Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Kromatin Immunoprecipitation (ChIP) Histon ändringar från Saccharomyces cerevisiae

doi: 10.3791/57080 Published: December 29, 2017

Summary

Här beskriver vi ett protokoll för kromatin immunoprecipitation av modifierade histoner från spirande jästen Saccharomyces cerevisiae. Immunoprecipitated DNA används därefter för kvantitativ PCR för att förhöra överflöd och lokalisering av Histon post-translationella modifieringar i hela genomet.

Abstract

Histon post-translationella modifieringar (PTMs), såsom acetylering, metylering och fosforylering, regleras dynamiskt av en rad enzymer som Lägg till eller ta bort dessa märken som svar på signaler tas emot av cellen. Dessa PTMS är nyckelpersoner till regleringen av processer såsom gen uttryck kontroll och DNA reparation. Kromatin immunoprecipitation (chIP) har varit en instrumental tillvägagångssätt för dissekera överflöd och lokalisering av många Histon PTMs i hela genomet som svar på olika störningar till cellen. Här beskrivs en mångsidig metod för att utföra post-translationally modifierade histoner-chIP från spirande jästen Saccharomyces cerevisiae (S. cerevisiae) . Denna metod förlitar sig på crosslinking av proteiner och DNA använder formaldehyd behandling av jäst kulturer, generation av jäst lysates av pärla slå, lösbarhet av kromatin fragment av micrococcal nuclease och immunoprecipitation Histon-DNA komplex. DNA är associerad med varumärket Histon sevärdheter renas och föremål för kvantitativa PCR-analys att utvärdera dess anrikning på flera loci i hela genomet. Representativa experiment sondera localizationen av Histon varumärkena H3K4me2 och H4K16ac i vildtyp och muterade jäst diskuteras för att Visa dataanalys och tolkning. Denna metod är lämplig för en mängd Histon PTMs och kan utföras med olika muterade stammar eller i närvaro av olika miljöpåfrestningar, vilket gör det till ett utmärkt verktyg för att undersöka förändringar i kromatin dynamik under olika förhållanden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dynamiska posttranslationella modifieringen (PTM) av histoner är en viktig reglerande mekanism för många DNA-mallade processer, inklusive transkription, replikering och DNA reparation1,2. Möjligheten att bestämma överflöd och exakt lokalisering av modifierade histoner samtidig med dessa processer är därför avgörande för att förstå deras reglering under olika förhållanden i cellen. Utvecklingen av kromatin immunoprecipitation (chIP) som en metod som till stor del härrörde från biokemiska studier av interaktioner mellan proteiner och DNA, bestämt in vitro- metoder med kemiska bindemedel, tillsammans med behovet av att utvärdera den dynamiska karaktär av protein-DNA interaktioner i vivo och på specifika regioner av genomet3,4,5. Befordran av kvantitativ PCR (qPCR) och sekvensering teknik har också utökat möjligheten att utföra chIP experiment med kvantitativa jämförelser och över hela genomet, vilket gör det ett kraftfullt verktyg för dissekera DNA-protein interaktioner på flera nivåer.

För närvarande är chIP en lämplig metod för alla intresserade av kromatin-medierad reglering av genomet forskargrupp som det finns inga jämförbara metoder för direkt förhör den fysiska kopplingen mellan en modifierad Histon och en specifik genomisk locus i vivo. Även om det finns varianter av denna metod som använder nästa generations sekvensering mappa Histon ändringar i hela genomet6,7 , kan dessa synsätt behandla olika vetenskapliga frågor och deras skala, kostnad och tekniska resurser kan vara begränsande för vissa forskargrupper. Dessutom riktade chIP-qPCR är nödvändigt att komplettera dessa metoder genom att tillhandahålla metoder både optimera chIP protokollet före sekvensering och att validera resultaten från epigenetisk datamängderna. Masspektrometri baserad metoder för att identifiera full uppsättning av Histon märken förknippas med genomiska regioner har också dykt upp8,9,10,11, dock dessa metoder har vissa begränsningar angående vilka regioner i genomet kan vara utforskad och de kräver teknisk expertis och instrumentering som inte kommer att vara tillgängliga för alla forskargrupper. ChIP förblir därför en grundläggande metod för att analysera överflöd och distribution av Histon ändringar under varierande förhållanden för alla forskargrupper intresserad epigenetik, kromatin och regleringen av genomisk funktioner.

Här, beskriver vi en metod för chIP med spirande jästen modell Saccharomyces cerevisiae (S. cerevisiae) för att undersöka fördelningen av Histon PTMs på kromatin. Denna strategi bygger på ett antal centrala delarna av chIP protokoll utvecklad i jäst och också tillämpas på olika modell system12,13. Interaktioner mellan modifierade histoner och DNA i cellen bevarade av crosslinking med formaldehyd. Efter lysate beredning, kromatin fragment är solubilized i enhetligt medelstora fragment av matsmältning med micrococcal nuclease. Immunoprecipitation av modifierade Histonerna utförs med antingen kommersiella eller lab-genererade antikroppar och eventuella associerade DNA är isolerade och analyseras för berikning på särskilda genomisk regioner med qPCR (figur 1). För många Histon modifieringar räcker mängden DNA som erhållits från detta protokoll för att testa mer än 25 olika genomisk loci av qPCR.

