de glicogênio e 12,5 µ l de 20mg/mL da protease K para as amostras em tubos de 1,5 mL. Incube-os a 65 ° C durante a noite.
  • Adicione 10 µ l de RNaseA 10 mg/mL. Incube a 37 ° C por 30 min.
  • Adicionar 300 µ l de PCI para a solução aquosa e misturá-los bem. Girar a 15.500 x g durante 5 min à temperatura ambiente.
    1. Retire a camada aquosa para um novo tubo. Adicione 300 µ l de PCI e misture bem. Girar a 15.500 x g durante 5 min à temperatura ambiente. Transferi a fase aquosa para um novo tubo.
  • Adicione 0,1 x volume de acetato de sódio 3M (normalmente ~ 30 µ l) e 1 mL de álcool etílico frio de 100% para precipitar o DNA. Inverter o tubo 4 - 6 vezes para misturar bem. Incube o tubo a-80 ° C por 1h ou a-20 ° C durante a noite.
    1. Girar o tubo a 15.500 x g por 20 min a 4° C. Remova cuidadosamente o sobrenadante com uma pipeta.
    2. Lave as bolinhas em 1 mL de álcool etílico frio de 70%. Girar a 15.500 x g durante 10 minutos a 4 ° C.
    3. Deixe que secar ao ar as pelotas no capô aproximadamente 20 min (ou até completamente seco). Resuspenda as pelotas em 30 µ l de água livre de nuclease.
  • Adicionar o DNA de corante a carregar e executar 20 µ l em um agarose 2% gel para visualizar digerido DNA.
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Um componente chave do presente protocolo é otimizar a concentração de nuclease micrococcal (MNase), usada para digerir a cromatina em fragmentos solúveis, como descrito no passo 10. Isto é crítico para a obtenção de dados de alta resolução sobre a distribuição das modificações do histone em regiões genômicas de interesse. Um MNase de titulação deve ser executado para determinar a concentração mais apropriada para alcançar principalmente mono-nucleosomes com uma quantidade menor de di-nucleosomes na fração solúvel da cromatina. Isto pode ser visualizado através da extração do DNA após digestão MNase da pelota contendo cromatina e realizando agarose gel eletroforese (Figura 2). Na preparação de MNase usado aqui, 2,5 µ l da enzima em 20 unidades / µ l produzido predominantemente mono-os nucleossomas, e, portanto, este montante foi utilizado para o chIP.

    Dois conjuntos de resultados representativos são mostrados para este procedimento de microplaqueta (Figura 3). No primeiro exemplo, uma marca de metilo do histone é avaliada em sua células ou células falta o methyltransferase que catalisa esta marca. Especificamente, chIP foi executada com um anticorpo contra H3K4me2, bem como contra histona H3 como um controle, em células Δ sua e set1. H3K4me2 principalmente localiza apenas a jusante da transcrição iniciar site na extremidade 5' de regiões codificantes e, na ausência de Set1, H3K4me2 não pode ser detectado em células17,18,19. A tensão Δ set1, portanto, serve como um controle para indicar a quantidade de sinal de fundo que pode ser atribuída à inespecificas de outras marcas de histona ou DNA ao anticorpo. Neste caso, a sua tensão mostrou claro enriquecimento para H3K4me2 na extremidade 5' de dois genes conhecidos por serem alvos diretos de Set1, PMA1 e ERG1120,21, Considerando que nenhum sinal foi observada em Δ set1 células (Figura 3A). Como esperado, não há nenhum enriquecimento da marca H3K4me2 em telômero (TEL) 07 L. A expressão do gene da esporulação média SPR3 também foi relatada para ser regulada por Set122,23, no entanto, o enriquecimento de H3K4me2 na extremidade 5' do SPR3 ORF é mais semelhante aos níveis observados em TEL07L, em comparação com qualquer PMA1 ou ERG11. Avaliando a localização desta marca de metilo indica que regulamento Set1-mediada de SPR3 é provável de ocorrer por um mecanismo diferente do que a PMA1 ou ERG11, como observadas anteriormente22.

