Here, we describe a protocol for chromatin immunoprecipitation of modified histones from the budding yeast Saccharomyces cerevisiae. Immunoprecipitated DNA is subsequently used for quantitative PCR to interrogate the abundance and localization of histone post-translational modifications throughout the genome.
Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes that add or remove these marks in response to signals received by the cell. These PTMS are key contributors to the regulation of processes such as gene expression control and DNA repair. Chromatin immunoprecipitation (chIP) has been an instrumental approach for dissecting the abundance and localization of many histone PTMs throughout the genome in response to diverse perturbations to the cell. Here, a versatile method for performing chIP of post-translationally modified histones from the budding yeast Saccharomyces cerevisiae (S. cerevisiae) is described. This method relies on crosslinking of proteins and DNA using formaldehyde treatment of yeast cultures, generation of yeast lysates by bead beating, solubilization of chromatin fragments by micrococcal nuclease, and immunoprecipitation of histone-DNA complexes. DNA associated with the histone mark of interest is purified and subjected to quantitative PCR analysis to evaluate its enrichment at multiple loci throughout the genome. Representative experiments probing the localization of the histone marks H3K4me2 and H4K16ac in wildtype and mutant yeast are discussed to demonstrate data analysis and interpretation. This method is suitable for a variety of histone PTMs and can be performed with different mutant strains or in the presence of diverse environmental stresses, making it an excellent tool for investigating changes in chromatin dynamics under different conditions.
The dynamic post-translational modification (PTM) of histones is a key regulatory mechanism for many DNA-templated processes, including transcription, replication and DNA repair1,2. The ability to determine the abundance and precise localization of modified histones concomitant with these processes is therefore critical to understanding their regulation under different conditions in the cell. The development of chromatin immunoprecipitation (chIP) as a method largely stemmed from biochemical studies of the interactions of proteins with DNA, particularly in vitro methods using chemical crosslinkers, coupled with the need to evaluate the dynamic nature of protein-DNA interactions in vivo and at specific regions of the genome3,4,5. The advancement of quantitative PCR (qPCR) and sequencing technologies has also expanded the ability to perform chIP experiments with quantitative comparisons and across whole genomes, making it a powerful tool for dissecting DNA-protein interactions at multiple levels.
Currently, chIP is a required method for any research group interested in chromatin-mediated regulation of the genome as there are no comparable methods for directly interrogating the physical link between a modified histone and a specific genomic locus in vivo. Although variations of this method using next generation sequencing to map histone modifications throughout the genome6,7 are available, these approaches may address different scientific questions and their scale, cost and technical resources may be limiting for some research groups. Additionally, targeted chIP-qPCR is necessary to complement these approaches by providing methods to both optimize the chIP protocol prior to sequencing and to validate results from the epigenomic datasets. Mass spectrometry based approaches for identifying the full complement of histone marks associated with genomic regions have also emerged8,9,10,11, however, these approaches have some limitations regarding which regions of the genome can be probed and they require technical expertise and instrumentation that will not be available to all research groups. Therefore, chIP remains a foundational method for analyzing the abundance and distribution of histone modifications under diverse conditions for all research groups interested in epigenetics, chromatin and the regulation of genomic functions.
Here, we describe a method for chIP using the budding yeast model Saccharomyces cerevisiae (S. cerevisiae) to investigate the distribution of histone PTMs at chromatin. This approach relies on a number of core components of chIP protocols developed in yeast and also applied to diverse model systems12,13. Interactions between modified histones and DNA in the cell are preserved by crosslinking with formaldehyde. Following lysate preparation, chromatin fragments are solubilized into uniformly-sized fragments by digestion with micrococcal nuclease. Immunoprecipitation of the modified histones is performed with either commercial or lab-generated antibodies and any associated DNA is isolated and analyzed for enrichment at particular genomic regions using qPCR (Figure 1). For many histone modifications, the quantity of DNA obtained from this protocol is sufficient for testing more than 25 different genomic loci by qPCR.
This chIP method is highly versatile for monitoring the distribution of a single histone modification across multiple mutant strains or environmental conditions, or for testing multiple histone modifications in wildtype cells at a number of genomic loci. Furthermore, numerous components of the protocol are easily adjustable to optimize detection of either highly- or lowly-abundant histone marks. Finally, performing chIP of modified histones in budding yeast provides the opportunity to use key controls for antibody specificity that are largely unavailable in other systems. Namely, yeast strains can be generated that carry point mutations in histone residues that are targeted for modification, and, in some cases, there is only a single enzyme that catalyzes modification on a particular histone residue (e.g. histone lysine methyltransferases). Therefore, chIP can be performed in either the histone mutant or enzyme deletion strains to assay the extent to which non-specific binding of the antibody may be occurring and generating false positive results. This control is particularly valuable for newly-developed antibodies, and may even be used to validate antibody specificity for conserved histone modifications prior to their use in other systems. This approach complements other methods to test antibody specificity that distinguish among different modification states (such as mono-, di- and tri-methylation), including probing arrays of modified peptides and performing western blots of histones or nucleosomes with defined modifications. Overall, chIP in budding yeast is a powerful method for assessing the dynamics of histone PTMs throughout the genome and dissecting the mechanisms governing their regulation.
1. Pre-bind Antibody to Magnetic Beads
2. Grow Yeast Cells
3. In Vivo Crosslinking of Proteins to DNA
4. Make Yeast Lysates
5. Immunoprecipitate (IP) Modified Histones
6. Wash IPs and Elute Histone-DNA Complexes
7. Reverse Protein-DNA Crosslinks
8. Purify and Concentrate DNA
9. Quantitative PCR (qPCR) to Detect Enriched Genomic Regions
10. Determine MNase Digest Conditions (Recommended Prior to First Full chIP Experiment)
One key component of this protocol is optimizing the concentration of micrococcal nuclease (MNase) used to digest the chromatin into soluble fragments, as outlined in Step 10. This is critical for obtaining high resolution data regarding the distribution of histone modifications at genomic regions of interest. An MNase titration should be performed to determine the most suitable concentration to achieve primarily mono-nucleosomes with a smaller amount of di-nucleosomes in the soluble chromatin fraction. This can be visualized by extracting the DNA following MNase digestion of the chromatin-containing pellet and performing agarose gel electrophoresis (Figure 2). In the preparation of MNase used here, 2.5 µL of enzyme at 20 units/µL produced predominantly mono-nucleosomes, and therefore this amount was used for the chIP.
Two sets of representative results are shown for this chIP procedure (Figure 3). In the first example, a histone methyl mark is evaluated in either wildtype cells or cells lacking the methyltransferase which catalyzes this mark. Specifically, chIP was performed with an antibody against H3K4me2, as well as against histone H3 as a control, in wildtype and set1Δ cells. H3K4me2 primarily localizes just downstream of the transcription start site at the 5' end of coding regions and, in the absence of Set1, H3K4me2 cannot be detected in cells17,18,19. The set1Δ strain therefore serves as a control to indicate the amount of background signal that may be attributed to non-specific binding of other histone marks or DNA to the antibody. In this case, the wildtype strain showed clear enrichment for H3K4me2 at the 5' end of two genes known to be direct targets of Set1, PMA1 and ERG1120,21, whereas no signal was observed in set1Δ cells (Figure 3A). As expected, there is no enrichment of the H3K4me2 mark at telomere (TEL) 07L. The expression of the middle sporulation gene SPR3 has also been reported to be regulated by Set122,23, however the enrichment of H3K4me2 at the 5' end of the SPR3 ORF is most similar to the levels observed at TEL07L, as compared to either PMA1 or ERG11. Evaluating the localization of this methyl mark indicates that Set1-mediated regulation of SPR3 is likely to occur by a different mechanism than at PMA1 or ERG11, as previously observed22.
In the second example, chIP of acetylated H4K16 is shown relative to histone H4 in wildtype cells and cells lacking the histone deacetylase Sir2, which removes H4K16ac marks. H4K16ac is depleted in the heterochromatic-like chromatin close to the telomere, and enriched in euchromatin more distal from the telomere24,25, as demonstrated for TEL07L and TEL15L (Figure 3B). Additionally, the loss of Sir2 causes an increase in H4K16ac at specific telomeric and subtelomeric regions, although no change is observed at the control gene PMA1, where Sir2 is not known to localize. While these data show a clear increase in H4K16ac levels in sir2Δ cells, the detected change in H4K16ac, which is not expected to be as substantial as the change in H3K4me2 in wildtype versus set1Δ cells, may be obscured if chIP parameters are not properly optimized. Recommendations for optimization are described in the Discussion.
Figure 1: Timeline of chIP procedure. The typical schedule for the chIP protocol is shown. Possible variations are indicated in the text. Please click here to view a larger version of this figure.
Figure 2: Test MNase digestion for solubilization of mono-nucleosomes. Agarose gel electrophoresis of DNA isolated following digestion of the chromatin pellet with varying amounts of MNase (20 units/µL). DNA from mononucleosomes migrates at approximately 150 bp, from dinucleosomes at approximately 300 bp and DNA from polynucleosomes is found at increasingly higher molecular weights. Please click here to view a larger version of this figure.
Figure 3: ChIPs of H3K4me2 and H4K16ac in wildtype and mutant yeast strains. (A) ChIP using antibodies against H3K4me2 and H3 was performed in wildtype and set1Δ cells. Percent input was calculated for each primer pair for both the H3K4me2 and H3 IPs and the ratio is graphed to indicate the relative enrichment of H3K4me2 at the indicated loci. The primers for PMA1, ERG11 and SPR3 generate amplicons at the 5' end of each ORF, whereas the TEL07L primer pair is adjacent to the telomere on the left arm of Chromosome 7. The mean of three biological replicates is shown and the error bars represent standard error of the mean. (B) ChIP was performed with antibodies recognizing H4K16ac and H4 in wildtype and sir2Δ cells and plotted as described for Figure 3A. Primer pairs amplify sequences adjacent to telomeres (TEL07L and TEL15L) and downstream within previously defined euchromatic regions of each subtelomere (at 21 kb and 5 kb distal from the telomere, respectively). Please click here to view a larger version of this figure.
Strain Number | Genotype | Reference |
yEG230 | MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | 23 |
yEG223 | MATα sir2Δ::NATMX | This study |
yEG232 | MATa set1Δ::KANMX | 23 |
Table 1: Yeast strains used in this study.
Oligo Number | Location | Sequence |
oEG141 | TELVIIL F | AGCCCGAGCCTGTACTAAAT |
oEG142 | TELVIIL R | CAAAAGAAACTTTTCATGGCA |
oEG153 | 5'PMA1 F | TCAGCTCATCAGCCAACTCAAG |
oEG154 | 5'PMA1 R | CGTCGACACCGTGATTAGATTG |
oEG220 | TELVIIL + 21KB F | AAACAATGGGACCCTTCTGA |
oEG221 | TELVIIL + 21KB R | AACACCTTGCAAAACACAGG |
oEG280 | TELXVL F | ATCCTGCAATTGGGCCACTAT |
oEG281 | TELXVL R | AGCGGAAGGCATATTAACGT |
oEG282 | TELXVL + 5KB F | AGGCGATGTAATCTCACCAA |
oEG283 | TELXVL + 5KB R | CATTCACACATCCTGCTACCA |
oEG568 | ERG11 F | CCTCTTATTCCGTCGGTGAA |
oEG569 | ERG11 R | TGTGTCTACCACCACCGAAA |
oEG963 | SPR3 F | TCTGGATTCGCTGAGGAAGT |
oEG964 | SPR3 R | TTTCAGTTCAGGGCTTTTCG |
Table 2: Primers used in this study.