Detta chIP metod är mångsidig för att övervaka distribution av en enstaka Histon ändring på flera mutant stammar eller miljöförhållanden, eller för att testa flera Histon ändringar i vildtyp celler på ett antal genetiska loci. Dessutom är många komponenter i protokollet enkelt justerbar att optimera upptäckt av antingen högt - eller ödmjuk-riklig Histon-märken. Slutligen ger utför chIP av modifierade histoner i spirande jäst möjlighet att använda viktiga kontroller för antikropp specificitet som till stor del inte är tillgängliga i andra system. Nämligen jäststammar kan genereras som bär punktmutationer i Histon rester som är avsedda för modifiering, och, i vissa fall finns det bara ett enda enzym som katalyserar ändring på en viss Histon rester (t.ex. Histon lysin metyltransferaser). Därför kan chIP utföras i antingen Histon mutant eller enzym radering stammar till assay i omfattning som icke-specifik bindning av antikroppen kan förekommande och generera falskt positiva resultat. Denna kontroll är särskilt värdefulla för nyutvecklade antikroppar, och kan även användas för att validera antikropp specificitet för bevarade Histon ändringar före deras användning i andra system. Detta synsätt kompletterar andra metoder för att testa antikropp specificitet som skiljer mellan olika modifiering stater (t.ex. mono-, di- och tri-metylering), inklusive sondera matriser av modifierade peptider och utföra western blotting av histoner eller nucleosomes med definierade ändringar. Övergripande, chIP i spirande jäst är en kraftfull metod för att bedöma dynamiken i Histon PTMs i hela genomet och dissekera de mekanismer som styr deras reglering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. före binda antikroppar mot magnetiska pärlor

  1. Blanda protein A/G magnetiska pärlor väl och överföra 20 µL av magnetiska pärlor per en immunoprecipitation (IP) prov till en 1,5 mL tub.
    Obs: När pipettering pärlor, använda wide-bore, låg-lagring tips.
  2. Ställ röret med pärlor i en magnetisk stå och pärlor för att samla på sidan av röret. Ta bort supernatanten.
  3. Tvätta pärlor 3 gånger med 1 mL kall Tris-buffrad koksaltlösning (TBS) (50 mM Tris-HCl pH 7.5, 150 mM NaCl).
  4. Tillsätt 200 µL av TBS till pärlor och lämplig mängd antikroppar. Rotera vid 8 varvtal över natten vid 4 ° C.
    Obs: För många Histon PTM antikroppar, 1-3 µg antikroppar per IP räcker. Dock rekommenderas titrering experiment att fastställa lämpliga koncentrationer. Rekommenderade koncentrationerna för välkarakteriserad, kommersiella Histon PTM antikroppar är ofta korrekta och kan hittas i publicerade rapporter eller dokumentation.
  5. Placera pärlorna i en magnetisk stå och ta bort supernatanten. Tvätta dem med 1 mL av TBS.
  6. Återsuspendera pärlorna i 20 µL av TBS per IP prov plus en ytterligare 5 µL (vid pipettering fel) TBS.
    Obs: Pärlorna kan lagras kortsiktiga vid 4 ° C fram till användning.

2. växa jästceller

  1. Inokulera 10 mL YPD (10% jästextrakt, 20% pepton och 20% dextros) med en enda koloni av lämpliga stammen och odla den vid 30 ° C över natten i en skakande inkubator vid 220 rpm.
  2. Mät den optiska densiteten vid 600 nm (OD600) av jästkultur med en spektrofotometer. Späd kulturen till en OD600 = 0,2 i 100 mL YPD i en ny kolv.
  3. Odla cellerna vid 30 ° C i en skakande inkubator vid 220 rpm tills de når mitten av log fas (OD600 = 0,6-0,8).

3. in Vivo Crosslinking av proteiner till DNA

  1. När kulturer når mitten av log fas, tillsätt 2,7 mL 37% formaldehyd direkt till medium, för en slutlig koncentration av 1% formaldehyd. Överföra kolven till en shaker vid 25 ° C (eller rumstemperatur) och skaka den vid 50 rpm i 15 min.
  2. Tillsätt 5 mL av 2,5 M glycin till medium och fortsätta skakar vid 50 rpm i rumstemperatur i 5 min att släcka formaldehyd.
  3. Överföra cellerna för att Centrifugera flaskor och snurra cellerna vid 5800 x g under 5 minuter vid 4 ° C. Dekantera supernatanten.
    1. Tvätta cellerna av omblandning dem i 45 mL kall TBS och överför till en 50 mL konisk tub. Snurra röret vid 2800 x g under 3 minuter vid 4 ° C. Ta bort supernatanten.
    2. Tvätta cellerna i 10 mL kallt chIP lyseringsbuffert (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM etylendiamintetraättiksyrans dinatriumsalt (EDTA), 1% nonidet octyl phenoxypolyethoxylethanol (NP-40), lagras vid 4 ° C).
    3. Snurra cellerna vid 2800 x g under 3 minuter vid 4 ° C. Ta bort supernatanten.
      Obs: Celler kan frysas med flytande kväve och lagras vid-80 ° C tills vidare bearbetning.