    No segundo exemplo, microplaqueta de H4K16 acetilado é mostrada em relação a histona H4 em sua células e células falta a histona deacetilase Sir2, que remove as marcas de H4K16ac. H4K16ac é empobrecido na cromatina heterocromático, como perto do telômero e enriquecido em eucromatina mais distal o telômero24,25, como demonstrado por TEL07L e TEL15L (Figura 3B). Além disso, a perda da Sir2 provoca um aumento na H4K16ac em determinadas regiões teloméricas e subtelomeric, embora nenhuma mudança é observada no gene do controle PMA1, onde Sir2 não é conhecido para localizar. Enquanto estes dados mostram um claro aumento nos níveis de H4K16ac em células Δ sir2, a alteração detectada no H4K16ac, que não deverá ser tão substancial como a mudança no H3K4me2 na sua contra set1células Δ, pode ser obscurecida se chIP parâmetros são não devidamente otimizado. Recomendações para a otimização estão descritas na discussão.

    Figure 1
    Figura 1: Cronograma de procedimento microplaqueta. O horário típico para o protocolo da microplaqueta é mostrado. As variações possíveis são indicadas no texto. Clique aqui para ver uma versão maior desta figura.

    Figure 2
    Figura 2: MNase teste de digestão para solubilização de mono-nucleosomes. A electroforese do gel do agarose de DNA isolado após digestão da pelota de cromatina com quantidades variáveis de MNase (20 unidades / µ l). DNA da mononucleosomes migra em aproximadamente 150 bp, de dinucleosomes em aproximadamente 300 bp e DNA de polynucleosomes encontra-se em cada vez maior peso molecular. Clique aqui para ver uma versão maior desta figura.

    Figure 3
    Figura 3 : Fichas de H3K4me2 e H4K16ac em sua e estirpes de levedura mutante. (A) ChIP usando anticorpos contra H3K4me2 e H3 foi realizado em células Δ sua e set1. Entrada por cento foi calculada para cada par de primer para o H3K4me2 e o H3 IPs e a relação é graficamente para indicar o enriquecimento relativo de H3K4me2 nos loci indicado. Os primers para PMA1, ERG11 e SPR3 geram amplicons na extremidade 5' de cada ORF, considerando o par de primer TEL07L é adjacente ao telômero do braço esquerdo do cromossomo 7. A média de três repetições biológicas é mostrada e as barras de erro representam o erro padrão da média. (B) ChIP foi realizada com anticorpos reconhecendo H4K16ac e H4 em células Δ sua e sir2e plotado conforme descrito para a Figura 3A. Pares da primeira demão amplificam sequências adjacentes de telômeros (TEL07L e TEL15L) e a jusante no prazo definido anteriormente eucromatina regiões de cada subtelomere (21kb e 5KB distal do telômero, respectivamente).Por favor clique aqui para ver uma versão maior desta figura.

    Número de tensão Genótipo Referência
    yEG230 MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 23
    yEG223 MATα sir2Δ::NATMX Este estudo
    yEG232 MATa set1Δ::KANMX 23

    Tabela 1: Cepas de leveduras utilizadas neste estudo.

    Número de oligo Localização Sequência de
    oEG141 F TELVIIL AGCCCGAGCCTGTACTAAAT
    oEG142 TELVIIL R CAAAAGAAACTTTTCATGGCA
    oEG153 5' PMA1 F TCAGCTCATCAGCCAACTCAAG
    oEG154 5' PMA1 R CGTCGACACCGTGATTAGATTG
    oEG220 TELVIIL + F 21KB AAACAATGGGACCCTTCTGA
    oEG221 TELVIIL + R 21KB AACACCTTGCAAAACACAGG
    oEG280 F TELXVL ATCCTGCAATTGGGCCACTAT
    oEG281 TELXVL R AGCGGAAGGCATATTAACGT
    oEG282 TELXVL + F 5KB AGGCGATGTAATCTCACCAA
    oEG283 TELXVL + R 5KB CATTCACACATCCTGCTACCA
    oEG568 ERG11 F CCTCTTATTCCGTCGGTGAA
    oEG569 ERG11 R TGTGTCTACCACCACCGAAA
    oEG963 SPR3 F TCTGGATTCGCTGAGGAAGT
    oEG964 SPR3 R TTTCAGTTCAGGGCTTTTCG