The procedure described here allows for the efficient recovery of DNA associated with modified histones in yeast cells by immunoprecipitation. This is followed by qPCR using primers which amplify regions of interest to determine local enrichment or depletion of specific histone modifications. Despite being developed as a method almost 20 years ago, chIP remains the defining assay for investigating histone modification status at different genomic regions and under diverse conditions. Although chIP coupled to next generation sequencing technologies can interrogate histone modifications on a genome-wide scale6,7, the costs and required data analysis of these approaches may limit their use in some lab settings. Furthermore, these epigenomic experiments are often followed by chIP coupled to qPCR to validate observations of histone modification status at some genomic loci. There are few comparable methods that provide the utility of chIP in physically linking a histone mark (or other protein) to a specific location within the genome and analyzing the dynamics of this interaction under different environmental or biological conditions. Although there has been recent success in isolating chromatin from defined genomic regions and identifying the local histone marks using mass spectrometry8,9,10,11, these methods pose technical challenges and their utility across diverse lab types may be limited by adequate access to mass spectrometry instrumentation and data analysis resources. The protocol described here is technically and economically accessible to diverse lab settings, with the primary possible hurdle being access to a qPCR machine. ChIP remains the gold-standard for defining genomic localization of modified histones in yeast and other systems.
This is a versatile protocol with a number of steps that can be optimized to suit different experimental conditions, including simultaneously testing multiple mutants or environmental conditions. Alternatively, sufficient chromatin is usually generated from one lysate to perform multiple IPs with up to at least four different antibodies. This protocol can also be used for chIP of non-histone chromatin proteins that are epitope-tagged, or for which antibodies have been generated. If this protocol is to be adapted for chIP of non-histone proteins, parameters including fixation time, chromatin concentration in the IP and antibody concentration are often critical to obtaining enrichment of the targeted protein over background. Most commonly, it is useful to increase the fixation time with formaldehyde to between 45 and 60 min and to increase the amount of chromatin used in the IP (up to 200 µg of total protein).
There are a number of potential variables that contribute to the quality and reproducibility of histone modification chIP experiments. Although a sub-optimal experiment may often yield positive results when comparing stark differences (for example, the levels of H3K4me2 in wildtype or set1Δ cells, as shown in Figure 3A), more subtle differences are likely to be masked in an improperly performed experiment (such as the differing levels of H4K16ac at TEL07L in wildtype or sir2Δ cells, as shown in Figure 3B). Experimental parameters to consider include the quantity of yeast cells used, fixation time, concentration of the chromatin fraction used in the IP, fragment size of the digested DNA-protein complexes and the antibody quality and concentration. One limitation of this approach is that optimization of experimental parameters is generally required for each histone modification being tested and the mutant strains and/or conditions under investigation. There may be subtle differences in histone mark levels or localization under different conditions, and the ability to detect these differences is dependent on the parameters described above. We discuss some of the key considerations for developing the most sensitive experimental approaches below.
As described in the protocol, it is recommended to test multiple concentrations of MNase to determine the optimal concentration prior to performing a full chIP experiment. Ensuring that the DNA within the IP is adequately fragmented is key to obtaining high resolution chIP results. Even though the amplicon size of the qPCR products may be small (generally less than 100 bp), if the fragment size of the DNA is substantially larger, the qPCR may falsely indicate enrichment at a specific locus when, in actuality, the histone mark may be localized hundreds of basepairs away. While this protocol relies on MNase to solubilize the chromatin into mono- and di-nucleosomes, other chIP protocols also commonly use sonication to shear chromatin6,7. Sonication is also a reliable method for solubilizing chromatin fragments, although the shear sizes tend to be less uniform and it can be more difficult to achieve consistent results between experiments. Although sonication may be preferable for chIP of some non-histone proteins, the use of MNase to digest chromatin into primarily mono-nucleosomes can improve the resolution of histone modification chIP experiments.
One requirement for a successful chIP experiment is an antibody that uniquely and with high affinity recognizes the histone modification of interest. The primary limitation of chIP as a method for histone modification detection is its reliance on a high-quality, validated antibody; without such a reagent, results obtained from chIP are not likely to be biologically-relevant. There are a number of commercially-available antibodies against histone modifications found in budding yeast, although the quality and validity of the antibodies is variable. Efforts to validate these antibodies have produced useful resources for determining the best available antibody for a given experiment26. It is recommended that antibodies used for chIP are validated with a diversity of methods for their specificity, including by probing arrays of modified and unmodified histone peptides, performing western blots of whole cell extracts and purified histones, and in chIP experiments with proper controls, such as strains with a modifying enzyme deleted or carrying point mutations in the modified histone residue. For new antibodies that recognize uncharacterized marks or lab-generated antibodies, these specificity experiments are critical to determining whether the antibody may be a valid reagent for chIP. In addition to validating the specificity of the antibody, performing an antibody titration for the IP from a wildtype strain and a negative control strain is often useful for determining the amount of antibody required (relative to a set chromatin concentration) to detect accurate differences in enrichment between strains or regions of the genome. Furthermore, if some data regarding genomic distribution patterns of the mark are known, positive and negative control primer sets should be included in all qPCR experiments to validate any individual experiment and to simplify comparisons between experiments.