4. gör jäst Lysates

  1. Att resuspendera cellerna i 1 mL kall ChIP lyseringsbuffert med 1 mM phenylmethylsulfonyl fluor (PMSF) och 1:1,000 utspädning av den jäst proteashämmare cocktail. Överför till en 2,0 mL skruvlock röret som innehåller 200 µL av glaspärlor.
  2. Överföra cellerna till en pärla som slog apparater för hög hastighet agitation vid 4 ° C och bead beat 6 gånger för 30 s varje. Hålla cellerna på is för minst 1 min mellan varje pärla som slog.
  3. Överföra den lysate till ett 1,5 mL rör med gel lastning tips. Centrifugera det lysate på 15.500 x g i 20 min vid 4 ° C.
  4. Avlägsna supernatanten och återsuspendera pelleten i 250 µL av MNase matsmältningen buffert (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2, 21 mM CaCl2, 1% NP-40, lagras vid 4 ° C) genom att försiktigt upp och ner med.
  5. Tillsätt 2,5 µL av MNase på reaktionerna. Blanda dem försiktigt genom att vända 4 - 6 gånger och omedelbart Inkubera det i ett vattenbad på 37 ° C i 20 min.
    Obs: Digest villkor bör optimeras när ett nytt lager av MNase används. Se steg 10 för protokollet.
  6. Placera omedelbart rören på is för att stoppa reaktionen och tillsätt 5 µL 0,5 M EDTA för en slutlig koncentration på 10 mM EDTA. Blanda dem försiktigt genom inversion.
  7. Centrifugera reaktionen vid 15.500 x g i 15 minuter vid 4 ° C och överför supernatanten till en ny 1,5 mL tub.
    Obs: Lösligt (smält) kromatin kommer att vara i supernatanten. Pelleten innehåller något osmält och olösliga cellfragment.

5. Immunoprecipitate (IP) modifierad histoner

  1. Bestämma proteinkoncentration i varje MNase-släppt kromatin bråk med en Bradford-analys. Tillsätt 1 mL Bradford reagensmedel till varje 8 disponibla kyvetter plus 1 extra kyvetten för varje protein prov som testas.
    1. Förbereda en stamlösning av 2 mg/mL bovint serum albumin (BSA).
    2. Lägg till lämplig volym för att uppnå följande koncentrationer av BSA i 1 mL av Bradford reagens: 0 μg/mL, 0,5 μg/mL, 1 μg/mL, 2 μg/mL, 4 μg/mL, 6 μg/mL, 8 μg/mL och 10 μg/mL. Tillsätt 2 μL av den MNase-släppt kromatin-fraktionen till de ytterligare kyvetter.
    3. Täck toppen av varje kyvetten med en liten bit av parafilm och Invertera kyvetter 4 - 6 gånger att blanda lösningen väl. Inkubera i kyvetter i rumstemperatur i 15 min.
    4. Med en synlig ljus spektrofotometer, Mät absorbansen vid 595 nm för standardkurva och experimentella prover.
      Obs: Använd kyvetten utan BSA (0 μg/mL) till tomt spektrofotometern innan den första mätningen.
    5. Rita en standardkurva med absorbansvärdena för de olika koncentrationerna av BSA på programvara som är associerad med spektrofotometer eller kalkylprogram. Baserat på standardkurvan och utspädningsfaktorn används (1: 500), använda absorbansvärdena för att beräkna protein koncentrationen för varje kromatin bråkdel prov.
  2. För varje IP, lägga till 50 µg totalt protein från den MNase-släppt kromatin-fraktionen i ChIP lyseringsbuffert att nå en slutlig volym av 1 mL.
    Obs: Om du ställer in mer än en IP per lysate, gör en master mix av den lysate och ChIP lyseringsbuffert och delmängd 1 mL till enskilda rör för IP.
  3. Ta bort 100 µL från IP-mixen att bearbeta som ingång provet. Frysa in provet vid-20 ° C tills steg 7,1.
    Obs: Alla återstående kromatin prov kan också vara fryst vid-20 ° C och används för en efterföljande IP om så önskas.
  4. Tillsätt 20 µL av magnetiska Protein A/G pärlor pre bundna med antikropp till varje IP-provet.
Rotera provet vid 8 rpm för 3 h (standard) eller över natten (om så önskas) vid 4 ° C.

6. Tvätta IPs och eluera Histon-DNA komplex

  1. Placera rören i en magnetisk stå och låt pärlor samla på sidan av röret. Ta bort supernatanten med pipett. Tvätta pärlorna successivt med 1 mL av varje av buffertar nedan.
    1. Utför varje tvättningen av roterande vid 8 rpm för 5 min vid 4 ° C, placera pärlor i en magnetisk stå, ta bort supernatanten och lägga till nästa buffert: 2 x - ChIP lyseringsbuffert, 2 x - hög Salt tvättbuffert (50 mM Tris-HCl pH 7.5, 500 mM NaCl, 1 mM EDTA 1% NP-40, lagras vid 4 ° C), 1 x - LiCl/tvättmedel tvättbuffert (10 mM Tris-HCl pH 8,0, 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% natriumdeoxikolat, lagras vid 4 ° C), 1 x - TE (10 mM Tris-HCl pH 8,0, 1 mM EDTA, lagras vid 4 ° C), och 1 x - TE.
    2. Med senaste TE tvätt, överföra pärlor till en ny tub med 0,5 mL av TE för att överföra de flesta av pärlor, sedan ytterligare 0,5 mL TE att tvätta röret och överföra återstående pärlor.
  2. Tillsätt 250 µL av nygjorda ChIP eluering buffert (1% SDS, 1 mM NaHCO3). Vortex lösningen kort. Rotera proverna vid 8 rpm i 15 min i rumstemperatur.
  3. Placera röret i en magnetisk stå och samla pärlor. Försiktigt överför supernatanten till en ny tub och undvika pärlorna.
    Obs: Eluatet innehåller immunoprecipitated proteiner och associerade DNA.
  4. Lägga till en annan 250 µL av ChIP eluering buffert pärlor. Rotera proverna vid 8 rpm i 15 min i rumstemperatur.
  5. Försiktigt överför supernatanten till röret som innehåller den första elueringen. Om det behövs, ta en mindre volym (240 µL) för alla IP-adresser att undvika att störa pärlorna.