    Tabela 2: Primers utilizados neste estudo.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    O procedimento descrito aqui permite a recuperação eficiente de DNA associado a histonas modificadas em células de levedura por imunoprecipitação. Isto é seguido por qPCR usando as primeiras demão que amplificam regiões de interesse para determinar o local enriquecimento ou esgotamento das modificações do histone específico. Apesar de ser desenvolvido como um método há quase 20 anos, microplaqueta permanece o ensaio decisivo para investigar o estatuto de modificação de histona a diferentes regiões genômicas e em diversas condições. Embora o chIP acoplado à próxima geração de tecnologias de sequenciamento podem interrogar modificações do histone num genoma-larga escala6,7, os custos e análise de dados necessários dessas abordagens podem limitar seu uso em algumas configurações de laboratório. Além disso, estas experiências epigenomic frequentemente são seguidas por chIP acoplado ao qPCR para validar as observações do status de modificações do histone em alguns loci genômicos. Existem alguns métodos comparáveis que fornecem a utilidade do chIP de fisicamente ligando uma marca do histone (ou outras proteínas) para um local específico dentro do genoma e analisar a dinâmica desta interação em diferentes condições ambientais ou biológicas . Embora tenha havido sucesso recente no isolamento da cromatina de regiões genômicas definidas e identificar as marcas de histona local utilizando espectrometria de massa8,9,10,11, estes métodos apresentam desafios técnicos e sua utilidade em tipos diversos de laboratório podem ser limitadas por um acesso adequado aos recursos de análise de instrumentação e dados de espectrometria de massa. O protocolo descrito aqui é tecnicamente e economicamente acessível para configurações de laboratório diverso, com o principal obstáculo possível sendo o acesso a uma máquina de qPCR. Microplaqueta continua a ser o padrão-ouro para a definição de localização genômica das histonas modificadas em leveduras e outros sistemas.

    Este é um protocolo versátil com uma série de etapas que podem ser otimizados para se adequar a diferentes condições experimentais, incluindo testes simultaneamente vários mutantes ou condições ambientais. Alternativamente, cromatina suficiente geralmente é gerada a partir de um lisado para executar vários IPs com até pelo menos quatro diferentes anticorpos. Este protocolo também pode ser usado para chIP de proteínas não-histonas cromatina que são epítopo-tag, ou para os quais foram gerados anticorpos. Se este protocolo é para ser adaptado para chIP de proteínas não-histonas, parâmetros, incluindo o tempo de fixação, concentração de cromatina no PI e concentração de anticorpo são frequentemente essenciais para obtenção de enriquecimento da proteína alvo sobre fundo. Mais comumente, é útil para aumentar o tempo de fixação em formol para entre 45 e 60 min e aumentar a quantidade de cromatina usada no PI (até 200 µ g de proteínas totais).

    Há um número de variáveis possíveis que contribuem para a qualidade e a reprodutibilidade de experimentos de microplaqueta de modificação de histona. Embora uma sub-óptima experiência pode muitas vezes produzir resultados positivos quando comparando diferenças stark (por exemplo, os níveis de H3K4me2 em sua ou set1células Δ, como mostrado na Figura 3A), mais sutis diferenças são susceptíveis de ser mascarada em uma experiência realizada incorretamente (como os diferentes níveis de H4K16ac em TEL07L em sua ou sir2células Δ, como mostrado na Figura 3B). Parâmetros experimentais a considerar incluem a quantidade de células de levedura utilizadas, tempo de fixação, concentração da fração cromatina usada no PI, tamanho do fragmento dos complexos DNA-proteína digeridos e o anticorpo qualidade e concentração. Uma limitação dessa abordagem é que a otimização dos parâmetros experimentais é geralmente necessária para cada modificação de histona sendo testado e as cepas mutantes e/ou condições sob investigação. Pode haver diferenças sutis em níveis de marca de histona ou localização em diferentes condições, e a capacidade de detectar essas diferenças é dependente sobre os parâmetros descritos acima. Vamos discutir algumas das considerações chaves para o desenvolvimento de abordagens experimentais mais sensíveis abaixo.

    Conforme descrito no protocolo, é aconselhável testar várias concentrações de MNase para determinar a concentração ideal antes de realizar um experimento completo chIP. Garantir que o DNA dentro do IP é adequadamente fragmentado é a chave para obtenção de alta resolução chIP resultados. Mesmo que o tamanho do amplicon dos produtos qPCR pode ser pequeno (geralmente inferior a 100 bp), se o tamanho do fragmento de DNA é substancialmente maior, o qPCR pode indicar falsamente enriquecimento em um locus específico, quando, na realidade, a marca do histone pode ser localizada centenas de basepairs embora. Enquanto este protocolo baseia-se na MNase para solubilizar a cromatina em mono - e di-os nucleossomas, outros protocolos de chIP também comumente utilizam sonication de cisalhamento cromatina6,7. Sonication também é um método confiável para solubilizing fragmentos de cromatina, embora os tamanhos de cisalhamento tendem a ser menos uniforme e pode ser mais difícil de conseguir resultados consistentes entre as experiências. Embora sonication pode ser preferível para chIP de algumas proteínas não-histonas, o uso de MNase para a digestão da cromatina em mono-nucleosomes principalmente pode melhorar a resolução de experimentos de microplaqueta de modificação de histona.