Overall, this work describes a foundational method for researchers interested in interrogating histone modification status at any genomic region in budding yeast. The versatility of this protocol and its applicability to diverse experimental questions makes it an extremely useful tool for dissecting chromatin dynamics at the molecular level.
The authors have nothing to disclose.
The authors would like to thank members of the Green lab for helpful discussions. This work was supported in part by NIH grants R03AG052018 and R01GM124342 to E.M.G.
Yeast Extract | Research Products International (RPI) | Y20025-1000.0 | |
Peptone | Research Products International (RPI) | P20250-1000.0 | |
Dextrose | ThermoScientific | BP350-1 | |
Formaldehyde | Sigma-Aldrich | F8775 | |
Glycine | Fisher Scientific | AC12007-0050 | |
Tris | Amresco | 0497-5KG | |
EDTA | Sigma-Aldrich | E6758-500G | |
NaCl | ThermoScientific | BP358-10 | |
4-Nonylphenyl-polyethylene glycol | Sigma-Aldrich | 74385 | Equivalent to NP-40 |
MgCl | ThermoScientific | S25533 | |
CaCl2 | Sigma-Aldrich | 20899-25G-F | |
LiCl | ThermoScientific | AC413271000 | |
Sodium Dodecyl Sulfate | Amresco | M107-1KG | |
Sodium Deoxycholate | Sigma-Aldrich | 30970-100G | |
Sodium Acetate | Sigma-Aldrich | S2889 | |
NaHCO3 | ThermoScientific | S25533 | |
PMSF | Sigma-Aldrich | P7626-5G | |
Yeast protease inhibitor cocktail | VWR | 10190-076 | |
25 Phenol:24 Chloroform:1 Isoamyl Alcohol | VWR Life Science | 97064-824 | |
Ethanol | Sigma-Aldrich | E7023 | |
Nuclease-Free Water | VWR | 100720-992 | |
Micrococcal Nuclease | Worthington Biochemical | LS004797 | |
Glycogen | ThermoScientific | R0561 | |
Proteinase K | Research Products International (RPI) | P50220-0.1 | |
RNase A | Sigma-Aldrich | R6513-50MG | |
Bradford Assay Reagent | ThermoScientific | 23238 | |
BSA Standard 2 mg/mL | ThermoScientific | 23210 | |
α H4 | EMD Millipore | 04-858 | |
α H4K16ac | EMD Millipore | ABE532 | |
α H3 | Abcam | ab1791 | |
α H3K4me2 | Active Motif | 39142 | |
High Rox qPCR Mix | Accuris qMax Green, Low Rox qPCR Mix | ACC-PR2000-L-1000 | |
Protein A/G Magnetic Beads | ThermoScientific | 88803 | |
magnetic stand for 1.5mL tubes | Fisher Scientific | PI-21359 | |
Acid-Washed Glass Beads | Sigma-Aldrich | G8772 | |
Microtube Homogenizer | Benchmark | D1030 | |
2.0 mL screw-cap tubes with sealing rings | Sigma-Aldrich | Z763837-1000EA | |
Gel loading tips | Fisher Scientific | 07-200-288 | |
Cuvettes | Fisher Scientific | 50-476-476 | |
Parafilm | Fisher Scientific | 13-374-10 | |
50 mL conical tubes | Fisher Scientific | 14-432-22 | |
384-Well PCR Plate | Fisher Scientific | AB-1384W | |
Gyratory Floor Shaker | New Brunswick Scientific | Model G10 | |
Spectrophotometer | ThermoScientific | ND-2000c | |
Real-Time PCR Detection System | Bio-Rad | 1855485 |