7. omvänd Protein-DNA antipyridinantikropp

  1. Tina de ingående proverna och tillsätt 400 µL av ChIP eluering buffert till varje ingång.
  2. Både indata och IP-prover, tillsätt 20 µL av 5 M NaCl, 5 µL 20 mg/mL glykogen och 12,5 µL 20 mg/ml proteinas K. Mix väl av Invertera eller snärta rör. Inkubera proverna i 65 ° C vattenbad över natten.

8. rena och koncentrera DNA

  1. Tillsätt 10 µL av 10mg/mL RNase A input samt IP-prover. Inkubera proverna i ett vattenbad på 37 ° C i 30 min.
  2. Lägga till 600 µL av fenol: chlorofrom:isoamyl alkohol (25:24:1 PCI) i vattenlösningen och blanda dem väl. Snurra dem vid 15.500 x g under 5 minuter i rumstemperatur.
    1. Ta bort vattenskiktet till en ny tub. Lägga till 600 µL av PCI och blanda dem väl. Snurra röret vid 15.500 x g under 5 minuter i rumstemperatur. Överföra vattenskiktet till en ny tub.
      FÖRSIKTIGHET: Arbeta i dragskåp och bära lämplig personlig skyddsutrustning vid arbete med PCI. Släng flytande och fast avfall som instrueras av institutionella riktlinjer.
  3. Tillsätt 0,1 x volym 3M natriumacetat och 1 mL kall 100% etanol utfällning DNA. Vänd röret 4 - 6 gånger att blanda lösningen väl. Inkubera vid-20 ° C över natten.
    1. Snurra röret på 15.500 x g i 20 min vid 4 ° C. Ta försiktigt bort supernatanten med en pipett.
    2. Tvätta pelleten i 1 mL kall 70% etanol. Spinna på 15.500 x g under 10 minuter vid 4 ° C. Ta försiktigt bort supernatanten med en pipett.
    3. Lufttorka pellets i huven för cirka 20 min (tills den är helt torr). Återsuspendera IP-prover i 50 µL nuclease-gratis vatten och återsuspendera input prover i 100 µL nuclease-gratis vatten. Lagra de DNA-proverna vid-20 ° C tills utför qPCR.

9. kvantitativ PCR (qPCR) att upptäcka berikad genomisk regioner

  1. Göra en qPCR master mix för varje uppsättning primers. En reaktion innehåller 5 µL av 2 x qPCR mix, 0,25 µL 20 µM framåt primer och 0,25 µL 20 µM reverse primer.
    Obs: Rätt primer design och testning för qPCR experiment är beskrivs någon annanstans14,15,16.
  2. Gör DNA master mixar för varje DNA-prov. En reaktion innehåller 0,5 µL av DNA och 4.0 µL nuclease-gratis vatten.
  3. Lägga till 5,5 µL av lämplig primer huvudmixen och 4,5 µL av lämpliga DNA huvudmixen till varje brunn på en 384-väl qPCR-tallrik.
    Obs: Börja med att lägga 5,5 µL av primer mixen till varje brunn. Snurra på plattan vid 200 x g för 1 min i rumstemperatur innan du lägger till 4,5 µL av den DNA-mix.
  4. Följa tätningen till plattan och spinn på 200 x g för 1 min i rumstemperatur.
  5. Utföra qPCR med ett realtids qPCR-system med följande villkor: 95 ° C i 3 min. 40 cykler av 95 ° C för 10 s, 55 ° C för 30 s; smältande kurva 65 ° C till 95 ° C med 0,5 ° C inkrement, 5 s.
  6. För varje tabellpar som primer, beräkna procent inmatning av IP-provet i förhållande till det 5% ingående prov som används i qPCR. Använda de tekniska PCR exemplar för att utföra beräkningarna.
    Obs: Om betydande variation observeras i de PCR-exemplar, är det bäst att upprepa qPCR med hänsyn till huvudmixen sammansättning, pipettering fel och korskontamination mellan brunnarna i plattan med 384 brunnar.
    1. Justera Cq värdena för input till 100% genom att subtrahera antalet cykler som representerar utspädningsfaktorn från raw Cq värdena.
      Notera: Fem procent input representerar en utspädningsfaktorn för 20-faldigt, vilket motsvarar 4,32 cykler (log2 20 = 4,32).
    2. Beräkna den procentuella ingång som 2 ^ (Cqingång - CqIP) multiplicerat med 100.