    Um requisito para uma experiência bem sucedida da microplaqueta é um anticorpo que excepcionalmente e com alta afinidade reconhece a modificação de histona de interesse. A principal limitação do chIP como um método para a deteção de modificação de histona é sua dependência de um anticorpo de alta qualidade, validado; sem tal reagente, resultados obtidos do chIP não são susceptíveis de ser biologicamente relevantes. Há um número de anticorpos comercialmente disponíveis contra modificações do histone encontrados em levedura de brotamento, embora a qualidade e a validade dos anticorpos é variável. Esforços para validar estes anticorpos têm produzido recursos úteis para a determinação do melhor anticorpo disponível para um determinado experimento26. Recomenda-se que os anticorpos usados para chIP são validados com uma diversidade de métodos para a sua especificidade, incluindo por sondagem matrizes de peptídeos de histona modificada e não modificada, realizando borrões ocidentais de extratos de células inteiras e histonas purificadas e em experimentos com controles adequados, tais como tensões com uma enzima modificando excluído ou carregando mutações pontuais no resíduo da histona modificado o chIP. Para novos anticorpos que reconhecem as marcas descaracterizadas ou anticorpos gerados pelo laboratório, estas experiências de especificidade são críticas para determinar se o anticorpo pode ser um reagente válido para chIP.Além de validar a especificidade do anticorpo, realizando uma titulação de anticorpos para o IP de uma estirpe de controlo negativo e uma estirpe de sua muitas vezes é útil para determinar a quantidade de anticorpos necessários (em relação a uma concentração de cromatina conjunto) para detecta diferenças exatas no enriquecimento entre estirpes ou regiões do genoma. Além disso, se alguns dados sobre os padrões de distribuição de genômica da marca são conhecidos, positivo e negativo conjuntos de controle da primeira demão devem ser incluídos em todos os experimentos de qPCR para validar qualquer experiência individual e para simplificar as comparações entre as experiências.

    Em geral, este trabalho descreve um método fundamental para pesquisadores interessados no status de modificação do histone em qualquer região genômica em leveduras brotamento a interrogar. A versatilidade do presente protocolo e sua aplicabilidade às diversas perguntas experimentais o torna uma ferramenta extremamente útil para dissecar dinâmica de cromatina, a nível molecular.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Os autores não têm nada para divulgar.

    Acknowledgments

    Os autores gostaria de agradecer aos membros do laboratório verde para debates úteis. Este trabalho foi financiado em parte por subvenções de NIH R03AG052018 e R01GM124342 para E.M.G.

    Materials

    Name Company Catalog Number Comments
    Yeast Extract Research Products International (RPI) Y20025-1000.0
    Peptone Research Products International (RPI) P20250-1000.0
    Dextrose ThermoScientific BP350-1
    Formaldehyde Sigma-Aldrich F8775
    Glycine Fisher Scientific AC12007-0050
    Tris Amresco 0497-5KG
    EDTA Sigma-Aldrich E6758-500G
    NaCl ThermoScientific BP358-10
    4-Nonylphenyl-polyethylene glycol Sigma-Aldrich 74385 Equivalent to NP-40
    MgCl ThermoScientific S25533
    CaCl2 Sigma-Aldrich 20899-25G-F
    LiCl ThermoScientific AC413271000
    Sodium Dodecyl Sulfate Amresco M107-1KG
    Sodium Deoxycholate Sigma-Aldrich 30970-100G
    Sodium Acetate Sigma-Aldrich S2889
    NaHCO3 ThermoScientific S25533
    PMSF Sigma-Aldrich P7626-5G
    Yeast protease inhibitor cocktail VWR 10190-076
    25 Phenol:24 Chloroform:1 Isoamyl Alcohol VWR Life Science 97064-824
    Ethanol Sigma-Aldrich E7023
    Nuclease-Free Water VWR 100720-992
    Micrococcal Nuclease Worthington Biochemical LS004797
    Glycogen ThermoScientific R0561
    Proteinase K Research Products International (RPI) P50220-0.1
    RNase A  Sigma-Aldrich R6513-50MG
     Bradford Assay Reagent ThermoScientific 23238
     BSA Standard 2 mg/mL ThermoScientific 23210
    α H4 EMD Millipore 04-858
    α H4K16ac EMD Millipore ABE532
    α H3 Abcam ab1791
    α H3K4me2 Active Motif 39142
     High Rox qPCR Mix Accuris qMax Green, Low Rox qPCR Mix ACC-PR2000-L-1000
    Protein A/G Magnetic Beads ThermoScientific 88803
    magnetic stand for 1.5mL tubes Fisher Scientific PI-21359
    Acid-Washed Glass Beads Sigma-Aldrich G8772
     Microtube Homogenizer Benchmark D1030
    2.0 mL screw-cap tubes with sealing rings Sigma-Aldrich Z763837-1000EA
    Gel loading tips Fisher Scientific 07-200-288
    Cuvettes Fisher Scientific 50-476-476
    Parafilm Fisher Scientific 13-374-10
    50 mL conical tubes Fisher Scientific 14-432-22
    384-Well PCR Plate Fisher Scientific AB-1384W
     Gyratory Floor Shaker New Brunswick Scientific Model G10
    Spectrophotometer ThermoScientific ND-2000c
     Real-Time PCR Detection System Bio-Rad 1855485

    DOWNLOAD MATERIALS LIST

    References

    1. Jaiswal, D., Turniansky, R., Green, E. M. Choose Your Own Adventure: The Role of Histone Modifications in Yeast Cell Fate. J Mol Biol. 429, (13), 1946-1957 (2017).
    2. Suganuma, T., Workman, J. L. Signals and combinatorial functions of histone modifications. Annu Rev Biochem. 80, 473-499 (2011).
    3. Solomon, M. J., Varshavsky, A. Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures. P Natl Acad Sci USA. 82, (19), 6470-6474 (1985).
    4. Solomon, M. J., Larsen, P. L., Varshavsky, A. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell. 53, (6), 937-947 (1988).
    5. Gilmour, D. S., Lis, J. T. Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes. P Natl Acad Sci USA. 81, (14), 4275-4279 (1984).
    6. Lefrançois, P., et al. Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics. 10, 37 (2009).
    7. Furey, T. S. ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet. 13, (12), 840-852 (2012).
    8. Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic Loci. Cell. 136, (1), 175-186 (2009).
    9. Byrum, S. D., Raman, A., Taverna, S. D., Tackett, A. J. ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep. 2, (1), 198-205 (2012).
    10. Soldi, M., Bremang, M., Bonaldi, T. Biochemical systems approaches for the analysis of histone modification readout. Biochim Biophys Acta. 1839, (8), 657-668 (2014).
    11. Soldi, M., Bonaldi, T. The ChroP approach combines ChIP and mass spectrometry to dissect locus-specific proteomic landscapes of chromatin. J Vis Exp. (86), (2014).
    12. Kuo, M. H., Allis, C. D. In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment. Methods. 19, (3), 425-433 (1999).
    13. Meluh, P. B., Broach, J. R. Immunological analysis of yeast chromatin. Methods Enzymol. 304, 414-430 (1999).
    14. Rozen, S., Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132, 365-386 (2000).
    15. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods. 50, (4), S1-S5 (2010).
    16. Rodríguez, A., Rodríguez, M., Córdoba, J. J., Andrade, M. J. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol. 1275, 31-56 (2015).
    17. Briggs, S. D., et al. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Gene Dev. 15, (24), 3286-3295 (2001).
    18. Bernstein, B. E., et al. Methylation of histone H3 Lys 4 in coding regions of active genes. P Natl Acad Sci USA. 99, (13), 8695-8700 (2002).
    19. Pokholok, D. K., et al. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122, (4), 517-527 (2005).
    20. Krogan, N. J., et al. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell. 11, (3), 721-729 (2003).
    21. South, P. F., Harmeyer, K. M., Serratore, N. D., Briggs, S. D. H3K4 methyltransferase Set1 is involved in maintenance of ergosterol homeostasis and resistance to Brefeldin A. P Natl Acad Sci USA. 110, (11), E1016-E1025 (2013).
    22. Margaritis, T., et al. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3'-end antisense transcription. PLoS Genet. 8, (9), e1002952 (2012).
    23. Jezek, M., et al. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance. Epigenetics. 12, (2), 93-104 (2017).
    24. Suka, N., Luo, K., Grunstein, M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat Genet. 32, (3), 378-383 (2002).
    25. Kimura, A., Umehara, T., Horikoshi, M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 32, (3), 370-377 (2002).
    26. Rothbart, S. B., et al. An Interactive Database for the Assessment of Histone Antibody Specificity. Mol Cell. 59, (3), 502-511 (2015).
    Imunoprecipitação da cromatina (ChIP) de modificações do Histone de <em>Saccharomyces cerevisiae</em>
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).More

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter