Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Udarbejdelsen af perifere olfaktoriske væv for at udvikle molekylære og immunhistokemisk analyse i Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Vi præsenterer her, en protokol for at iscenesætte og dissekere udvikle olfaktoriske væv fra Drosophila arter. De dissekerede væv kan senere bruges til molekylære analyser, som kvantitativ RT-PCR (Reverse transkription-Polymerase Chain Reaction) eller RNA sekventering (RNAseq), samt i vivo analyser som Immunhistokemi eller i situ hybridisering.

Abstract

Den olfaktoriske system af Drosophila er et udbredt system i udviklingsmæssige neurobiologi, systemer neurovidenskab, såvel som neurofysiologi, adfærd og adfærdsmæssige udvikling. Drosophila olfaktoriske væv hus olfaktoriske receptor neuroner (ORNs), der registrerer flygtige kemiske signaler ud over hydro - og thermo-sensoriske neuroner. I denne protokol beskriver vi dissektion af udvikle perifere olfaktoriske væv voksen Drosophila arter. Vi beskriver først sådan fase og alder Drosophila larver, efterfulgt af dissektion af antennal disken fra puppe vorden, efterfulgt af dissektion af antenner fra midten af puppe faser og voksne. Vi viser også metoder hvor præparater kan udnyttes i molekylære teknikker, såsom RNA udvinding for qRT-PCR, RNAseq eller Immunhistokemi. Disse metoder kan også anvendes på andre Drosophila arter efter artsspecifikke puppe udviklingstider bestemmes, og respektive faser beregnes for passende aldring.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den olfaktoriske system af Drosophila er et udbredt system i udviklingsmæssige neurobiologi, systemer neurovidenskab, såvel som neurofysiologi, opførsel undersøgelser og adfærdsmæssige evolution1,2,3, 4. Drosophila olfaktoriske væv hus olfaktoriske receptor neuroner (ORNs), der registrerer flygtige kemiske signaler ud over hydro - og thermo-sensoriske neuroner1,5,6. Det overordnede mål for dette manuskript er at demonstrere, hvordan man på scenen og dissekere udvikle puppe og voksen olfaktoriske væv i Drosophila arter. Begrundelsen for denne teknik er at generere prøver fra forskellige puppe stadier for molekylær og udviklingsmæssige analyser af de perifere olfaktoriske system, såsom RNAseq og kvantitativ RT-PCR, desuden til i vivo væv mærkning teknikker . Denne teknik kan være særligt nyttigt til at identificere dynamikken i transcriptional profiler i den tredje voksen olfaktoriske system fra ikke -melanogaster Drosophila arter, som ikke har alle de transgene reagenser til celle typespecifikke mærkningsbestemmelserne og analyser. I dette håndskrift viser vi, hvordan dissekere antennal diske og antenner fra puppe og voksen Drosophila arter. Først, viser vi hvordan du identificere Drosophila 0 h af puparium dannelse (APF, hvid pupper eller prepupae) for udviklingsmæssige iscenesættelse og artsspecifikke aldring. Næste, vi viser hvordan man kan dissekere antennal diske og den tredje antennal segment; specifikt, hvordan at adskille dem fra øjet disc og andet antennal segment for væv renhed kræves til RNAseq eller RT-PCR'er. Faser i D. melanogaster beskrevet i denne protokol nogenlunde svarer til den pre mønstrede antennal disc (prepupae), udvælgelse af prækursorer fra den antennal disk (8 h APF), starten på den terminal differentiering til ORNs (40 h APF), og voksen antenne. Endelig giver vi eksempler for en kvantitativ RT-PCR fra voksen antenner isoleret ved hjælp af metoden, og for i vivo Immunhistokemi. Denne metode kan bruges til at generere prøver for en RNA/DNA analyse og Immunhistokemi på udvikle perifere olfaktoriske væv fra forskellige Drosophila arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Følgende protokol er i overensstemmelse med de etiske retningslinier på Duke University videnskabsetisk Komité.

1. Vævscentre præparat og udviklingsmæssige iscenesættelse af Drosophila melanogaster puppe

  1. For det første identificere hvor mange fluer vil være nødvendige for dissektion. RT-PCR og RNAseq, indsamle 100-200 antennal diske og antenner fra personer, som er nødvendig på prepupal, 8 h APF, 40 h APF, og voksen stadier. Immunhistokemi, dissekere 10-20 person.
  2. Rengør alle materialer, herunder dissektion puder og pincet, ved hjælp af klude med 70% EtOH. Hvis dissekeret materialet skal bruges til RNA ekstraktioner, rydde alt med RNase neutralizers og gøre alle løsninger ved hjælp af enten nukleasen-fri eller diethyletheren pyrocarbonate (DEPC) behandlet vand.
    Bemærk: Denne protokol bruger silikone dissektion puder i stedet for glas for dissektioner. Silikone underlag er venlige at ultra-fine pincet og fremme hurtig og høj kvalitet dissektioner.
  3. Indsamle puppe på 0 h APF/prepupal fase.
    1. For at sikre den mest præcise iscenesættelse, overvåge larver på 30 min. til 1 time intervaller.
      Bemærk: Vandrer tredje instar larver i en moderat overfyldt flaske vil sandsynligvis forpupper inden for et par timer.
    2. Når larver bliver immobil og er omgivet af en meget lys (næsten hvid) farvede puppe sag, overføre dem til en lille 2 - in petriskål med et fugtigt filtrerpapir.
    3. Fortsat for 1-2 h, lejlighedsvis overvågning, identificere og overførsel af prepupae.
      Bemærk: Alternativt, klart en flaske af alle pupper og tillade larver at udvikle for 2 h. Alle pupper indsamlet efter 2 h vil være inden for en 0 - 2 h APF området.
  4. Straks gå til trin 3.1 at dissekere prepupal antennal disken for 0 h APF fase. Hvis prepupa skal være alderen, samle dem i en skål, Dæk fadet og placere en paraffin film omkring kanterne til at hæmme tørhed og placere petriskålen ved 25 ° C.
    Bemærk: Pupper kan nu være alderen til eclosion.
  5. For pupper opsamlet i et 2 h udvalg, alder prepupae i 2 timer mindre end den ønskede alder for at sikre, at pupper ikke overdosering.
  6. Brug ultra-fine pincet (Dumont 55) som væv er meget lille og skrøbelig.

2. væv forberedelse og udviklingsmæssige iscenesættelse af puppe fra andre Drosophila arter

  1. Bestem længden af den puppe udvikling i andre Drosophila arter prøveemner på den optimale temperatur, optage de datoer, hvor prepupae overholdes, sortere dem i en frisk hætteglas og registrere antallet af dage fra prepupa til voksenalderen.
  2. Registrere forholdet mellem tid til puppe udvikling for ikke -melanogaster arter og melanogaster. Formere forholdet mellem den udviklingsmæssige tid med antallet af timer brugt for mellemstationer melanogaster for at få antallet af timer til alder ikke -melanogaster arter.

3. dissektion af D. melanogaster puppe Antennal Disc

Bemærk: Alle de forældelsesperiode gange og dissektion protokoller er beskrevet Drosophila melanogaster. For alle andre arter, vil en ændring af den aldrende protokol baseret på artsspecifikke udviklingsmæssige tidspunkter være påkrævet, som beskrevet ovenfor.

  1. Til puppe antennal disc dissektioner, indsamle 50-100 0 - 2 h eller 6-8 h gamle pupper ved hjælp af en spatel og placere dem på en dissektion pad.
  2. Der afpipetteres 150 µL af RNA isolering løsning i en RNase gratis 1,5 mL mikrofuge rør ved hjælp af en 200-µL pipette og placere røret på is.
  3. Dissekere pupper i 150-200 µL 1 x PBS (fosfatbufferet saltopløsning, nukleasen-fri). Placer flere dråber af PBS (150-200 µL pr. dråbe) på dissektion pad.
  4. Dissektion pad, placere 0 - 2 h eller 6-8 h alderen pupper (en puppe pr drop) for at blive dissekeret i en 1 x PBS dråber. Bruge tang i den ene hånd til at stabilisere kroppen.
  5. For 0 - 2 h alderen pupper, ved hjælp af pincet i anden hånden, holde på den mest forreste del (mund kroge) af prepupa og trække det til at afsløre hjerne og fantasiens skiverne fastgjort til den forreste puppe sag.
  6. For 8 h APF pupper, først blidt skrælle den puppe sag fra den mest forreste fjerdedel af puppe, udsætter hovedet inden for membran sækken, der omgiver kroppen.
    Bemærk: Kroppen, på dette stadium, ligner en udarter larve.
  7. Fjern hoved på halsen joint.
    Bemærk: Dette sikrer, at de antennal diske ikke bliver tabt, som på dette tidspunkt er primært tilsluttet optik lapper i hjernen.
  8. Overføre væv med hjerner og de imaginære diske til en anden 1 x PBS droplet med pincet eller en 20-µL pipette.
  9. Identificere øje-antennal disken forbundet til hjernen på optik fliger. Brug af pincet, afbryde øje-antennal disken fra hjernen og puppe-sagen. Overføre den til en ny 1 x PBS droplet med pincet eller en 20-µL pipette.
    Bemærk: Prepupal øje-antennal disken er en flad væv. Dog af pupper 8 h øje diskene er roteret cupping antennal-diske, der sidder foran den centrale hjernen.
  10. Brug af pincet, skære væv i stedet for forbindelsen mellem øjet og antennal disken. Bruge en 20-µL pipette til forsigtigt for at overføre de dissekerede væv til RNA isolering løsning reagens. Minimere mængden af væske overført når der afpipetteres en mængde så lille som muligt.
  11. Gentag, indtil alle pupper har været dissekeret.

4. dissektion af D. melanogaster Mid-puppe og voksen antenner

Bemærk: Ved 40 h APF, fleste af metamorfosen er fuldført, og de voksne strukturer bliver tydelige, men er stadig hvid og ubestemmelige. For denne udviklingsmæssige tidspunkt, voksen antennen har truffet sin endelige form endnu stadig er gennemsigtig og fleste af de olfaktoriske receptorer, bortset fra nogle få, har ikke startet udtryk.

  1. Til puppe antennal dissektioner, indsamle 50-100 prepupae som beskrevet i trin 1 og alder dem i 40 timer ved 25 ° C.
  2. Med pipette overfoeres 150 µL af RNA isolering løsning i en RNase gratis 1,5 mL microcentrifuge rør ved hjælp af en 200-µL pipette og placere røret på is.
  3. Dissektion pad, placere den puppe at blive dissekeret i en af 1 x PBS dråber. Bruge tang i den ene hånd til at stabilisere kroppen. Brug af pincet i anden hånden, forsigtigt skrælle den puppe sag fra den mest forreste fjerdedel af puppe, udsætter hovedet inden for membran sækken, der omgiver kroppen.
  4. Brug af pincet, omhyggeligt skåret af hovedet fra resten af den puppe kroppen ved at holde kroppen med et sæt af tang og rive hovedet ud på halsen fælles med et andet sæt af tang. Forsigtigt overføre hovedet ind i en anden 1 x PBS droplet med pincet. Pipetteres op og ned for at rense ud indholdet af hovedet (hjernen, etc.) at opnå en klar membran, der bruges til at omgive den udvikle Drosophila hoved.
    Bemærk: På 40-50 h APF, følehornene er forbundet med den forreste-mest del af membranen. De vil blive synlige for dissektion, når indholdet af hovedet er ryddet med pipettering.
  5. Brug af pincet, afbryde de puppe antenner fra membranen. Afbryde 2nd segment af antennen fra 3rd bruge pincet til skive på segmental leddet, som kun 3rd segmentet vil huse olfaktoriske receptor neuroner.
  6. Bruge en 20-µL pipette til forsigtigt for at overføre de dissekerede væv til RNA isolering løsning reagens. Minimere mængden af væske overført når der afpipetteres en mængde så lille som muligt. Gentag, indtil alle pupper har været dissekeret.
  7. For voksne antennal dissektioner, indsamle ca 50 voksne og alder dem for en uge efter eclosion.
    Bemærk: Udtryk for olfaktoriske receptor gener og andre gener peak en uge efter eclosion. Voksne er alderen for en uge at sikre biologisk relevante gener med lav overflod udskrifter til at hæve sig over påvisningsgrænsen.
  8. Dissekere fluer til RNA ekstraktioner, mens de er stadig i live på en CO2 pad. Behandle CO2 pad med RNase hæmmere. For Konfokal imaging, dissekere fluer på en dissektion pad i 1 x PBS eller PBS + 0,2% Triton.
  9. Første, sætte de voksne til at sove på CO2 station pad omfattet dissektion. På CO2 station pad, bruger Tang i den ene hånd til at stabilisere kroppen, bruge pincet i anden hånden til forsigtigt trække/knivspids ud den tredje antennal segment fra andet.
  10. Overføre antenner i en RNA isolering løsning, ved hjælp af pincet til at placere antenner direkte i væsken. Gentag, indtil alle voksne har været dissekeret.
    Bemærk: Sikre, at antennen er neddykket i RNA isolering løsning. Antennen kan blive hængende på siden af røret. Dette vil medføre en øget nedbrydning af RNA, reducere RNA kvalitet og kvantitet.
  11. Direkte videre til RNA udvinding eller placere røret ved-80 ° C til langtidsopbevaring.