10. Bestäm MNase Digest förhållanden (rekommenderas före första Full chip Experiment)

  1. Följ steg 2.1 genom 4.4 i det föregående protokollet. Skala upp protokollet att generera tillräckligt lysate för flera prover av MNase nedbrytning av kromatin-innehållande pelleten. Vid steg 4,4, Återsuspendera pellets i 1,25 mL MNase matsmältningen buffert. Alikvot proverna till 5 rör så att varje innehåller 250 µL av kromatin pelleten resuspended i MNase matsmältningen buffert.
  2. Lägg till 0, 1,5, 2,5 eller 5 µL av MNase till varje rör. Blanda dem försiktigt genom att vända 4 - 6 gånger och omedelbart Inkubera rören i ett vattenbad på 37 ° C i 20 min.
  3. Stoppa reaktioner genom att omedelbart att placera rören på is och lägga 5 µL 0,5 M EDTA för en 10 mM slutlig koncentration.
Blanda lösningen försiktigt genom inversion.
  • Centrifugera rören vid 15.500 x g i 15 minuter vid 4 ° C och överför supernatanten till en ny 1,5 mL tub.
  • Lägga till SDS slutliga koncentration av 1% (25 µL av 10% stamlösning) och NaHCO3 till 0,1 M slutliga koncentration (25 µL av 1 M stamlösning) till proverna i 1,5 mL tuberna.
  • Tillsätt 20 µL av 5M NaCl, 5 µL av glykogen och 12,5 µL av 20mg/mL proteinas K i proverna i 1,5 mL tuberna. Inkubera dem vid 65 ° C över natten.
  • Tillsätt 10 µL av 10 mg/mL RNaseA. Inkubera vid 37 ° C i 30 min.
  • Tillsätt 300 µL PCI i vattenlösningen och blanda dem väl. Snurra på 15.500 x g under 5 minuter i rumstemperatur.
    1. Ta bort vattenskiktet till en ny tub. Tillsätt 300 µL av PCI och blanda väl. Snurra på 15.500 x g under 5 minuter i rumstemperatur. Överföra vattenskiktet till en ny tub.
  • Tillsätt 0,1 x volym 3 M natriumacetat (vanligtvis ~ 30 µL) och 1 mL kall 100% etanol utfällning DNA. Vänd röret 4 - 6 gånger att blanda väl. Inkubera röret vid-80 ° C 1 h eller -20 ° C över natten.
    1. Snurra röret på 15.500 x g i 20 min vid 4° C. Ta försiktigt bort supernatanten med en pipett.
    2. Tvätta pellets i 1 mL kall 70% etanol. Snurra på 15.500 x g under 10 minuter vid 4 ° C.
    3. Låt pellets lufttorka i huven ungefär 20 min (eller tills helt torr). Återsuspendera pellets i 30 µL nuclease-gratis vatten.
  • Lägg till DNA lastning färgämne och köra 20 µL på en 2% agaros gel att visualisera rötas DNA.
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    En viktig komponent i detta protokoll är att optimera koncentrationen av micrococcal nuclease (MNase) används för att smälta kromatinet i lösliga fragment, som beskrivs i steg 10. Detta är avgörande för att erhålla hög upplösning data angående distributionen av Histon ombyggnadsar genomisk regioner av intresse. En MNase titrering bör utföras för att bestämma den mest lämpliga koncentrationen att uppnå primärt mono-nucleosomes med en mindre mängd di-nucleosomes i lösliga kromatin fraktionen. Detta kan visualiseras genom att extrahera DNA efter MNase rötning av kromatin-innehållande pelleten och utför agaros gel elektrofores (figur 2). I beredningen av MNase används här, 2,5 µL av enzym på 20 enheter/µL produceras huvudsakligen mono-nucleosomes, och därför detta belopp användes för chIP.

    Två uppsättningar av representativa resultat visas för proceduren chIP (figur 3). I det första exemplet utvärderas en Histon metyl mark i antingen vildtyp celler eller celler som saknar den methyltransferase katalyserar detta märke. Specifikt, utfördes chIP med en antikropp mot H3K4me2 samt Histon H3 som kontroll, i vildtyp och set1Δ celler. H3K4me2 primärt lokaliserar precis nedströms av transkriptionen startar platsen i 5' slutet av kodande regioner och, i avsaknad av Set1, H3K4me2 kan inte upptäckas i celler17,18,19. Set1Δ stammen fungerar därför som en kontroll att indikera mängden bakgrund signal som kan tillskrivas icke-specifik bindning av andra Histon märken eller DNA till antikroppen. I det här fallet vildtyp stammen visade tydlig anrikning för H3K4me2 i 5' slutet av två gener kända för att vara direkt mål Set1, PMA1 och ERG1120,21, medan ingen signal observerades hos set1Δ celler (figur 3A). Som väntat, finns det ingen berikning av telomeren (TEL) 07 LH3K4me2 varumärket. Uttrycket av genen mellersta sporulering SPR3 har också rapporterats regleras genom Set122,23, however anrikningen av H3K4me2 slutet 5' av den SPR3 ORF är mest liknar de nivåer som observerats på TEL07L, jämfört med antingen PMA1 eller ERG11. Utvärdera localizationen av metyl märket anger att Set1-medierad reglering av SPR3 kan uppstå genom en annan mekanism än på PMA1 eller ERG11, som tidigare observerade22.

    I det andra exemplet visas chIP av acetylerade H4K16 i förhållande till Histon H4 i vildtyp celler och celler som saknar den Histon histondeacetylas Sir2, som tar bort H4K16ac märken. H4K16ac är slut i heterochromatic-liknande kromatinet nära telomeren och berikad i euchromatin mer distala från telomeren24,25, som visats för TEL07L och TEL15L (figur 3b). Dessutom förlusten av Sir2 orsakar en ökning i H4K16ac på särskilda telomeric och subtelomeric regioner, även om ingen förändring observeras vid kontroll genen PMA1, där Sir2 inte är känt att lokalisera. Medan dessa data visar en tydlig ökning i H4K16ac nivåer i sir2Δ celler, kan upptäcks ändringen i H4K16ac, som inte förväntas vara lika betydande som förändringen i H3K4me2 av vildtyp kontra set1Δ celler, skymmas om chIP parametrar är inte ordentligt optimerad. Rekommendationer för optimering beskrivs i diskussionen.

    Figure 1
    Figur 1: Tidslinje chIP förfarandets. Typiska schemat för protokollet chIP visas. Möjliga variationer anges i texten. Klicka här för att se en större version av denna siffra.

    Figure 2
    Figur 2: Test MNase matsmältning för lösbarhet av mono-nucleosomes. Agaros gelelektrofores av DNA isolerade efter rötning av kromatin pelleten med varierande mängder av MNase (20 enheter/µL). DNA från mononucleosomes migrerar på ca 150 bp, från dinucleosomes på cirka 300 bp och DNA från polynucleosomes finns på allt högre molekylvikt. Klicka här för att se en större version av denna siffra.

    Figure 3
    Figur 3 : Marker för H3K4me2 och H4K16ac i vildtyp och muterade jäststammar. (A) ChIP med antikroppar mot H3K4me2 och H3 utfördes i vildtyp och set1Δ celler. Procent input beräknades för varje tabellpar som primer för både H3K4me2 och H3 IPs och förhållandet är ett diagram för att indikera den relativa anrikningen av H3K4me2 på de angivna lokus. Primers för PMA1, ERG11 och SPR3 generera amplikoner slutet 5' av varje ORF, medan paret TEL07L primer angränsar till telomeren på vänstra armen av kromosom 7. Medelvärdet av tre biologiska replikat visas och felstaplar representera standardavvikelsen för medelvärdet. (B) ChIP utfördes med antikroppar som känner igen H4K16ac och H4 i vildtyp och sir2Δ celler och ritade som beskrivs för figur 3A. Primer par förstärker sekvenser intill telomerer (TEL07L och TEL15L) och nedströms inom tidigare definierade euchromatic regioner av varje subtelomere (21 kb och 5 kb distala från telomeren, respektive).Klicka här för att visa en större version av denna siffra.

    Stam-nummer Genotyp Referens
    yEG230 MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 23
    yEG223 MATα sir2Δ::NATMX Denna studie
    yEG232 MATa set1Δ::KANMX 23

    Tabell 1: Jäststammar används i denna studie.

    Oligo-nummer Läge Sekvens
    oEG141 TELVIIL F AGCCCGAGCCTGTACTAAAT
    oEG142 TELVIIL R CAAAAGAAACTTTTCATGGCA
    oEG153 5' PMA1 F TCAGCTCATCAGCCAACTCAAG
    oEG154 5' PMA1 R CGTCGACACCGTGATTAGATTG
    oEG220 TELVIIL + 21KB F AAACAATGGGACCCTTCTGA
    oEG221 TELVIIL + 21KB R AACACCTTGCAAAACACAGG
    oEG280 TELXVL F ATCCTGCAATTGGGCCACTAT
    oEG281 TELXVL R AGCGGAAGGCATATTAACGT
    oEG282 TELXVL + 5KB F AGGCGATGTAATCTCACCAA
    oEG283 TELXVL + 5KB R CATTCACACATCCTGCTACCA
    oEG568 ERG11 F CCTCTTATTCCGTCGGTGAA
    oEG569 ERG11 R TGTGTCTACCACCACCGAAA
    oEG963 SPR3 F TCTGGATTCGCTGAGGAAGT
    oEG964 SPR3 R TTTCAGTTCAGGGCTTTTCG

    Tabell 2: Primers används i denna studie.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Proceduren som beskrivs här möjliggör effektiv återvinning av DNA som är associerad med modifierade histoner i jästceller av immunoprecipitation. Detta följs av qPCR med primers som förstärker regioner av intresse att bestämma lokala anrikning eller utarmning av specifika Histon ändringar. Trots att utvecklas som en metod för nästan 20 år sedan, fortfarande chIP definierande analysen för att utreda Histon ändring status på olika genomisk regioner och under olika förhållanden. Även om chIP kopplat till nästa generations sekvensering teknik kan förhöra Histon modifieringar på en genome-wide skala6,7, kan kostnader och nödvändiga dataanalys av dessa synsätt begränsa deras användning i vissa lab inställningar. Dessutom följs dessa epigenetisk experiment ofta av chIP kopplat till qPCR att validera observationer av Histon ändring status vid vissa genetiska loci. Finns det några jämförbara metoder som ger nyttan av chIP i fysiskt länka en Histon mark (eller andra protein) till en viss plats i genomet och analysera dynamiken i denna interaktion under olika miljömässiga och biologiska förhållanden . Även om det har varit senaste framgång isolera kromatin från definierade genomisk regioner och att identifiera de lokala Histon märken med masspektrometri8,9,10,11, dessa metoder utgör tekniska utmaningar och deras nytta över olika lab typer kan begränsas av tillräcklig tillgång till masspektrometri instrumentering och data analysresurser. Protokollet beskrivs här är tekniskt och ekonomiskt tillgängligt för olika lab inställningar, med det primära möjliga hindret att tillgång till en qPCR-maskin. ChIP är fortfarande den guld-standarden för att definiera genomisk lokalisering av modifierade histoner i jäst och andra system.

    Detta är en mångsidig protokoll med ett antal steg som kan optimeras för att passa olika experimentella villkor, inklusive samtidigt testa flera mutanter eller miljöförhållanden. Alternativt, tillräcklig kromatin genereras vanligtvis från en lysate att utföra flera IP-adresser med upp till minst fyra olika antikroppar. Detta protokoll kan också användas för chIP av icke-histonglykoprotein kromatin proteiner som är epitop-etiketten eller för vilka antikroppar har genererats. Om detta protokoll är anpassas för chIP av icke-histonglykoprotein proteiner, parametrar inklusive fixering tid, kromatin koncentration under Undersökningsperioden och antikroppskoncentrationen är ofta avgörande för att erhålla anrikning av proteinet riktade över bakgrund. Vanligast, är det användbart att öka tiden för fixering med formaldehyd till mellan 45 och 60 min och för att öka mängden av kromatin används under Undersökningsperioden (upp till 200 µg totalt protein).

    Det finns ett antal potentiella variabler som bidrar till kvaliteten och reproducerbarhet av Histon ändring chIP experiment. Även om en suboptimal experiment kan ofta ge positiva resultat när man jämför skarp skillnader (exempelvis nivåerna av H3K4me2 i vildtyp eller set1Δ celler, som visas i figur 3A), mer subtila skillnader sannolikt kommer att maskeras i en felaktigt utförda experiment (till exempel de olika nivåerna av H4K16ac på TEL07L i vildtyp eller sir2Δ celler, som visas i figur 3B). Experimentella parametrar att överväga inkluderar mängden jästceller används, fixering tid, koncentrationen av kromatin allmänna bråk som används under Undersökningsperioden, fragment storlek de smält DNA-proteinkomplex och antikropp kvalitet och koncentration. En begränsning med denna metod är att optimering av experimentella parametrar krävs generellt för varje Histon modifiering testas och muterade stammar eller villkor under utredning. Det kan finnas små skillnader i Histon mark nivåer eller localization under olika förhållanden, och förmågan att upptäcka dessa skillnader är beroende av de parametrar som beskrivs ovan. Vi diskutera några av de viktiga övervägandena för att utveckla de mest känsliga experimentella metoderna nedan.

    Som beskrivs i protokollet, är det rekommenderat att testa flera koncentrationer av MNase att bestämma den optimala koncentrationen innan du utför en fullständig chIP experiment. Att säkerställa att DNA inom IP är tillräckligt fragmenterad är nyckeln till att få högupplösta chIP resultat. Även om kopiestorlek qPCR produkter kan vara liten (mindre än 100 bp), om fragment av DNA är väsentligen större, qPCR tyda falskeligen berikning på en specifik locus när, i verkligheten, Histon märket kan vara lokaliserade hundratals basepairs bort. Medan detta protokoll förlitar sig på MNase till solubilize kromatinet i mono - och di-nucleosomes, använda andra chIP protokoll också brukar ultraljudsbehandling för att skeva kromatin6,7. Ultraljudsbehandling är också en pålitlig metod för solubilizing kromatin fragment, trots skjuvning storlekarna tenderar att vara mindre enhetlig och det kan vara svårare att uppnå konsekventa resultat mellan experiment. Även om ultraljudsbehandling kan vara att föredra för vissa icke-histonglykoprotein proteiner-chIP, kan användningen av MNase att smälta kromatin i primärt mono-nucleosomes förbättra upplösning av Histon ändring chIP experiment.

    Ett krav för en framgångsrik chIP experiment är en antikropp som unikt och med hög affinitet erkänner Histon ändring av intresse. Den primära begränsningen av chIP som en metod för Histon ändring upptäckt är beroendet av en hög kvalitet, validerade antikropp; utan sådan reagens är resultat från chIP inte sannolikt att vara biologiskt relevanta. Det finns ett antal kommersiellt tillgängliga antikroppar mot Histon ändringar i spirande jäst, även om kvalitet och giltighet av antikroppar är variabel. Ansträngningar för att validera dessa antikroppar har producerat användbara resurser för att fastställa bästa tillgängliga antikroppen för en given experiment26. Det rekommenderas att antikroppar används för chIP valideras med en mångfald av metoder för deras specificitet, inklusive genom sondering matriser av modifierade och oförändrad Histon peptider, utföra western blotting av hela cellen extrakt och renat histoner, och i chIP experiment med ordentliga kontroller, såsom stammar med en modifiera enzymet bort eller bär punktmutationer i modifierad Histon återstoden. För nya antikroppar som känner igen uncharacterized märken eller lab-genererade antikroppar, är dessa specificitet experiment avgörande för att fastställa huruvida antikroppen kan vara en giltig reagens för chIP.Förutom verifierar antikroppens specificitet, är utför en titrering av antikroppar för Undersökningsperioden från en vildtyp stam och en negativ kontroll stam ofta användbart för att bestämma mängden antikroppar krävs (i förhållande till en uppsättning kromatin koncentration) till upptäcka exakt skillnader i anrikning mellan stammar eller regioner i genomet. Dessutom om vissa uppgifter om genomisk spridningsmönster av märket är kända, positiv och negativ bör kontroll primer uppsättningar ingå i alla qPCR experiment att validera alla individuella experiment och förenkla jämförelser mellan experiment.

    Sammantaget beskriver detta arbete en grundläggande metod för forskares förhör Histon ändring status på någon genomisk region i spirande jäst. Mångsidigheten i detta protokoll och dess tillämplighet på olika experimentella frågor gör det ett mycket användbart verktyg för dissekera kromatin dynamics på molekylär nivå.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Författarna har något att avslöja.

    Acknowledgments

    Författarna vill tacka medlemmarna i gröna lab för bra diskussioner. Detta arbete stöds delvis av NIH grants R03AG052018 och R01GM124342 till E.M.G.

    Materials

    Name Company Catalog Number Comments
    Yeast Extract Research Products International (RPI) Y20025-1000.0
    Peptone Research Products International (RPI) P20250-1000.0
    Dextrose ThermoScientific BP350-1
    Formaldehyde Sigma-Aldrich F8775
    Glycine Fisher Scientific AC12007-0050
    Tris Amresco 0497-5KG
    EDTA Sigma-Aldrich E6758-500G
    NaCl ThermoScientific BP358-10
    4-Nonylphenyl-polyethylene glycol Sigma-Aldrich 74385 Equivalent to NP-40
    MgCl ThermoScientific S25533
    CaCl2 Sigma-Aldrich 20899-25G-F
    LiCl ThermoScientific AC413271000
    Sodium Dodecyl Sulfate Amresco M107-1KG
    Sodium Deoxycholate Sigma-Aldrich 30970-100G
    Sodium Acetate Sigma-Aldrich S2889
    NaHCO3 ThermoScientific S25533
    PMSF Sigma-Aldrich P7626-5G
    Yeast protease inhibitor cocktail VWR 10190-076
    25 Phenol:24 Chloroform:1 Isoamyl Alcohol VWR Life Science 97064-824
    Ethanol Sigma-Aldrich E7023
    Nuclease-Free Water VWR 100720-992
    Micrococcal Nuclease Worthington Biochemical LS004797
    Glycogen ThermoScientific R0561
    Proteinase K Research Products International (RPI) P50220-0.1
    RNase A  Sigma-Aldrich R6513-50MG
     Bradford Assay Reagent ThermoScientific 23238
     BSA Standard 2 mg/mL ThermoScientific 23210
    α H4 EMD Millipore 04-858
    α H4K16ac EMD Millipore ABE532
    α H3 Abcam ab1791
    α H3K4me2 Active Motif 39142
     High Rox qPCR Mix Accuris qMax Green, Low Rox qPCR Mix ACC-PR2000-L-1000
    Protein A/G Magnetic Beads ThermoScientific 88803
    magnetic stand for 1.5mL tubes Fisher Scientific PI-21359
    Acid-Washed Glass Beads Sigma-Aldrich G8772
     Microtube Homogenizer Benchmark D1030
    2.0 mL screw-cap tubes with sealing rings Sigma-Aldrich Z763837-1000EA
    Gel loading tips Fisher Scientific 07-200-288
    Cuvettes Fisher Scientific 50-476-476
    Parafilm Fisher Scientific 13-374-10
    50 mL conical tubes Fisher Scientific 14-432-22
    384-Well PCR Plate Fisher Scientific AB-1384W
     Gyratory Floor Shaker New Brunswick Scientific Model G10
    Spectrophotometer ThermoScientific ND-2000c
     Real-Time PCR Detection System Bio-Rad 1855485

    DOWNLOAD MATERIALS LIST

    References

    1. Jaiswal, D., Turniansky, R., Green, E. M. Choose Your Own Adventure: The Role of Histone Modifications in Yeast Cell Fate. J Mol Biol. 429, (13), 1946-1957 (2017).
    2. Suganuma, T., Workman, J. L. Signals and combinatorial functions of histone modifications. Annu Rev Biochem. 80, 473-499 (2011).
    3. Solomon, M. J., Varshavsky, A. Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures. P Natl Acad Sci USA. 82, (19), 6470-6474 (1985).
    4. Solomon, M. J., Larsen, P. L., Varshavsky, A. Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell. 53, (6), 937-947 (1988).
    5. Gilmour, D. S., Lis, J. T. Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes. P Natl Acad Sci USA. 81, (14), 4275-4279 (1984).
    6. Lefrançois, P., et al. Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics. 10, 37 (2009).
    7. Furey, T. S. ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet. 13, (12), 840-852 (2012).
    8. Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic Loci. Cell. 136, (1), 175-186 (2009).
    9. Byrum, S. D., Raman, A., Taverna, S. D., Tackett, A. J. ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep. 2, (1), 198-205 (2012).
    10. Soldi, M., Bremang, M., Bonaldi, T. Biochemical systems approaches for the analysis of histone modification readout. Biochim Biophys Acta. 1839, (8), 657-668 (2014).
    11. Soldi, M., Bonaldi, T. The ChroP approach combines ChIP and mass spectrometry to dissect locus-specific proteomic landscapes of chromatin. J Vis Exp. (86), (2014).
    12. Kuo, M. H., Allis, C. D. In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment. Methods. 19, (3), 425-433 (1999).
    13. Meluh, P. B., Broach, J. R. Immunological analysis of yeast chromatin. Methods Enzymol. 304, 414-430 (1999).
    14. Rozen, S., Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132, 365-386 (2000).
    15. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods. 50, (4), S1-S5 (2010).
    16. Rodríguez, A., Rodríguez, M., Córdoba, J. J., Andrade, M. J. Design of primers and probes for quantitative real-time PCR methods. Methods Mol Biol. 1275, 31-56 (2015).
    17. Briggs, S. D., et al. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Gene Dev. 15, (24), 3286-3295 (2001).
    18. Bernstein, B. E., et al. Methylation of histone H3 Lys 4 in coding regions of active genes. P Natl Acad Sci USA. 99, (13), 8695-8700 (2002).
    19. Pokholok, D. K., et al. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122, (4), 517-527 (2005).
    20. Krogan, N. J., et al. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell. 11, (3), 721-729 (2003).
    21. South, P. F., Harmeyer, K. M., Serratore, N. D., Briggs, S. D. H3K4 methyltransferase Set1 is involved in maintenance of ergosterol homeostasis and resistance to Brefeldin A. P Natl Acad Sci USA. 110, (11), E1016-E1025 (2013).
    22. Margaritis, T., et al. Two distinct repressive mechanisms for histone 3 lysine 4 methylation through promoting 3'-end antisense transcription. PLoS Genet. 8, (9), e1002952 (2012).
    23. Jezek, M., et al. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance. Epigenetics. 12, (2), 93-104 (2017).
    24. Suka, N., Luo, K., Grunstein, M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nat Genet. 32, (3), 378-383 (2002).
    25. Kimura, A., Umehara, T., Horikoshi, M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 32, (3), 370-377 (2002).
    26. Rothbart, S. B., et al. An Interactive Database for the Assessment of Histone Antibody Specificity. Mol Cell. 59, (3), 502-511 (2015).
    Kromatin Immunoprecipitation (ChIP) Histon ändringar från <em>Saccharomyces cerevisiae</em>
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).More

    Jezek, M., Jacques, A., Jaiswal, D., Green, E. M. Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae. J. Vis. Exp. (130), e57080, doi:10.3791/57080 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    Simple Hit Counter