5. RNA isolering fra dissekeret væv

  1. Fjern alle prøver fra-80 ° C opbevaring og tø dem på is.
  2. Kort spin (5-6 s, ~ 6.000 x g) hver prøve for at indsamle materialet i bunden af røret.
  3. Male hver prøve ved hjælp af en elektrisk motor og en autoklaveres plast pistillen for 10 s på is.
  4. Gentag trin 5.2 og 5.3 4.
  5. Udføre RNA udvinding ved hjælp af kommercielt tilgængelige kits og efter fabrikantens protokoller for en optimal udbytte.
  6. Udføre qRT-PCR ved hjælp af kommercielt tilgængelige reagenser og specifikke primere mod gener af interesse og efter fabrikantens protokoller.
    1. Udføre alle PCR reaktioner ved hjælp af følgende betingelser: 95 ° C denaturering i 10 min efterfulgt af 40 cyklusser af 95 ° C til 15 s, 55 ° C til 30 s og 60 ° C i 30 s.
      Bemærk: Primer par til DIP og dpr gener er angivet i tabel 1, og primere for olfaktoriske receptor gener er opført i Hueston CE et al. 8.

6. fiksering af puppe Antennal diske og antenner for Immunhistokemi

Bemærk: Løse væv i partier fra 10-20 personer til at sikre, at væv er fastsat for den samme mængde tid. Minimere mængden tid prøverne bo i PBT (PBS med vaskemiddel) før overføre dem til en fiksativ at maksimere integriteten af væv.

  1. Indsamle dissekeret antennal diske eller puppe antenner i 200 µL PCR rør indeholdende 200 µL af 0,2% PBT på is til at bevare vævet intakt, og at undgå prøve klistrer til væggen i 200 µL PCR rør som vil føre til en ufuldstændig fiksering.
    Bemærk: Puppe antenner og antennal diske kan være svært at se som de er helt gennemsigtigt. Det er tilrådeligt at bruge en dissektion anvendelsesområdet for alle vask skridt til at forhindre tab af væv. Alternativt, 96-brønd Terasaki plader kan være anvendes til fiksering og farvning bedst spore væv.
  2. Fix dissekeret antennal disken og antennal prøver fra pupper i ca 200 µL af 4% PFA (PARAFORMALDEHYD) i 30 min ved stuetemperatur. For dette og de efterfølgende holde trin, rør med prøverne på en nutator til korrekt Bland prøver i løsningen. Fremskridt til trin 6.7.
  3. For den voksne antenne, dissekere hele hovedet først og ordne det i ca. 200 µL af 4% PFA (PARAFORMALDEHYD) i 1 time ved stuetemperatur.
  4. Vask 3 x med 200 µL af 0,2% PBT i 10 min. Holde prøverne på nutator under inkubation.
  5. Gå tilbage til dissektion mikroskop for en finere dissektion af den anden antennal segment fra faste hoveder. Brug af pincet til at stabilisere hovedet, forsigtigt trække/knivspids ud den tredje antennal segment fra andet.
  6. Overføre de dissekerede tredje antennal segmenter til ca. 200 µL af 4% PFA (PARAFORMALDEHYD) og lave dem i 30 min. ved stuetemperatur.
  7. Vask 3 x med 200 µL af 0,2% PBT i 10 min. Holde prøverne på nutator under inkubation.
  8. Opbevare prøver ved 4 ° C eller fortsætte direkte med hele mount Immunhistokemi.
    Bemærk: Effektiviteten af farvning kan skifte, når der bruges antistoffet. Denne metode bør være egnet til mindre rigelige protein tags eller svagere antistoffer. Til tider kan det dog kræve en optimering af protokollen (identitet eller størrelsen af fixativ eller tidspunktet for fiksering).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De dissekerede udvikle olfaktoriske væv kan bruges til RNA ekstraktion efterfulgt af RT-PCR til at vurdere genekspression eller kan tages gennem Immunhistokemi protokoller til at bestemme dens udtryk mønster og subcellulære lokaliseringen af gener i interesse. I dette afsnit præsenterer vi repræsentative resultater fra enten protokol. Figur 1 er den repræsentative kvantitativ RT-PCR viser transskription af celle overflade receptor og olfaktoriske receptor gener i wild-type voksen antenner. Figur 2 viser 6-8 h og 12 h APF antennal disc stainings på Rn-EGFP transgene fluer ved hjælp af anti-normal god landbrugspraksis (1:1000) og anti-Eigil antistoffer (1: 100) (fig. 2A og 2B). Rn-EGFP etiketter særlige regioner i antennal disken under puppe vorden. Vi viser også 40 h APF puppe antennal anti-normal god landbrugspraksis antistoffarvning af Or67d-GAL4 UAS-CD8GFP transgene fluer, og voksen antennal anti-elav (1: 100) antistoffarvning af ORNs (figur 2). Andre eksempler kan også findes i litteratur7,8,9,10.

Figure 1
Figur 1 . Kvantitativ RT-PCR fra wild-type adult antennal RNA prøver for forskellige gener. Disse paneler viser kvantitativ RT-PCR-resultater for (A) DIP-alpha, DIP-eta, dpr5, dpr8, Simon, beatIIIb (for primer par se tabel 1), og (B) olfaktoriske og ionotropic receptor (eller / Ir) gener fra voksen antennal RNA prøver. Fejllinjer Vis en standard fejl af middelværdien (SEM). Eller / Ir gener er lav overflod RNA'er, der stadig kan registreres af qRT-PCR. Udtryk for hvert gen blev analyseret i tre eksemplarer. CT værdier blev brugt til at beregne fortynding faktorer for hvert gen baseret på standard kurver oprettet for hvert Gen. Fortynding faktorer blev derefter normaliseret for hvert gen til den gennemsnitlige udtryk for alle gener måles som beskrevet før8. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 . Immunhistokemi med forskellige antistoffer på udvikle olfaktoriske væv. Disse paneler viser anti-normal god landbrugspraksis (grøn) og anti-Eigil (rød) antistof stainings på (A) 6 h APF puppe antennal diske og (B) 12 h APF puppe antennal diske. (C) dette panel viser en 40 h APF antenne fra Or67d GAL4 UAS-CD8GFP transgenics farves med kanin anti-normal god landbrugspraksis (grøn) antistoffer. (D) dette panel viser voksen antenner farves med anti-CD2 antistoffer, hvilken etiket Or47b-CD2 positive ORNs (magenta). Venligst klik her for at se en større version af dette tal.

Fremad primer Omvendt primer Længde
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tabel 1. Liste over PCR primere bruges i qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokol er en nyttig ressource for labs interesseret i at identificere de genetiske og transcriptional programmer opererer i udvikle Drosophila olfaktoriske væv, samt en sammenlignende analyse af disse programmer på tværs af Drosophila arter. Det er især nyttigt, hvis systemer-niveau transcriptional profiler fra forskellige udviklingsstadier er nødvendig som en primer for fremtidige undersøgelser. Protokollen beskrevet her demonstrerer, hvordan man på scenen og isolere udvikle olfaktoriske væv fra Drosophila at få prøver fra fire vigtige faser af olfaktoriske systemudvikling fra før mønstre til terminal differentiering, der skal bruges i molekylære og immun-histologiske undersøgelser. Dissekeret Drosophila antennal diske og antenner på forskellige puppe stadier kan bruges til at identificere genet udtryk profiler under olfaktoriske systemudvikling på systemniveau af RNA-seq eller på niveau med enkelte gener ved kvantitativ RT-PCR. Prøver kan også bruges til Immunhistokemi og i situ hybridisering til at identificere i vivo mønstre af væv-specifikke genekspression. En yderligere fordel ved denne protokol er at dissekeret prøver kan være yderligere adskilles ved hjælp af standard metoder og FAC-sorteret at få renset cellulære indbyggere (eller enkelte celler) til celle type-specifikke molekylære analyser, såsom kvantitative RT-PCR eller RNAseq.

Selv om protokollen viser dissektioner af antennal diske og antenner fra puppe (på 0 h/prepupa, 8 h og 40 h APF) og voksen faser, kan det tilpasses til andre puppe tidspunkter. Det er også værd at nævne, at lære disse dissektioner tager tid og øvelse. En ekspert bør kunne dissekere 50 prøver en time. Det er vigtigt at ikke overdosering af pupper. Derfor, en time før starten dissektion, sikre, at ingen pupper er ældre end den ønskede alder. Dissektioner kan tage tid at lære, så en periode af praksis for hver etape er nødvendig før du starter eksperimenter. Dissektioner blevet vanskeligere fra 9-12 h APF morfologiske ændringer. Det er muligt at sortere pupper af alder når indsamling prepupae (ved organ farve, med mørkere farver bliver ældre). I første omgang sortering prepupae giver mulighed for dissektion i rækkefølge efter alder at forhindre vare.

Protokollen beskrevet ovenfor kan anvendes til andre Drosophila arter. Timingen for de puppe dissektioner af andre arter kan være baseret både på forholdet mellem den puppe udvikling af en given art ved 25 ° C til D. melanogaster og sammenlignende observationer af antenner/antennal disc morfologi under dissektioner, med en prioritet til morfologiske overvejelser at være så enslydende som muligt. For Drosophila melanogastertager den puppe stadie ca. 4 dage. D. sechellia og D. erecta puppe udviklingsmæssige iscenesættelse ligner D. melanogaster; D. virilis puppe udvikling er imidlertid 1,3 x længere11,12. Når andre arter er forberedt til dissektion, bør iscenesættelsen baseres på begge timingen af perioden puppe og sammenlignende observationer af fase-specifikke antenner/antennal disc morfologi, med de morfologiske lighed er den højeste prioritet. Første, identificere den optimale håndtering temperatur for de arter, du er interesseret i. Mange arter vokser godt ved 25 ° C, men detaljerede oplysninger om vedligeholdelsesbetingelser kan fås fra UC San Diego Drosophila arter stock center.

De mest kritiske trin i protokollen er korrekte iscenesættelse og ordentlig dissektion af væv af interesse i passende tal fra forskellige arter. Når disse er på plads, protokollen giver en effektiv metode til væv samling af sådanne analyser og kan tilpasses næsten enhver udvikling fantasiens disc væv under de puppe stadier i enhver Drosophila arter.

En begrænsning af denne protokol er at det ikke indeholder celle type-specifikke prøver. En mere detaljeret forståelse af cellulære funktion og morfologi, der kræver celle type-specifikke profilering af transskription på systemer plan, ud over standard molekylære procedurer såsom kvantitativ RT-PCR eller Immunhistokemi. Celle typespecifikke profilering har været vanskeligt, især i betragtning af manglen på celle typespecifikke reporter transgenics i ikke -melanogaster arter. Med de nuværende fremskridt i cellulære profilering, transgenics og CRISPR-Cas9 medieret genom-redigering i ikke -melanogaster arter, det er nu muligt at mærke og sortere ud enkelt celler af interesse at profilere transskription13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Denne undersøgelse blev støttet af en bevilling fra National Science Foundation til Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Udarbejdelsen af perifere olfaktoriske væv for at udvikle molekylære og immunhistokemisk analyse i <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter